SEARCH

SEARCH BY CITATION

Keywords:

  • insulin-dependent diabetes mellitus;
  • sequence analyses;
  • coxsackievirus B4;
  • enterovirus;
  • nucleotide sequence

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Some coxsackievirus B serotypes are potentially diabetogenic. Previous studies revealed that the virulence and the tissue damage varied with the genetics of the virus strain as well as with the genetics of the mice. A single amino acid variation can alter virulence and tropism in both murine and in vitro models. However, the genetic determinants of this phenomenon have not been determined. In this study, infections with a laboratory strain of coxsackievirus B4 resulted in a diabetes-like syndrome in ICR mice, characterized by chronic pancreatic inflammation together with dysregulation in glucose metabolism, loss of pancreatic acinar tissue and persistent infection in islets. To characterize the genetic determinants involved in the mouse pancreas adaptation, the laboratory strain of coxsackievirus B4 was cloned for molecular characterization. Comparing the whole genome sequence of this virus strain with the other coxsackievirus B4 strains revealed some differences. Altogether 15 nucleotides were changed, resulting in 10 amino acid substitutions, which might be responsible for the pathogenic phenotype of this strain in mice. Anat Rec, 291:601–609, 2008. © 2008 Wiley-Liss, Inc.

Coxsackievirus serotype B (CVB1-6) belongs to the species human enterovirus-B (HEV-B), a member of the family Picornaviridae. Infections with CVB usually lead to diseases including aseptic meningitis, encephalitis, myocarditis, pancreatitis, myositis, and insulin-dependent diabetes mellitus (Pallansch, 1997). The broad spectrum of diseases associated with coxsackievirus serotype B reflects the existence of multiple strains with various degrees of virulence, within a single serotype. Individual nucleotide substitutions in the noncoding and coding regions of the viral genome determine virulence (Ramsingh and Collins, 1995; Halim and Ramsingh, 2000). The existence of variants within a single serotype further complicates the pathogenesis of coxsackievirus infections. Therefore, comparison of coxsackievirus serotype B sequences, in particular multiple strains in a single serotype, is important not only for determining serotypes but also for studying virulence variations.

For coxsackievirus B4 (CVB4), the genome consists of a single-stranded RNA of positive polarity. Excluding the poly(A) tract, the RNA genome consists of 7,395 nucleotides and is composed of a 5′-nontranslated region (NTR) of 743 nucleotides, a 3′-NTR of 105 nucleotides and an open reading frame encoding a polyprotein of 2,183 amino acids, which is proteolytically cleaved (Jenkins et al., 1987). The open reading frame is divided into three regions: P1, P2, and P3. The four capsid proteins, VP1 to VP4, are encoded within the P1 region, whereas the nonstructural proteins that are involved in virus replication are encoded within the P2 and P3 regions. The 5′- and 3′-NTRs, which encode no proteins, are highly structured RNA sequences that are important for virus replication (Jackson and Kaminski, 1995).

Human enteroviruses (HEV), in particular coxsackievirus B, have been implicated in the pathogenesis of type 1 diabetes (T1D). T1D is caused by progressive destruction of pancreatic β-cells, leading to insulin deficiency (Atkinson and Eisenbarth, 2001). Epidemiological data indicate an increased incidence of type 1 diabetes after epidemics due to enteroviruses. Furthermore, enteroviral RNA has been detected in the blood of approximately 50% of type 1 diabetes patients at the time of disease onset (Yin et al., 2002a). Coxsackievirus B-IgM, coxsackievirus B-derived RNA, and IgM antibodies against other enteroviruses were found in higher frequencies in newly diagnosed patients than in controls (Frisk et al., 1985, 1992; King et al., 1985; Frisk and Diderholm, 1997). CVB4 has been isolated from patients with acute onset diabetes (Yoon et al., 1979). The virus isolates were shown to induce a diabetes-like syndrome when injected into susceptible mice strains, CD1 and/or SJL (Yoon et al., 1978). Further direct evidence has been obtained from the isolation of CVB4 (Tuscany strain), isolated from the islets of a patient who died at diabetes onset, which is capable of infecting β-cells from nondiabetic multiorgan donors, causing β-cell dysfunction (Dotta et al., 2007).

