SEARCH

SEARCH BY CITATION

Keywords:

  • polygenic;
  • balanced translocation;
  • uniparental disomy chromosome 5;
  • duplication 5q11;
  • RHOXF2

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Here, we describe a female patient with autism spectrum disorder and dysmorphic features that harbors a complex genetic alteration, involving a de novo balanced translocation t(2;X)(q11;q24), a 5q11 segmental trisomy and a maternally inherited isodisomy on chromosome 5. All the possibly damaging genetic effects of such alterations are discussed. In light of recent findings on ASD genetic causes, the hypothesis that all these alterations might be acting in orchestration and contributing to the phenotype is also considered. © 2012 Wiley Periodicals, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Autism spectrum disorders (ASD) are a group of neurodevelopmental diseases with onset in early childhood, characterized by impairments in social and communicative skills and a repertoire of repetitive behaviors. The latest studies have consistently provided an estimated prevalence of 0.6% for these disorders [Fombonne, 2009]. It is widely accepted that ASD have a strong genetic component, with a high heritability index [El-Fishawy and State, 2010]. However, their genetic architecture is very heterogeneous, and both multifactorial and Mendelian models seem to play a role in ASD etiology. Despite the enormous effort to identify the genetic factors and mechanisms involved in ASD, still very few genes have been definitely associated with this complex disorder.

It is estimated that chromosomal abnormalities, such as translocations, inversions, deletions, and duplications, are present in around 3% of ASD cases [Vorstman et al., 2006]. More recently, an increasing number of rare potentially pathogenic submicroscopic duplications or deletions, the copy number variations (CNVs), have been identified in approximately 5–10% of ASD patients [Szatmari et al., 2007; Marshall et al., 2008; Pinto et al., 2010; van Daalen et al., 2011]. Mapping of the boundaries of chromosomal translocations, examination of overlapping regions among duplications or deletions of different sizes and analysis of CNVs have allowed the identification of genes that have become strong candidates for ASD, such as SHANK3, NLGN3/4, and NRXN1 [Laumonnier et al., 2004; Durand et al., 2007; Kim et al., 2008]. Thus, chromosomal alterations represent an important etiological mechanism associated with ASD and their molecular and genomic analysis is a useful approach to investigate the genetics of these disorders.

In this report, we describe the clinical features and molecular characterization of chromosomal abnormalities of a female patient with ASD, developmental delay, and craniofacial dysmorphism.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Clinical Evaluation

A detailed anamnesis and a three-generation pedigree, as well as a physical examination were performed. Blood from the proband and her parents was collected for DNA and karyotype analysis. The study was approved by the Ethical Committee of Bioscience Institute—University of São Paulo.

Karyotype and FISH Studies

Metaphase slides were obtained from peripheral blood lymphocytes treated with colchicine and conventional G-banded karyotype was performed for the patient and her parents.

For breakpoint mapping, FISH analysis (fluorescent in situ hybridization) was carried out using bacterial artificial chromosomes (BACs) from the RPCI-11 library. BACs were selected from UCSC genome Browser (http://genome.ucsc.edu/, hg18) and labeled using nick translation reaction [Lichter et al., 1990]. Hybridization of the probes to the patient's metaphase slides was performed following standard procedures. Images were analyzed with the Openlab v.5.5 software and in silico analysis were performed using the UCSC genome browser and National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) databases. All the genes localized 1 Mb distal or proximal from the breakpoint were investigated in regard to their function, site of expression, interaction with other genes, associated diseases, animal models and relation to neurological function and psychiatric diseases.

SNP-Based Microarray Analysis

Patient's DNA sample was hybridized on Illumina Human CNV 370k BeadChips, following the manufacturer's protocol. Data were analyzed using PennCNV [Wang et al., 2007] and QuantiSNP [Colella et al., 2007] software packages. The CNVs found were compared to the Database of Genomic Variants (http://projects.tcag.ca/variation/), Autism CNV Database (http://projects.tcag.ca/autism_500k/) and Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources (DECIPHER; http://decipher.sanger.ac.uk/) to identify common and rare variants, as well as recurrence of variants in other autistic patients.

Microsatellite Analysis

Patient, mother, and father were genotyped for the markers D5S1981, D5S416, D5S644, D5S2027, D5S408 (ABI PRISM Linkage Mapping Set version 2.0; Perking Elmer, Applied Biosystems, Foster City, CA), D5S2092, D5S2076, D5S2102, and D5S2107 (M-13 tailed primers). The results were analyzed with GeneMapper Software v4.0 (Applied Biosystems).