Although some reports have shown that coxsackievirus B can infect the human pancreas and induce T1D in murine models (Yoon et al., 1989; Ramsingh et al., 1997), it remains unclear whether it is relevant in the development of type 1 diabetes. Some studies have shown that virulence and tissue damage vary with the genetics of the virus strain. A single amino acid variation could alter the virulence and tropism in both murine and in vitro models (Caggana et al., 1993; Kandolf, 1993; Chapman et al., 1994, 1997).

Recent studies have demonstrated the association of the virulence with the genetics of the virus strain (Yin et al., 2002b; Paananen et al., 2003; Al-Hello et al., 2005; Dotta et al., 2007). Based on the sequence comparison of the diabetogenic E2 strain of CVB4 and the nondiabetogenic JVB strains, it was revealed that some amino acid changes in the capsid and noncapsid proteins of the E2 strain might be responsible for determination of its diabetogenicity (Kang et al., 1994). However, comparing the complete sequence and phylogenetic dendrogram between the Tuscany strain of CVB4 and the other enteroviruses showed that this virus was closely related to the prototype strain JVB (Francesco et al., 2007). Taken together, these results are inadequate and suggest an unclear mechanism of the viral determinants responsible for its diabetogenicity. The aim of the present study was to observe the effect of infection of ICR mice with a laboratory strain of CVB4 (jlu06) on glucose metabolism and histology of the pancreas, and to study the genetic determinants involved in mouse pancreas adaptation and virulence.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Virus and Cells

The original virus (COXB4/MK5P8) was obtained from the Shanghai Institute of Biological Products in 1990 and passaged in the Pathogenobiology Laboratory of Jilin University (renamed as a laboratory strain of coxsackievirus B4 jlu06). Virus jlu06 was prepared in Vero cell monolayers. The cell culture supernatant was harvested when the maximum cytopathic effect was observed and the flasks were freeze-thawed three times to lyse infected cells. The medium was then centrifuged at 2,500 rpm for 10 min at 4°C to pellet cellular debris. The supernatant virus stock was stored at −70°C and titrated by TCID50. Neutralization tests were used to confirm the serotype of the viruses before the inoculation of mice.

Animal Care and Virus Inoculation

Three-week-old ICR male mice (n = 10) were obtained from the Experimental Animal Center of Jilin University and housed according to the standard guide for the care and use of laboratory animals published by the Institute of Laboratory Animal Resources of the National Research council. They were acclimatized for 1 week before inoculation intraperitoneally (i.p.) with 400 × TCID50 of the jlu06 strain, 0.2 ml/20 g body weight. Control mice were injected with an equal volume of phosphate buffered saline (PBS). Mice were killed from day 1 to day 117 postinfection (p.i.), and pancreas tissues, heart tissue, and blood were collected. Half of the pancreas and heart tissue was snap-frozen in dry ice and stored at −70°C for virus titration; the remaining half was fixed in 4% formaldehyde in sodium phosphate buffer, pH 7.4, for histopathological examination and immunohistochemistry.

Histological Staining

The experimental mice were killed at the appropriate postinfection time point. The paraffin sections of formalin fixed pancreas were sectioned, 3 μm thick, and stained with hematoxylin and eosin (H&E) or with the primary virus-specific polyclonal antiserum for immunohistochemical staining.

Immunohistochemistry

The sections of paraffin-embedded tissue were dipped in xylene and rehydrated in graded alcohols (100%, 70%, 50% ethanol). Endogenous peroxidases were quenched with 3% H2O2, and nonspecific proteins were blocked with 2% bovine serum albumin in PBS. Primary antibodies for viral antigen (Chemicon International, Inc.) were diluted in blocking buffer and incubated at 37°C for 1.5 hr in a humidified chamber, washed with 1× PBS five times and then incubated for 40 min with horseradish peroxidase-conjugated secondary antibody at 1:500 dilution in blocking buffer. After washing, the diaminobenzidine substrate was added to the specimens followed by counterstaining with hematoxylin (blue nuclear stain) and slides were mounted with coverslips for microscope observations. The positively stained islets were counted in a masked manner in six high power fields (magnification ×200) per section and an average percentage of islet counts per section was taken. The average percentage of specific islets in each section was then used to determine the average percentage for the experimental groups (8–10 individuals per group).