Isolation of Human Dental Pulp Stem Cells

Dental pulp stem cells (DPSCs) lineages were obtained after digestion of dental pulp tissues with a solution of 0.25% trypsin for 30 min at 37°C. The cells were cultivated in DMEM/F12 media (Gibco, Carlsbad, CA) supplemented with 15% fetal bovine serum (Hyclone, Logan, UT), 1% penicillin/streptomycin and 1% non-essential amino acids and maintained under standard conditions (37°C, 5% CO2).

RNA Isolation and Quantitative Real-Time PCR

RNA samples were extracted from DPSCs using the NucleoSpin RNA II (Macherey-Nagel, Düren, Germany) extraction kit. Samples concentration and quality were evaluated by Nanodrop 1000 and gel electrophoresis. RNA samples were reversely transcribed into cDNA using the Super Script II First Strand Synthesis System (Invitrogen, Carlsbad, CA) according to manufacturer's instructions. Primers were designed using PrimerExpress v. 2.0 software and their specificity was verified by melting curve analysis on 7500 System SDS v. 1.2 Software (Applied Biosystems; Table I). Reactions were run on an Applied Biosystems 7500 sequence detection system using SYBR-Green Master Mix (Applied Biosystems). Quantitative analysis was performed using the comparative threshold cycle method [Livak and Schmittgen, 2001]. The geNorm applet (www.medgen.ugent.be/genorm/) was used to determine the stability of the reference genes GAPDH, HPRT1, SDHA, and HMBS and generate a normalization factor for the expression values of the target genes. The principles of analysis of geNorm are described in Vandesompele et al. [2002].

Table I. Primer Sequences Used for qPCR Experiments
GenePrimer FPrimer R
GAPDHTGCACCACCAACTGCTTAGCGGCATGGACTGTGGTCATG
HMBSGGCAATGCGGCTGCAAGGTAAGGCACGCGAATCAC
HPRT1TGACACTGGCAAAACAATGCGTCCTTTTCACCCAGCAAGC
SDHATGGGAACAAGAGGGCATCTGCCACCACTGCATCAAATTCATG
UBE2ACCAGGCTGCTCAGCTGTACCGGGGTCAACAATCACGC
GLUD2GGGAGTCTGAGAAAGCGCACAGGTAGCGGTACATCGCGG

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Clinical History

The patient, a girl who is currently 10 year-old, was born to a 27-year-old mother and 33-year-old father, both healthy and non-consanguineous. She was born at term after an uncomplicated pregnancy except for placental infarction at the 30th week. There was no history of medication use or alcohol consumption during pregnancy. Birth weight and length was 2.355 kg (<10th percentile) and 45 cm (<10th percentile), respectively, and her Apgar scores were 9 at 1 min and 10 at 5 min. Her older sister is healthy and the parents did not report any case of developmental delay or psychiatric diseases in their first relatives.

The first signs of developmental problems noted by the parents were hypotonia, motor delay, and excessive crying at night. She sat without support at 8 months of age, walked at 24 months and still suffers from lack of sphincter control. No alterations were found in neuroimaging exams (cranial CT scan and brain MRI). She has lack of spoken language, weakly compensated by other forms of communication, a low level of cognitive functioning, poor eye contact and impaired social interaction skills. The patient met the DSM-IV criteria for pervasive developmental disorder not otherwise specified (PDDNOS), one of the categories within ASD. This diagnosis was supported by the administration of the Childhood Autism Rating Scale (CARS) [Schopler et al., 1980] and a questionnaire based on Autism Diagnosis Interview–Revised (ADI-R) [Lord et al., 1994].

On physical examination, the patient shows dysmorphic facial features, comprising blepharophimosis, short philtrum, everted lips, prominent central incisors and ears. Ophthalmologic evaluation disclosed high myopia. The craniofacial alterations do not fulfill clinical criteria for any known genetic syndrome.

Cytogenetic Characterization

G-banded karyotype revealed a balanced translocation between chromosome 2 and X [46,XX, t(2;X)(q11;q24)] in the proband (Fig. 1A). Parent karyotypes were normal.

thumbnail image

Figure 1. Chromosomal translocation (X:2)(q24;q11). A: Partially karyotype and ideogram of the proband's normal and derivatives chromosomes 2 and X. B: Metaphase spreads showing green FISH signal obtained for RP11-34G16 and schematic representation of breakpoint area on chromosome 2. C: Metaphase spreads showing red signal obtained for RP11-42G22 and schematic representation of breakpoint area on chromosome X.

Download figure to PowerPoint

The BAC clone RP11-34G16 spans the breakpoint on chromosome 2 (Fig. 1B). In the region covered by this BAC, there are three transcripts of non-characterized proteins: BC016831, AK 057596, and AL832439.