Glucose Tolerance Test

On days 15 and 117 p.i., 10 mice from each group were starved overnight. Blood glucose concentrations were monitored from the tail vein at different time points. The first sample (time point 0) was taken before, and the other samples were taken 10, 30, 60, and 120 min after injection of glucose at 2 mg/g body weight. The glucose concentrations were measured using a Glucose Kit (Glu) (Biosino Bio-Technology and Science INC).

Viral RNA Extraction and Reverse Transcription

Total RNA of the jlu06 strain was extracted from 200 μl of virus stock using Trizol Reagent (Invitrogen) according to the manufacturer's instructions. RNA was stored with TE buffer at −70°C. Virus RNA was reverse transcribed in a volume of 20 μl. A 10-μl aliquot of RNA with 1 μl primer (dT26) and 1 μl of 10 mM concentration of each deoxynucleotide triphosphate (dNTP; Invitrogen) was heated for 5 min at 60°C and put on ice; then, 7 μl of master mix was added, containing 4 μl of 5× First Strand Buffer (250 mM Tris-HCI, pH 8.3, 375 mM KCl, 15 mM MgCl2), 1 μl of 0.1 M dithiothreitol, and 1 μl RNaseOUT and 1 μl of SuperScript™III RNase H-Reverse Transcriptase (Invitrogen), then incubating for 60 min at 50°C. The reverse-transcribed samples were denatured for 15 min at 70°C before storage on ice.

Polymerase Chain Reaction

In this study, 2 μl of the reverse transcribed RNA was amplified in a volume of 50 μl containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 1.5 mM MgCl2, 1 μl of primer mix, and 0.2 μl of Platinum Taq DNA Polymerase (Invitrogen), and amplified with the following protocol: 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 52°C for 30 sec, and 72°C for 2 min, with a final extension step at 72°C for 7 min. To generate templates for cycle sequencing, several fragments were amplified with polymerase chain reaction (PCR) from cDNA and the products were analyzed on 1% Tris–borate–ethylenediaminetetraacetic acid agarose gels containing 0.1 mg/ml ethidium, then purification with QIAquick PCR Purification Kit (QIAGEN GmbH) according to the manufacturer's instructions. Primers used for PCR (Table 1) were designed from the different regions of coxsackie B virus genome.

Table 1. Primers used for PCR amplification
PrimeraSequencebNucleotide positionsc
  • a

    S, sense; A, antisense.

  • b

    Sequences are shown 5′–3′.

  • c

    Nucleotide sequence coordinates are given relative to the sequence of CVB4/JVB.

  • d

    V corresponds to the base A, C, or G.

CBM1STTAAAACAGCCTGTGGGTTGTACC1–24
CBM1AGCATATTCTGCCCAAAGAGCCC1238–1218
CBM2STGGTGGTGGAAGTTCCCAGATGC1181–1204
CBM2ATGTCCCTCAACATGCGTA2413–2395
CBM3STACGCATGTTGAGGGACAC2398–2417
CBM3AATGCGGATGGTGCTGGTCA3161–3142
CBM4SCGTTCATGAGTATTGGCAATGC2998–3018
CBM4AGTTAACCTGCTCGCATATCTG3818–3797
CBM5SCAGATATGCGAGCAGGTTAAC3797–3818
CBM5ACAGAACAAAGACACGTCCTTGC4609–4587
CBM6STGCCGTATTGAACCTGTATGC4388–4409
CBM6ACATGTTTGGGAATTTGCT5695–5677
CBM7SAGCAAATTCCCAAACATG5677–5695
CBM7ATGTCCATACATTCCTTCAA6345–6326
CBM8SGAAGGAATGTATGGACAAGTA6328–6349
CBM8ACCGCACCGAATGCGGAGAATTTA7395–7373
dT26VAT26VdPoly(A)

Ligation and Transformation

Purified polymerase chain reaction products were ligated using pMD19-T Vector Kit (TaKaRa) according to the manufacturer's instructions. The ligation reaction took place at 16°C for 45 min. The ligated products were transformed into competent Escherichia coli JM109 cells.