The BAC clone RP11-42G22 hybridized to both derivative 2 and derivative X as well as to normal X, and BAC RP11-631P19 was found to be distal to the breakpoint (Fig. 1C). This result indicates the disruption of the transcript AK123976 and places the breakpoint in a region that also spans two other genes: RHOXF1 (Rhox homeobox family, member 1, originally called OTEX) and RHOXF2 (Rhox homeobox family, member 2, originally called PEPP2). We were unable to confirm if these genes were disrupted since no probes were available to narrow down the breakpoint area.

Microarray data revealed that the patient is homozygous for all the SNP markers on chromosome 5, suggesting uniparental isodisomy (UPD) (Fig. 2A). Patient and parents were genotyped for five microsatellite markers, distributed along the entire chromosome, which showed that the isodisomy was maternally inherited (Fig. 2B). Furthermore, we also identified a duplication on chromosome 5q11, ranging from ∼49.5 to ∼52.1 Mb (Fig. 2A,C). The duplication was confirmed by the presence of a microsatellite marker (D5S2107) in heterozygosity in this region (Fig. 2B), which was the only informative marker out of the four tested.

thumbnail image

Figure 2. Isodisomy and segmental trissomy on chromosome 5. A: Signal log ratio (top) and B allele frequency distribution plot (bottom) for chromosome 5 generated by SNP array genotyping. The graphs show the duplication on 5q11 and the loss of heterozygosity on the entire chromosome, indicating the presence of isodisomy. B: Localization of the six microsatellite markers analyzed (left) and genotype of these markers for parents and proband, indicating that both proband's chromosome 5 were maternally inherited. Note that the patient is heterozygous for the marker D5S2092, confirming the segmental trisomy of this region. C: Region 5q11 in detail, showing the presence of SNP markers in heterozigosity between ∼45.5 and ∼52.1 Mb.

Download figure to PowerPoint

Expression Studies

Near the breakpoints there are two functionally important genes, UBE2A and GLUD2. GLUD2 is not abundantly transcribed in DPSC, and therefore we only investigated the expression levels of UBE2A. qPCR analysis showed that transcriptional levels of UBE2A in DPSCs from the studied patient are not significantly different from the controls (Normalized expression values—patient: 1.02; controls: 1.22 ± 0.22; Mann–Whitney test P = 0.78).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

We identified a girl with ASD who has a de novo balanced translocation involving the chromosomes 2q11 and Xq24. By FISH analysis, we could only confirm the disruption of AK123976, located on chromosome X, which is yet a very poorly characterized transcript. The breakpoint region on chromosome X also spans RHOXF1 and RHOXF2 genes. Although it has not been tested in neuronal tissue yet, there are evidences that RHOXF2 can regulate the expression of genes that play important roles in nervous system, such as axonal guidance, neuronal migration and signal transduction in neurons [Liu et al., 1999; Vuletic et al., 2005; Round and Stein, 2007; Hu et al., 2008; Hu et al., 2010].

It is possible that chromosomal balanced translocations disrupt regulatory elements important to control the surrounding genes of the breakpoint regions [Fenton et al., 2006; Cinquetti et al., 2008]. We notice that there are potential candidates near the chromosome X breakpoint: UBE2A at 468 kb and GLUD2, at 845 kb distal. Nonsense mutation in UBE2A seems to be a cause of mental retardation [Nascimento et al., 2006]. This gene encodes an ubiquitin-conjugating enzyme (E2), which interacts with UBE3A, the gene responsible for Angelman Syndrome, a phenotype that frequently presents ASD as comorbidity [Veltman et al., 2005]. On the other hand, GLUD2 encodes the enzyme glutamate dehydrogenase 2, important for the metabolism of the neurotransmitter glutamate. Several lines of evidence implicate glutamatergic neurotransmission system in ASD etiology [Jamain et al., 2002; Serajee et al., 2003; Shuang et al., 2004]. Although our data on the expression levels of GLUD2 were inconclusive, we observed that UBE2A did not differ between patient and control cells suggesting that the translocation does not affect UBE2A regulation.

The patient also presents a duplication of approximately 2.5 Mb on chromosome 5q11. The duplication is of paternal origin, suggesting that this alteration and the UPD was very possibly generated by an incomplete rescue of trisomy on chromosome 5. On karyotyping, we did not detect supernumerary chromosomes, suggesting that this segment is probably inserted somewhere in the genome, for instance on chromosomes involved in the translocation or on chromosome 5. Therefore, disruption of genes or regulatory regions caused by the insertion of this segment might be also contributing to phenotype. Although the genes located within this segment seem not be involved in neuronal development, we cannot exclude gene dosage effect as an additional mechanism contributing to the psychiatry alterations of this patient. In this regard, it is worthy to mention that at least two other cases of patients presenting mental retardation have been reported to have copy number variations involving this region [DECIPHER database http://decipher.sanger.ac.uk/patient/253998 and Barbosa-Melo et al., 2011].

To our knowledge, the studied case represents the second case in the literature of UPD on the entire chromosome 5, but the first of maternal origin. A first report on UPD on the entire chromosome 5, however of paternal origin, was described in a boy with spinal muscular atrophy (SMA) [Brzustowicz et al., 1994], a disorder mostly caused by homozygous deletions at the SMN1 gene, located at 5q11.2-q13.3 [Matthijs et al., 1996]. It was suggested that SMA in this boy was probably caused by the transmission of two copies of a paternal defective gene, instead of parental imprinting effects, since the patient does not present any other developmental abnormalities.

A case of paternal segmental isodisomy on chromosome 5q32-qter was identified in a patient diagnosed with childhood onset schizophrenia (COS) [Seal et al., 2006], a disorder that presents clinical symptoms and etiological mechanisms that overlaps with ASD [Ching et al., 2010; Gauthier et al., 2010]. In the region involved in the segmental isodisomy seen in the COS patient, more exactly on chromosome 5q34-q35.1, there is a cluster of gamma-aminobutyric acid (GABA) receptor subunit genes: GABRB2, GABRA6, GABRA1, GABRG2, and GABRP. GABAergic neurotransmission system has been implicated in the etiology of autism and schizophrenia [Ma et al., 2005; Schmitz et al., 2005; Fatemi et al., 2009; Gonzalez-Burgos et al., 2010].

Considering that UPD on chromosome 5 does not necessarily lead to behavioral abnormalities, it seems more likely that recessive mutations on maternal chromosome 5 inherited by this girl could be leading to ASD symptoms instead of imprinting effects caused by the UPD. In this regard, several candidate genes and regions on chromosome 5 have already been related to ASD and are summarized in Table II.

Table II. Candidate Genes and Regions for ASD on Chromosome 5
Gene/regionAssociated disorder/evidenceRefs.a
  • a

    ASD cases with chromosomal abnormalities such as translocations, duplications, deletions and inversions involving chromosome 5 that are not associated with the disorders mentioned above can be revised in Vorstman et al. [2006].

NIPBL (5p13.2)Cornelia de Lange syndrome (47–67% of individuals with de Lange syndrome have ASD)

Basile et al. [2007

]; Berney et al. [1999

]; Bhuiyan et al. [2006

]; Moss et al. [2008

]; Oliver et al. [2008

]
MEF2C (5q14)5q14 microdeletion syndrome

Berland and Houge [2010

]; Novara et al. [2010

]; Nowakowska et al. [2010

]; Zweier et al. [2010

]
ALDH7A1 (5q23.2)Pyridoxine-dependent epilepsy (3 out of 64 cases described are reported to have ASD)

Bennett et al. [2009

]; Burd et al. [2000

]; Mills et al. [2010

]
NSD1 (5q35.2-q35.3)Sotos syndrome

Battaglia and Carey [2006

]; Bolton et al. [2004

]; Kielinen et al. [2004

]
SEMA5A (5p15)Association studyWeiss et al. [2005]
PITX1 (5q31)Association study

Philippi et al. [2007

]
5p15.2-p15.33Cri du Chat syndrome (39% of individuals with Cri du Chat syndrome have ASD)

Cantu et al. [1990

]; Dykens and Clarke [1997

]; Marshall et al. [2008

]; Moss et al. [2008

]
5p14Association studies

St Pourcain et al. [2010

]; Ma et al. [2009]; Wang et al. [2009

]

In face of the genetic complexity of this case and the almost uniqueness of such alterations, even among ASD cohorts, we cannot rule out the possibility that all of the alterations found in this patient might contribute to the behavioral phenotype. In this regard, some examples of apparently oligogenic model of inheritance in ASD have been listed in the literature [Bakkaloglu et al., 2008; Poot et al., 2010; Leblond et al., 2012], and a deeper discussion on this theme can be found elsewhere [Jones and Szatmari, 2002; Cook and Scherer, 2008; Girirajan and Eichler, 2010; Poot et al., 2011]. Functional studies of the genes involved in the translocation and duplication as well as next generation sequencing of chromosome 5 might help in the near future to elucidate some of these questions.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