Purification of Plasmid DNA and Sequencing

Pelleted bacteria were resuspended, lysed, and neutralized according to QIAprep Spin Miniprep Kit Protocol (QIAGEN, Hilden, Germany). The dried pellet was then eluted to select the clones for further experiments. Purified plasmids were digested with the HindIII and EcoRI restriction enzyme (TaKaRa) to confirm the insertion of the DNA fragment and then the positive clones were sequenced. The cycle sequencing reactions were performed using ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Warrington, UK). The pMD/M13 primer was used for sequencing, and the sequence data were assembled using DNAstar software.

Sequence Analysis

The nucleotide and amino acid sequences were aligned by ClustalW and phylogenetic trees were generated by Megalin Programme (DNAStar). The following previously published complete enterovirus B sequences used in phylogenetic trees were obtained from GenBank: coxsackievirus A9 Griggs (D00627), coxsackievirus B1 Japan (M16560), coxsackievirus B2 Ohio (AF085363), coxsackievirus B3 Nancy (M33854), CVB4 J.V.B. (X05690), CVB4 Tuscany(DQ480420), CVB4 E2 (S76772), CVB4 E2 variant (E2b, AF311939), coxsackievirus B5 Faulkner (AF114383), coxsackievirus B6 Schmitt (AF114384), echovirus 5 Noyce (AF083069), echovirus 9 Hill (X84981), echovirus 11 Gregory (X80059), echovirus 18 Metcalf (AF317694), and echovirus 30 Bastianni (AF311938).

Statistical Analysis

Data presented are means ± SD. A P value less than 0.05 was considered statistically significant. Differences in blood glucose concentrations were tested with Student's t-test for comparing paired samples. Virus-infected and control samples were compared at each time point.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Histological Damage to Pancreas Induced by the jlu06 Strain

Histological examination of tissues showed that, soon after infection (at days 1–4 p.i.), the jlu06 strain infected the pancreas and caused acute tissue damage, which was primarily localized to the acinar tissue (Fig. 1A). A few islets in jlu06-infected mice showed signs of cytopathology, but the majority had normal morphology. Lymphocytic infiltration was observed throughout the pancreas, and some lymphocytes were observed penetrating islets close to areas containing dying cells on days 4, 8, and 27 p.i. (see Fig. 1B for a higher magnification). However, most islets were intact despite being surrounded by infected acinar tissue. By days 15 and 27 p.i., increased necrosis of the tissue was seen in jlu06-infected mice (Fig. 1A,d,e). The histology of the pancreas was examined after infection of ICR mice with the jlu06 strain for 117 days p.i., and compared with control tissue (Fig. 1A).

thumbnail image

Figure 1. Histopatholoy of the pancreas following infection with the jlu06 strain. (A) shows sections of pancreas obtained between days 1 and 117 post-infection (p.i.) from ICR mice injected with PBS or with the jlu06 strain and stained with hematoxylin and eosin (H&E). Eearly virus-induced cytopathology of exocrine tissue together with a lymphocytic infiltration can be seen on days 1 and 4 p.i., but the islets are largely spared. At later times, the jlu06-infected pancreata show almost complete necrosis of acinar tissue leaving large misshapen islets and tubular structures caught up in connective tissue. (B) shows a higher magnification of single islets at days 4, 8, and 27 p.i. showing some acute damage and lympocytic infiltration (arrows). Original magnification: (A) ×200; (B) ×1000. (A) Scale bar in f = 100 μm and applies to a–e. (B) Scale bar in c = 20 μm and applies to a and b.

Download figure to PowerPoint

Virus titers in serum, pancreas, and heart were measured to determine whether the jlu06 strain had a particular tropism for pancreatic tissues (Fig. 2A). We observed that when the susceptible mice were infected intraperitoneally with the jlu06 virus, viremia occurred rapidly, spreading the virus to secondary replication sites of infection such as the pancreas or heart. Jlu06 was present at high titers in blood samples collected during the early stages of infection. Maximal serum viral titers were detected 4 days p.i., whereas no signs of viremia were seen 8 days p.i. However, the jlu06 strain was found to be more virulent in pancreatic tissues, giving yields 100- to 1,000-fold greater than in the heart tissues tested. Moreover, the jlu06 strain virus replication continued for a longer period, with ongoing replication on day 27 in the pancreas, whereas no infectious virus was detected after day 8 in heart tissues.

thumbnail image

Figure 2. (A) Virus titres in tissues. The titres of virus in selected tissues including pancreas and heart are shown. The jlu06 strain replicated to a higher titre in the pancreases tested, in which virus clearance was also delayed. Results are shown as means + SD. (B) Viral antigen in the pancreas on days 8 and 27 post-infection. Viral antigen was detected by immunohistochemistry throughout the acinar tissue and islets in jlu06-infected mice (b, c, e, and f). a,d: control tissues. Original magnifications: (a–c) ×400; (d–f) ×1000. Scale bar in c = 50 μm and applies to a and b. Scale bar in f = 20 μm and applies to d and e.

Download figure to PowerPoint

Immunohistochemistry to detect viral antigens at day 8 and day 27 revealed that viral proteins were present in the majority of pancreatic islets of infected mice and in a few scattered exocrine cells (Fig. 2B, arrows). Positive staining of mice pancreatic islets were found in all jlu06-inoculated mice. An average percentage of the positively stained islets exceeded 70% per section as well as in the whole groups (8–10 individuals per group). The viral antigens were present in surviving islets and also in the tubular structures and fibroblast-like cells that represented the remnants of the exocrine tissue. At later stages, persistence of viral proteins were detected in jlu06-infected animals on day 27 p.i.

Glucose Tolerance Test

Glucose tolerance tests performed at day 15 and day 117 p.i. revealed significant differences between virus-infected and control groups for each time point. At day 15 p.i., the serum glucose concentrations in mice infected with the jlu06 strain tended to be increased after glucose injection compared with the control group (Fig. 3A). By day 117 p.i., the serum glucose concentrations in mice infected with the jlu06 strain were significantly greater compared with the uninfected controls (P < 0.01, Fig. 3B), indicating impaired glucose handling in these mice.

thumbnail image

Figure 3. Glucose tolerance tests performed on ICR mice infected with the jlu06 strain. There were no statistically significant differences between the infected groups and the uninfected controls at day 15 p.i. (A), but by day 117 p.i. (B). The glucose concentrations in mice infected with the jlu06 strain were significantly greater compared with the uninfected controls (p < 0.01).

Download figure to PowerPoint

Genomic Structure of the jlu06 Strain

To determine the complete nucleotide sequence of the jlu06 strain, virus RNA was purified and amplified by reverse transcriptase-PCR. The amplification products were sequenced and assembled into a complete genome sequence. The sequence analysis showed that the genome of the jlu06 strain is 7,395 nucleotides (nt) long, excluding the poly(A)-tract. The 5′-NTR extends to nt 743 and was followed by an open reading frame, ranging from nucleotide 744–7292, coding for a single polyprotein of 2,183 amino acids. The polyprotein coding sequence was flanked by a 103 nt-long 3′-NTR and a poly(A) tract. The sequences of the 5′- and 3′-NTRs were very similar to that of other CVB4 (99% and 84%, respectively; Table 2).

Table 2. Nucleotide identity (%) in genomic regions between the jlu06 strain and other CVB4 strains
 5′NTRVP4VP2VP3VP12A2B2C3A3B3C3D3′NTR
JVB999999999999999998100989998
Tuscany99999999999910099100100999999
E288848383827479817778807987
E2b88858382837679807777808088

Sequence Analysis and Phylogenetic Trees

The overall nucleotide sequence and amino acid sequence comparison with the other strains of CVB4, revealed 15 nucleotide and 10 amino acid differences that were scattered throughout the genome: one in VP4 (T3A), one in VP3 (A498V), one in 2A (I893T), three in 2C (C1184Y, R1213K, N1417S), two in 3A (V1450A, T1481I), one in 3C protease (F1643N), and one in 3D polymerase (K2044R). Amino acid motifs conserved among enteroviruses are present in the jlu06 polyprotein sequence corresponding to part of the active site of the 3C protease [GXCGG] (Gorbalenya et al., 1989) and the amino acid motifs in the 3D polymerase [KDE], [GX2SGX3TX3NS], [YGDD], and [FLKR] (Koonin, 1991). Additionally, the jlu06 strain contained highly conserved immunogenic PALTAVETGHT and PALNSPTVEE in the capsid protein. These conservative viral sequences are known to be homologous to and cross-reactive with the known diabetogenic epitopes of islet cell autoantigens IAR/IA-2 and heat shock protein 60 (Kaufman et al., 1992; Harkonen et al., 2000). Tables 2 and 3 show the percentage of homology in the genomic regions, the jlu06 strain, and the other strains of CVB4 serotype.