We would like to thank the patient and her family, as well as Cassio Eduardo Raposo do Amaral for their contribution to this study. This work was supported by CNPq and FAPESP/CEPID grants.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • Bakkaloglu B, O'Roak BJ, Louvi A, Gupta AR, Abelson JF, Morgan TM, Chawarska K, Klin A, Ercan-Sencicek AG, Stillman AA, Tanriover G, Abrahams BS, Duvall JA, Robbins EM, Geschwind DH, Biederer T, Gunel M, Lifton RP, State MW. 2008. Molecular cytogenetic analysis and resequencing of contactin associated protein-like 2 in autism spectrum disorders. Am J Hum Genet 82(1): 165173.
  • Barbosa-Melo J, Backx L, Vermeesch JR, Santos HG, Sousa AC, Kosyakova N, Weise A, von Eggeling F, Liehr T, Carreira IM. 2011. Chromosome 5 derived small supernumerary marker: Towards a genotype/phenotype correlation of proximal chromosome 5 imbalances. J App Genet 52(2): 193200.
  • Basile E, Villa L, Selicorni A, Molteni M. 2007. The behavioural phenotype of Cornelia de Lange Syndrome: A study of 56 individuals. J Intellect Disabil Res 51: 671681.
  • Battaglia A, Carey JC. 2006. Etiologic yield of autistic spectrum disorders: A prospective study. Am J Med Genet C Semin Med Genet 142C: 37.
  • Bennett CL, Chen Y, Hahn S, Glass IA, Gospe SM Jr. 2009. Prevalence of ALDH7A1 mutations in 18 North American pyridoxine-dependent seizure (PDS) patients. Epilepsia 50: 11671175.
  • Berland S, Houge G. 2010. Late-onset gain of skills and peculiar jugular pit in an 11-year-old girl with 5q14.3 microdeletion including MEF2C. Clin Dysmorphol 19: 222224.
  • Berney TP, Ireland M, Burn J. 1999. Behavioural phenotype of Cornelia de Lange syndrome. Arch Dis Child 81: 333336.
  • Bhuiyan ZA, Klein M, Hammond P, van Haeringen A, Mannens MM, Van Berckelaer-Onnes I, Hennekam RC. 2006. Genotype–phenotype correlations of 39 patients with Cornelia De Lange syndrome: The Dutch experience. J Med Genet 43: 568575.
  • Bolton PF, Veltman MW, Weisblatt E, Holmes JR, Thomas NS, Youings SA, Thompson RJ, Roberts SE, Dennis NR, Browne CE, Goodson S, Moore V, Brown J. 2004. Chromosome 15q abnormalities and other medical conditions in individuals with autism spectrum disorders. Psychiatr Genet 14: 131137.
  • Brzustowicz LM, Allitto BA, Matseoane D, Theve R, Michaud L, Chatkupt S, Sugarman E, Penchaszadeh GK, Suslak L, Koenigsberger MR, et al. 1994. Paternal isodisomy for chromosome 5 in muscular atrophy child with spinal. J Med Genet 54(3): 482488.
  • Burd L, Stenehjem A, Franceschini LA, Kerbeshian J. 2000. A 15-year follow-up of a boy with pyridoxine (vitamin B6)-dependent seizures with autism, breath holding, and severe mental retardation. J Child Neurol 15: 763765.
  • Cantu ES, Stone JW, Wing AA, Langee HR, Williams CA. 1990. Cytogenetic survey for autistic fragile X carriers in a mental retardation center. Am J Ment Retard 94: 442447.
  • Ching MS, Shen Y, Tan WH, Jeste SS, Morrow EM, Chen X, Mukaddes NM, Yoo SY, Hanson E, Hundley R, Austin C, Becker RE, Berry GT, Driscoll K, Engle EC, Friedman S, Gusella JF, Hisama FM, Irons MB, Lafiosca T, LeClair E, Miller DT, Neessen M, Picker JD, Rappaport L, Rooney CM, Sarco DP, Stoler JM, Walsh CA, Wolff RR, Zhang T, Nasir RH, Wu BL, Children's Hospital Boston Genotype Phenotype Study Group. 2010. Deletions of NRXN1 (neurexin-1) predispose to a wide spectrum of developmental disorders. Am J Med Genet Part B 153B(4): 937947.
  • Cinquetti R, Badi I, Campione M, Bortoletto E, Chiesa G, Parolini C, Camesasca C, Russo A, Taramelli R, Acquati F. 2008. Transcriptional deregulation and a missense mutation define ANKRD1 as a candidate gene for total anomalous pulmonary venous return. Hum Mutat 29(4): 468474.
  • Colella S, Yau C, Taylor JM, Mirza G, Butler H, Clouston P, Bassett AS, Seller A, Holmes CC, Ragoussis J. 2007. QuantiSNP: An objective Bayes Hidden-Markov Model to detect and accurately map copy number variation using SNP genotyping data. Nucleic Acids Res 35(6): 20132025.
  • Cook EH Jr, Scherer SW. 2008. Copy-number variations associated with neuropsychiatric conditions. Nature 455(7215): 919923.
  • Durand CM, Betancur C, Boeckers TM, Bockmann J, Chaste P, Fauchereau F, Nygren G, Rastam M, Gillberg IC, Anckarsäter H, Sponheim E, Goubran-Botros H, Delorme R, Chabane N, Mouren-Simeoni MC, de Mas P, Bieth E, Rogé B, Héron D, Burglen L, Gillberg C, Leboyer M, Bourgeron T. 2007. Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders. Nat Genet 39(1): 2527.
  • Dykens EM, Clarke DJ. 1997. Correlates of maladaptive behavior in individuals with 5p- (cri du chat) syndrome. Dev Med Child Neurol 39: 752756.
  • El-Fishawy P, State MW. 2010. The genetics of autism: Key issues, recent findings, and clinical implications. Psychiatr Clin North Am 33: 83105.
  • Fatemi SH, Reutiman TJ, Folsom TD, Thuras PD. 2009. GABA(A) receptor downregulation in brains of subjects with autism. J Autism Dev Disord 39(2): 223230.
  • Fenton JA, Schuuring E, Barrans SL, Banham AH, Rollinson SJ, Morgan GJ, Jack AS, van Krieken JH, Kluin PM. 2006. t(3;14)(p14;q32) results in aberrant expression of FOXP1 in a case of diffuse large B-cell lymphoma. Genes Chromosomes Cancer 45(2): 164168.
  • Fombonne E. 2009. Epidemiology of pervasive developmental disorders. Pediatr Res 65: 591598.
  • Gauthier J, Champagne N, Lafrenière RG, Xiong L, Spiegelman D, Brustein E, Lapointe M, Peng H, Côté M, Noreau A, Hamdan FF, Addington AM, Rapoport JL, Delisi LE, Krebs MO, Joober R, Fathalli F, Mouaffak F, Haghighi AP, Néri C, Dubé MP, Samuels ME, Marineau C, Stone EA, Awadalla P, Barker PA, Carbonetto S, Drapeau P, Rouleau GA, S2D Team. 2010. De novo mutations in the gene encoding the synaptic scaffolding protein SHANK3 in patients ascertained for schizophrenia. Proc Natl Acad Sci USA 107(17): 78637868.
  • Girirajan S, Eichler EE. 2010. Phenotypic variability and genetic susceptibility to genomic disorders. Hum Mol Genet 15 19(R2): R176R187.
  • Gonzalez-Burgos G, Hashimoto T, Lewis DA. 2010. Alterations of cortical GABA neurons and network oscillations in schizophrenia. Curr Psychiatry Rep 12(4): 335344.
  • Hu Z, Shanker S, MacLean JA, Ackerman SL, Wilkinson MF. 2008. The RHOX5 homeodomain protein mediates transcriptional repression of the netrin-1 receptor gene Unc5c. J Biol Chem 283(7): 38663876.
  • Hu Z, Dandekar D, O'Shaughnessy PJ, De Gendt K, Verhoeven G, Wilkinson MF. 2010. Androgen-induced Rhox homeobox genes modulate the expression of AR-regulated genes. Mol Endocrinol 24(1): 6075.
  • Jamain S, Betancur C, Quach H, Philippe A, Fellous M, Giros B, Gillberg C, Leboyer M, Bourgeron T, Paris Autism Research International Sibpair (PARIS) Study. 2002. Linkage and association of the glutamate receptor 6 gene with autism. Mol Psychiatry 7(3): 302310.
  • Jones MB, Szatmari P. 2002. A risk-factor model of epistatic interaction, focusing on autism. Am J Med Genet 114(5): 558565.
  • Kielinen M, Rantala H, Timonen E, Linna SL, Moilanen I. 2004. Associated medical disorders and disabilities in children with autistic disorder: A population-based study. Autism 8: 4960.
  • Kim HG, Kishikawa S, Higgins AW, Seong IS, Donovan DJ, Shen Y, Lally E, Weiss LA, Najm J, Kutsche K, Descartes M, Holt L, Braddock S, Troxell R, Kaplan L, Volkmar F, Klin A, Tsatsanis K, Harris DJ, Noens I, Pauls DL, Daly MJ, MacDonald ME, Morton CC, Quade BJ, Gusella JF. 2008. Disruption of neurexin 1 associated with autism spectrum disorder. Am J Hum Genet 82(1): 199207.
  • Laumonnier F, Bonnet-Brilhault F, Gomot M, Blanc R, David A, Moizard MP, Raynaud M, Ronce N, Lemonnier E, Calvas P, Laudier B, Chelly J, Fryns JP, Ropers HH, Hamel BC, Andres C, Barthélémy C, Moraine C, Briault S. 2004. X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene, a member of the neuroligin family. Am J Hum Genet 74: 552557.
  • Leblond CS, Heinrich J, Delorme R, Proepper C, Betancur C, Huguet G, Konyukh M, Chaste P, Ey E, Rastam M, Anckarsäter H, Nygren G, Gillberg IC, Melke J, et al. 2012. Genetic and functional analyses of SHANK2 mutations suggest a Multiple Hit Model of Autism Spectrum Disorders. PLoS Genet 8(2): e1002521.
  • Lichter P, Tang CJ, Call K, Hermanson G, Evans Ga, Housman D, Ward DC. 1990. High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247: 6469.
  • Liu H, Nakagawa T, Kanematsu T, Uchida T, Tsuji S. 1999. Isolation of 10 differentially expressed cDNAs in differentiated Neuro2a cells induced through controlled expression of the GD3 synthase gene. J Neurochem 72(5): 17811790.
  • Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25(4): 402408.
  • Lord C, Rutter M, Le Couteur A. 1994. Autism diagnostic interview-revised: A revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. J Autism Dev Disord 24(5): 659685.
  • Ma DQ, Whitehead PL, Menold MM, Martin ER, Ashley-Koch AE, Mei H, Ritchie MD, Delong GR, Abramson RK, Wright HH, Cuccaro ML, Hussman JP, Gilbert JR, Pericak-Vance MA. 2005. Identification of significant association and gene-gene interaction of GABA receptor subunit genes in autism. Am J Hum Genet 3: 377388.
  • Marshall CR, et al. 2008. Structural variation of chromosomes in Aautism spectrum disorder. J Hum Genet 82(2): 477488.
  • Matthijs G, Schollen E, Legius E, Devriendt K, Goemans N, Kayserili H, Apäk MY, Cassiman JJ. 1996. Unusual molecular findings in autosomal recessive spinal muscular atrophy. J Med Genet 33: 469474.
  • Mills PB, Footitt EJ, Mills KA, Tuschl K, Aylett S, Varadkar S, Hemingway C, Marlow N, Rennie J, Baxter P, Dulac O, Nabbout R, Craigen WJ, Schmitt B, Feillet F, Christensen E, De Lonlay P, Pike MG, Hughes MI, Struys EA, Jakobs C, Zuberi SM, Clayton PT. 2010. Genotypic and phenotypic spectrum of pyridoxine-dependent epilepsy (ALDH7A1 deficiency). Brain 133: 21482159.
  • Moss JF, Oliver C, Berg K, Kaur G, Jephcott L, Cornish K. 2008. Prevalence of autism spectrum phenomenology in Cornelia de Lange and Cri du Chat syndromes. Am J Ment Retard 113: 278291.
  • Nascimento RM, Otto PA, de Brouwer AP, Vianna-Morgante AM. 2006. UBE2A, which encodes a ubiquitin-conjugating enzyme, is mutated in a novel X-linked mental retardation syndrome. Am J Hum Genet 79(3): 549555.
  • Novara F, Beri S, Giorda R, Ortibus E, Nageshappa S, Darra F, Bernardina BD, Zuffardi O, Van Esch H. 2010. Refining the phenotype associated with MEF2C haploinsufficiency. Clin Genet 78: 471477.
  • Nowakowska BA, Obersztyn E, Szymanska K, Bekiesinska-Figatowska M, Xia Z, Ricks CB, Bocian E, Stockton DW, Szczaluba K, Nawara M, Patel A, Scott DA, Cheung SW, Bohan TP, Stankiewicz P. 2010. Severe mental retardation, seizures, and hypotonia due to deletions of MEF2C. Am J Med Genet Part B Neuropsychiatr Genet 153B: 10421051.
  • Oliver C, Arron K, Sloneem J, Hall S. 2008. Behavioural phenotype of Cornelia de Lange syndrome: Case–control study. Br J Psychiatry 193: 466470.
  • Philippi A, Tores F, Carayol J, Rousseau F, Letexier M, Roschmann E, Lindenbaum P, Benajjou A, Fontaine K, Vazart C, Gesnouin P, Brooks P, Hager J. 2007. Association of autism with polymorphisms in the paired-like homeodomain transcription factor 1 (PITX1) on chromosome 5q31: A candidate gene analysis. BMC Med Genet 6(8): 74.
  • Pinto D, et al. 2010. Functional impact of global rare copy number variation in autism spectrum disorders. Nature 466(7304): 368372.
  • Poot M, Beyer V, Schwaab I, Damatova N, Van't SlotR, Prothero J, Holder SE, Haaf T. 2010. Disruption of CNTNAP2 and additional structural genome changes in a boy with speech delay and autism spectrum disorder. Neurogenetics 11(1): 8189.
  • Poot M, van der Smagt JJ, Brilstra EH, Bourgeron T. 2011. Disentangling the myriad genomics of complex disorders, specifically focusing on autism, epilepsy, and schizophrenia. Cytogenet Genome Res 135(3–4): 228240.
  • Round J, Stein E. 2007. Netrin signaling leading to directed growth cone steering. Curr Opin Neurobiol 17(1): 1521.
  • Schmitz C, van Kooten IA, Hof PR, van Engeland H, Patterson PH, Steinbusch HW. 2005. Autism: Neuropathology, alterations of the GABAergic system, and animal models. Int Rev Neurobiol 71: 126.
  • Schopler E, Reichler RJ, DeVellis RF, Daly K. 1980. Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS). J Autism Dev Disord 10(1): 91103.
  • Seal JL, Gornick MC, Gogtay N, Shaw P, Greenstein DK, Coffey M, Gochman PA, Stromberg T, Chen Z, Merriman B, Nelson SF, Brooks J, Arepalli S, Wavrant-De Vrièze F Hardy J, Rapoport JL, Addington AM. 2006. Segmental uniparental isodisomy on 5q32-qter in a patient with childhood-onset schizophrenia. J Med Genet 43: 887892.
  • Serajee FJ, Zhong H, Nabi R, Huq AH. 2003. The metabotropic glutamate receptor 8 gene at 7q31: Partial duplication and possible association with autism. J Med Genet 40(4): e42.
  • Shuang M, Liu J, Jia MX, Yang JZ, Wu SP, Gong XH, Ling YS, Ruan Y, Yang XL, Zhang D. 2004. Family-based association study between autism and glutamate receptor 6 gene in Chinese Han trios. Am J Med Genet Part B 131B(1): 4850.
  • St Pourcain B, Wang K, Glessner JT, Golding J, Steer C, Ring SM, Skuse DH, Grant SF, Hakonarson H, Davey Smith G. 2010. Association between a high-risk autism locus on 5p14 and social communication spectrum phenotypes in the general population. Am J Psychiatry 167(11): 13641372.
  • Szatmari P, et al. 2007. Mapping autism risk loci using genetic linkage and chromosomal rearrangements. Nat Genet 39: 319328.
  • Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7): RESEARCH0034.
  • Veltman MW, Craig EE, Bolton PF. 2005. Autism spectrum disorders in Prader-Willi and Angelman syndromes: A systematic review. Psychiatr Genet 15(4): 243254.
  • Vorstman JaS, Staal WG, Daalen E, van Engeland H, van Hochstenbach PFR, Franke L. 2006. Identification of novel autism candidate regions through analysis of reported cytogenetic abnormalities associated with autism. Mol Psychiatr 11(1): 1828.
  • Vuletic S, Peskind ER, Marcovina SM, Quinn JF, Cheung MC, Kennedy H, Kaye JA, Jin LW, Albers JJ. 2005. Reduced CSF PLTP activity in Alzheimer's disease and other neurologic diseases; PLTP induces ApoE secretion in primary human astrocytes in vitro. J Neurosci Res 80(3): 406413.
  • Wang K, Li M, Hadley D, Liu R, Glessner J, Grant SF, Hakonarson H, Bucan M. 2007. PennCNV: An integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome Res 17(11): 16651674.
  • Wang K, et al. 2009. Common genetic variants on 5p14.1 associate with autism spectrum disorders. Nature 459: 528533.
  • Weiss LA, Shen Y, Korn JM, Arking DE, Miller DT, Fossdal R, Saemundsen E, Stefansson H, Ferreira MA, Green T, Platt OS, Ruderfer DM, Walsh CA, Altshuler D, Chakravarti A, Tanzi RE, Stefansson K, Santangelo SL, Gusella JF, Sklar P, Wu BL, Daly MJ. 2008. Association betweenmicrodeletion and microduplication at 16p11.2 and autism. N Engl J Med 358: 667675.
  • Zweier M, Gregor A, Zweier C, Engels H, Sticht H, Wohlleber E, Bijlsma EK, Holder SE, Zenker M, Rossier E, Grasshoff U, Johnson DS, Robertson L, Firth HV, Ekici AB, Reis A, Rauch A. 2010. Mutations in MEF2C from the 5q14.3q15 microdeletion syndrome region are a frequent cause of severe mental retardation and diminish MECP2 and CDKL5 expression. Hum Mutat 31: 722733.