Table 3. Amino acid identity (%) in genomic regions between the jlu06 strain and other CVB4 strains
 VP4VP2VP3VP12A2B2C3A3B3C3D
JVB98.698.999.299.399.310099.194.410098.499.5
Tuscany98.697.799.299.399.310099.110010099.599.5
E297.198.197.596.889.89597.992.195.59495.3
E2b98.698.597.598.692.59797.992.110094.596.4

Phylogenetic trees of amino acid/nt sequences from the full-length jlu06 genome together with published sequences of other members of human enterovirus type B were constructed for different genomic regions. A phylogenetic tree of the complete polyprotein showed that all strains of CVB4 are closely related to each other (Fig. 4A), and the comparison using the complete sequence divides the CVB4 family into two subgroups: CVB4/JVB, CVB4/jlu06, CVB4/Tuscany; and CVB4/E2, CVB4/E2b (Fig. 4B).

thumbnail image

Figure 4. Phylogenetic trees showing the relationships between the jlu06 strain of CVB4 and selected human enterovirus type B strains in the amino acid sequences of their complete polyproteins (A) and in the complete nucleotide sequences (B).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

We investigated the effect of infection of ICR mice with the jlu06 virus strain on glucose metabolism and histology of the pancreas, and identified the genomic determinants for the mouse pancreas adaptation and virulence. According to our results, in vivo, the jlu06 strain was capable of causing a diabetes-like syndrome in ICR mice. We found that the diabetes-like syndrome was characterized by pancreatic inflammation together with mild glucose dysregulation, loss of pancreatic acinar tissue, and mild insulitis.

In addition, we found that the remaining islets survived for prolonged periods, although by day 27 many contained a proportion of dead or dying cells. Over the following 2 months, these surviving islets contained increasing numbers of dead cells and insulin levels became too low to maintain glucose homeostasis, suggesting that this was because of the absence of islet neogenesis. Recently, Yap et al. (2003) described that a lack of islet neogenesis plays a role in β-cell depletion in mice infected with a diabetogenic variant E2 of CVB4, while a remarkable regeneration takes place in the exocrine pancreas of mice infected with a prototype strain of CVB4.

When the distribution of the virus in mouse pancreas was studied by immunohistochemistry, the acinar tissue was found to be infected with the jlu06 strain and some staining was found in the islets of Langerhans as well by day 27 p.i., which suggested that this virus established a persistent infection in mice islets in vivo. The rapidity with which jlu06 infects and spread throughout the pancreas might prevent the tissue from mounting an effective antiviral response in time and, therefore, may induce a persistent infection. Persistent infection of CVB4 strains in human islet cells and in vivo in mice had been shown previously (Chehadeh et al., 2000; Yin et al., 2002b; Yap et al., 2003), although their results were different to some extent.

Another indication of the jlu06 strain in its ability to infect β-cells derived from glucose measurements. The results of glucose tolerance tests showed that the glucose clearance was significantly affected in mice infected with the jlu06 strain compared with uninfected mice. This finding indicates that there might be a direct or an indirect virus cell interaction with β-cells causing glucose intolerance. It seems possible that the outcome of the infection depended on the ability of the virus to establish persistence. Correlations between the persistence of viral RNA in the pancreata of CD1 mice infected with the CVB4 strain E2 and the development of diabetes 6 months later have been reported (See and Tilles, 1995). Another possible mechanism that leads to glucose intolerance could be the effect on the β-cells from the surrounding infected cells. The virus might interact with the ductal cells in the pancreas, which contribute to pancreatic islet cell cytokine release (Pavlovic et al., 1999), indicating the potential role of these cells in the development of diabetes.

There are several publications showing that a few point mutations or even a single point mutation might lead to important changes in the biology of various picornaviruses (Bae and Yoon, 1993; Caggana et al., 1993; Knowlton et al., 1996; Jun et al., 1997; Schmidtke et al., 2000). We had the hypothesis that viral genetic determinants for tropism for pancreas and/or to the cells of islets of Langerhans might be restricted to only one or a few amino acids. Therefore, the virus strain jlu06 was cloned molecularly and sequenced. Comparison of the entire genetic sequences between the jlu06 strain and the other CVB4 strains showed high similarity with some interesting differences.

A total of 15 of 7,395 nts in the viral genome were changed, resulting in 10 amino acid substitutions. Two of the changed amino acids were located in the capsid proteins while eight were localized to the nonstructural proteins. The two mutated amino acids in the capsid proteins were close to the outer surface of the virion, suggesting that they are involved in virus–cell interactions, possibly augmenting initiation of virus infection. On the other hand, coding mutations in the nonstructural genes might also affect virulence, involving protease 2A, proteins 2C and 3A, protease 3C, and the viral polymerase 3D. Little is known about the functional significance of these changes, although it cannot be excluded that any of the other amino acid substitutions or nt replacements of the jlu06 strain could affect the ability to establish a persistent infection. Further work is required to determine what role these mutations are playing in triggering type 1 diabetes and/or the ability to establish a persistent infection.

The complete sequence and phylogenetic trees, showing the close genetic relationship between the jlu06 strain and other enteroviruses, indicate that this CVB4 strain is closely correlated with the CVB4 strain Tuscany. The Tuscany strain was originally isolated from islets of a 19-year-old male who accidentally died 9 months after diabetes onset. The Tuscany strain has been shown to cause infection of β-cells from nondiabetic multiorgan donors and β-cell dysfunction characterized by impaired glucose-stimulated insulin release (Dotta et al., 2007). Infection of the CVB4 strain Tuscany led to insulitis in patients and partial loss of β-cell function on human islet cells in vitro, which is similar to our results with ICR mice infected with the jlu06 strain.

Several researchers have demonstrated that the coxsackieviruses group B could use the Coxsackie-adenovirus receptor (CAR; Lonberg-Holm et al., 1976; Agrez et al., 1997; Bergelson et al., 1997a, b). Other researchers have reported that the coxsackie B virus could also use the decay accelerating factor (DAF, CD55; Bergelson et al., 1995; Shafren et al., 1995), a 70-kDa protein that protects cells from complement-mediated lysis. Early studies revealed that one of the most important factors determining the ability of these viruses to establish a persistent infection in vitro is the change of receptor usage compared with their parental strains or with the prototype strains (Colbere-Garapin et al., 1989; Zhang and Racaniello, 1997; Duncan et al., 1998). This change of receptor usage has been shown to be because of amino acid substitutions in the capsid proteins (Duncan and Colbere-Garapin, 1999; Schmidtke et al., 2000). The CVB4 strains also differed with regard to which receptor or coreceptor they use in vitro (Frisk et al., 1985); one strain even infected cells lacking both CAR and DAF (Frisk et al., 2001). This finding seems to be consistent with the fact that the receptor usage is a major determinant of virus tropism and/or the establishment of persistence of a specific virus strain (Duncan et al., 1999; Frisk, 2001). The ability of this CVB4 strain to use other receptors might change its tropism and the ability to cause disease, such as type 1 diabetes.

In conclusion, our data revealed that a strain of CVB4 can establish a persistent infection in mice pancreata in vivo and leads to dysfunction of the β-cells, although causing no significant β-cell destruction. The sequence comparisons showed that the entire genetic sequence of the jlu06 strain had several amino acid differences both in capsid proteins and in nonstructural proteins when compared with the other CVB4 strains, which might be responsible for the pathogenic phenotype. It is well known that the virulence of a given virus can be dramatically influenced by single point mutations (Macadam et al., 1994; Knowlton et al., 1996). The establishment of infection in ICR mice, as reported in the present study for the highly diabetogenic the jlu06 strain, allows detailed investigations of the molecular determinants of pancreata virulence.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

The authors thank Dr. Honglan Huang and Jingwei Shi for assistance with the animal experiments. We also thank Haiying Zhang in the Department of Pathology at Jilin University for tissue processing and immunohistochemical studies. We give special thanks to Dr. Zhe Li in the Department of Cellular Biology at Jilin University for her invaluable help in sequence retrieval and phylogenetic analyses.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED