SEARCH

SEARCH BY CITATION

Keywords:

  • VEGF-C;
  • VEGF-D;
  • VEGFR-3;
  • cutaneous malignant melanoma

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Regional lymph node metastasis is one of the important indicators of cutaneous malignant melanoma. Newly formed lymphatic vessels are considered to provide a route whereby tumor cells can migrate to the lymph nodes. Both vascular endothelial growth factors (VEGF) -C and -D have been confirmed to participate in tumor lymphangiogenesis, but the prognostic significance of VEGF-C, VEGF-D, and lymphangiogenesis in cutaneous malignant melanoma remains controversial. To clarify the effects of these factors and to evaluate the relationships between lymphangiogenesis, lymph node metastasis, and prognosis in patients with malignant melanoma, the expressions of VEGF-C, VEGF-D, and their receptor (VEGFR) -3 were detected by immunohistochemistry and reverse transcriptase-polymerase chain reaction. The expressions of both VEGF-C and VEGF-D proteins were concomitantly detected in the cytoplasm of the malignant cells. VEGF-C and VEGF-D expressions were associated with VEGFR-3 expression and were significantly correlated with both peritumoral lymphangiogenesis and lymph node metastasis. The incidence of peritumoral lymphatic vessels was significantly higher in lymph node metastatic melanomas than that in nonmetastatic melanomas. Univariate and multivariate analyses indicated that VEGF-C and VEGF-D were independent prognostic factors for overall survival and disease-free survival in patients with malignant melanoma. This study suggests that both VEGF-C and VEGF-D are involved in peritumoral lymphangiogenesis and lymphatic metastasis. VEGF-C and VEGF-D expression may be clinically useful indicators for prognostic evaluation in patients with cutaneous malignant melanoma. Anat Rec, 2008. © 2008 Wiley-Liss, Inc.

Regional lymph node status is the most reliable prognostic indicator in patients with melanoma because as the first node draining the primary cancer it is also the node most likely to harbor metastatic cancer cells (Leong et al., 2003; Leong, 2004). Metastatic dissemination of the primary tumor is an important factor that negatively affects the prognosis in most malignancies, and the lymphatic system is thought to play an important role in tumor cell dissemination to the regional lymph nodes (Miyata et al., 2006).

Vascular endothelial growth factor (VEGF) -A, a member of the platelet-derived growth factor family, is a major inducer of angiogenesis and vessel permeability (Shida et al., 2005). The VEGF family is composed of five additional members (VEGF-B, -C, -D, -E, placenta growth factor) with distinct binding patterns to the three different tyrosine kinase receptors: VEGFR-1 (Flt-1), VEGFR-2 (KDR/Flk-1), and VEGFR-3 (Flt-4). Among them, VEGF-C and VEGF-D are structurally closely related and considered to be lymphangiogenic factors (McColl et al., 2004). Several studies examining VEGF-C and VEGF-D expression in transplanted tumor cells or transgenic tumor models have demonstrated that these factors promoted tumor lymphangiogenesis and lymph node metastasis. Moreover, clinicopathological studies of these growth factors in various types of cancers, including esophageal, colorectal, pancreatic, endometrial, and ovarian carcinomas (Kitadai et al., 2001; Yokoyama et al., 2003; Kurahara et al., 2004; Onogawa et al., 2004), revealed that the expression of VEGF-C or VEGF-D did correlate with the presence of lymph node metastases, negatively affecting patient survival.

Cutaneous malignant melanoma is a frequently lethal neoplasm with worldwide occurrence. It is distinguished by its propensity for early metastatic spread to regional lymph nodes. Hence, lymph node metastasis, as determined by the analysis of regional lymph nodes, is an important determinant in the staging and clinical management of melanomas (Dadras et al., 2003). However, more effective prognostic indicators are needed to predict the prognosis and survival in patients with malignant melanoma.

In this study, the expressions of VEGF-C, VEGF-D and their receptor, VEGFR-3, were examined using immunostaining and reverse transcriptase-polymerase chain reaction (RT-PCR) to clarify the roles of these factors in lymphangiogenesis and lymph node metastasis, and to evaluate the relationship between VEGF-C, VEGF-D and prognosis in patients with cutaneous malignant melanoma.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Patients and Tumor Samples

Fifty-six patients with primary cutaneous melanomas who underwent lymph node dissection procedures at Harbin Medical University Clinical Hospital (Harbin, China), during the period from January 2001 to March 2002, were included in this study. Eighteen fresh tumor specimens were obtained during surgery; the other 38 samples were paraffin-embedded, stored specimens from patients with cutaneous melanomas. The patients' ages ranged from 27 to 81 years, and none of them had received preoperative radiation therapy or chemotherapy. Routine histological examination was performed with hematoxylin-eosin staining. All carcinomas were classified according to the criteria of the World Health Organization. Staging at the time of diagnosis was based on the TNM system (Mylona et al., 2007). Histology grade and clinicopathological characteristics of patients and tumors are summarized in Table 1.

Table 1. Histology grade and clinicopathological characteristics of patients and tumors
Age (years)
 Range27–81
 Mean (SD)56.05 (11.34)
Gender (no.of patients)
 Male31
 Female25
Location of tumor (no. of patients)
 Extremity42
 Head and neck, Trunk14
Lymph node metastasis (no. of patients)
 Yes31
 No25
Tumor thickness (mm)
 <120
 ≥136
 Range0.3–4.1
 Mean (SD)1.83 (1.03)
Ulceration (no. of patients)
 Present26
 Absent30
TNM stage (no. of patients)
 I13
 II12
 III21
 IV10

Immunohistochemistry

Immunohistochemical staining was performed using the streptavidin-peroxidase conjugate method. Briefly, 4-μm paraffin sections were deparaffinized in dimethylbenzene, rehydrated through a graded ethanol series, and then incubated with fresh 3% hydrogen peroxide for 15 min at room temperature. After a phosphate-buffered saline (PBS) rinse, the tissue sections were antigen-retrieved in 0.01 M citrate buffer, PH 6.0, in a pressure steamer for 10 min. Sections were then incubated with 10% normal goat serum in PBS for 15 min at room temperature to block nonspecific binding. After rinsing with PBS, slides were incubated overnight at 4°C with VEGF-C, VEGF-D, and VEGFR-3 polyclonal rabbit anti-human antibodies, 1:200 (Santa Cruz Biotechnology. Inc., Santa Cruz, CA); LYVE-1 monoclonal rabbit anti-human antibody, 1:800 (Santa Cruz Biotechnology Inc.). After a PBS rinse, slides were then incubated for 25 min at room temperature with polyHRP goat anti-rabbit IgG (Zhongshan Biotechnology Inc, Beijing, China). After rinsing with PBS, slides were stained with fresh 3,3′-diaminobenzidine (DAB; Zhongshan Biotechnology, Inc., Beijing, China) then counterstained in hematoxylin, dehydrated, and mounted.

Evaluation of Immunohistochemistry

Using light microscopy, two pathologists with no knowledge of the clinical data for the patients, independently evaluated the immunostaining. The score was derived from the average of 10 distinct high-power fields, observed at ×400 magnification. The primary antibody was replaced by PBS in negative controls.

Staining intensity and the number of stained cells were taken into consideration during the evaluation process. Samples of tumor cells were considered to be positive for VEGF-C, VEGF-D, and VEGFR-3 when at least 10% of them showed cytoplasmic immunostaining. VEGFR-3 was also detected in endothelial cells, and 5% of immunoreactive endothelial cells constituted a positive sample.

To analyze lymphangiogenesis, LYVE-1 antibody was used to detect lymphatic vessels. Tumor sections stained with LYVE-1 antibody were examined using light microscopy and digital images were captured at ×200 magnification. In each tumor section, three fields with the highest number of lymphatic vessels (hotspots) were evaluated and the average vessel number was defined as lymphatic vessel density.

RT-PCR

Eighteen fresh tumor specimens were obtained during surgery for RT-PCR. Total RNA was extracted from resected specimens of malignant melanoma using the RNeasy Mini kit (Qiagen, Beijing, China), according to the manufacturer's instructions. First-strand cDNA was synthesized from total RNA by reverse transcriptase (First Strand cDNA synthesis kit, Promega, Madison, WI). The PCR analysis was performed using a pair of VEGF-C primers (sense primer, AGACTCAATGCATGCCACG; antisense primer, TTGAGTCATCTCCAGCATCC), VEGF-D primers (sense primer, GCTGTTGCAATGAAGAGAGC; antisense primer, TCTTCTGTTCCAGCAAGTGG), VEGFR-3 primers (sense primer, GGGGTGGTGCGAGACTGC; antisense primer, TCGTTGCCTGTGATGTTGC), and β-actin primers (sense primer, GTGGGGCGCCCCGGCACCA; antisense primer, CTCCTTAATGTCACGCACGATTT), respectively. The cDNA reaction was subjected to 30 cycles (denaturing at 94°C for 1 min, annealing at 58°C for 1 min, and polymerization at 72°C for 1 min), in the presence of 0.25 U of Taq DNA polymerase (Roche, Swiss), 1× PCR reaction buffer (Roche, Swiss), 0.25 mM of dNTPs (Promega, USA), and 0.5 μM of specific primers for VEGF-C, VEGF-D, VEGFR-3, and β-actin, in a final reaction volume of 50 μL.

Statistical Analysis

Each experiment was performed independently at least twice with similar results each time; one representative result for each experiment is presented here. All statistical calculations were performed using SPSS software. Data were expressed as means ± SDs. The significance of the data were determined using the χ-squared test. Overall survival and disease-free survival analyses were performed using the Kaplan-Meier method and were assessed by the log-rank test. Univariate and multivariate analyses of prognostic factors were based on the Cox proportional hazards model. A value of P < 0.05 indicates statistical significance.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

VEGF-C, VEGF-D, and VEGFR-3 Protein Expression

Positive immunostaining for VEGF-C was observed in the cytoplasm of the malignant cells (Fig. 1A) in 70.97% of metastatic cases and 36.0% of nonmetastatic cases (Table 2). The peritumoral stroma occasionally stained positively for VEGF-C.

thumbnail image

Figure 1. Immunihistochemical staining of VEGF-C, VEGF-D, and VEGFR-3 in malignant melanomas (SP). A: Focal expression of VEGF-C in the cytoplasm of melanoma cells in tumor nests (arrow). B: VEGF-D expression in the cytoplasm of the malignant cells (arrow). C: VEGFR-3 expressed in the cytoplasm of melanoma cells in tumor nests (arrow) and microvessel endothelium (V). Original magnifications: ×200 in A,C, ×400 in B.

Download figure to PowerPoint

Table 2. Positive immunostaining for VEGF-C, VEGF-D, and VEGFR-3
GroupTotalVEGF-C positiveP valueVEGF-D positiveP valueVEGFR-3 positiveP value
Metastatic3122 (70.97%)0.00923 (74.19%)0.00425 (80.65%)0.001
Nonmetastatic259 (36.0%)9 (36.0%)9 (36.0%)

VEGF-D protein was immunodetected in the cytoplasm of the malignant cells in 74.19% of the metastatic group and 36.0% of the nonmetastatic group, respectively (Fig. 1B, Table 2). Occasionally, the peritumoral stroma stained positively for VEGF-D.

VEGFR-3 protein expression was detected in the cytoplasm of the malignant cells in 80.65% of the metastatic group and 36.0% of the nonmetastatic group, respectively. The peritumoral stroma and microvessel endothelium always stained positively for VEGFR-3 (Fig. 1C, Table 2). The correlations between the expression of VEGF-C, VEGF-D, and VEGFR-3 were analyzed, and VEGFR-3 expression was found to be closely associated with both VEGF-C and VEGF-D expression (Table 3).

Table 3. Expression of VEGF-C, VEGF-D, and VEGFR-3
VEGFR-3VEGF-CVEGF-D
(+)(−)P valueR(+)(−)P valueR
(+)2590.0010.4542590.0020.412
(−)616715

Detection of Peritumoral Lymphatic Vessels in Malignant Melanoma

Using immunostaining for the lymphatic vessel specific marker, LYVE-1, peritumoral lymphatic vessels were detected in all primary melanomas. LYVE-1–positive lymphatic vessels were surrounded by mononuclear inflammatory cells in the peritumoral stroma (Fig. 2).

thumbnail image

Figure 2. Detection of peritumoral lymphatic vessels in malignant melanoma by immunohistochemistry (SP) with LYVE-1 (arrow). A: VEGF-C–positive malignant melanoma. B: VEGF-D–positive malignant melanoma. Original magnifications: ×400.

Download figure to PowerPoint

The number of peritumoral lymphatic vessels in VEGF-C–positive malignant melanomas (10.0539 ± 2.3851 vessels/visual field, VF) was significantly higher than that in the VEGF-C–negative group (6.480 ± 1.9902 vessels/VF; P < 0.001; Fig. 3A). The number of peritumoral lymphatic vessels in VEGF-D–positive malignant melanomas (10.0725 ± 1.9211 vessels/VF) was again significantly higher than that in VEGF-D–negative malignant melanomas (6.3063 ± 2.4096 vessels/VF; P < 0.001; Fig. 3B). Finally, the number of peritumoral lymphatic vessels was also significantly higher in the metastatic group (9.9355 ± 2.3594 vessels/VF) than that in nonmetastatic melanomas (6.6268 ± 2.2728 vessels/VF; P < 0.001; Fig. 3C).

thumbnail image

Figure 3. Peritumoral lymphatic vessels (number/visual field, VF) in VEGF-C, VEGF-D expression group, lymph node metastatic, and the nonmetastatic group. A: Significant increase of lymphatic vessel density in VEGF-C–positive malignant melanomas (n = 31), as compared with VEGF-C–negative malignant melanomas (n = 25). B: Lymphatic vessel density is significantly higher in VEGF-D–positive malignant melanomas (n = 32) than that in VEGF-D–negative malignant melanomas (n = 24). C: Significant increase of lymphatic vessel density in metastatic malignant melanomas (n = 31), as compared with nonmetastatic malignant melanomas (n = 25).

Download figure to PowerPoint

Expression of VEGF-C, VEGF-D, and VEGFR-3 mRNA in Malignant Melanoma

Eighteen tissue samples obtained from malignant melanomas were examined for gene expression of VEGF-C, VEGF-D, and VEGFR-3 using RT-PCR (Fig. 4). VEGF-C, VEGF-D, and VEGFR-3 were expressed in 16 (88.9%), 13 (72.2%), and 15 (83.3%) of the malignant melanomas, respectively. The sixteen VEGF-C mRNA-positive samples included 15 VEGF-C protein-positive samples and one VEGF-C protein-negative case. This VEGF-C protein-negative case was defined as a VEGF-C–positive case in patient survival analysis. The relative amounts of VEGF-C, VEGF-D, and VEGFR-3 mRNA in malignant melanomas with and without lymph node metastasis are shown in Figure 5.

thumbnail image

Figure 4. Expression of VEGF-C, VEGF-D, and their receptor VEGFR-3 mRNA in malignant melanomas with lymph node metastasis (n = 10) and nonmetastasis (n = 8). A: RT-PCR was carried out with primers specific for VEGF-C (amplifying transcripts of 435 bp). B: Expression of VEGF-D (amplifying transcripts of 313 bp). C: Expression of VEGFR-3 (amplifying transcripts of 449 bp). The β-actin served as an internal control (products: 500 bp).

Download figure to PowerPoint

thumbnail image

Figure 5. A–C: Relative amount of VEGF-C (A), VEGF-D (B), and VEGFR-3 (C) mRNA in malignant melanomas with lymph node metastasis and nonmetastasis. The expression of VEGF-C, VEGF-D, and VEGFR-3mRNA in malignant melanomas with lymph node metastasis was significantly higher than that in nonmetastatic malignant melanomas (P < 0.05).

Download figure to PowerPoint

VEGF-C, VEGF-D, and VEGFR-3 in Univariate and Multivariate Analyses of Survival

Univariate analysis for overall survival revealed six significant variables: VEGF-C, VEGF-D, VEGFR-3, lymphatic vessel number, tumor thickness, and presence of ulceration (Table 4). Multivariate analysis for overall survival identified two significant variables: VEGF-C and VEGF-D (Table 4). Univariate analysis and multivariate analysis for disease-free survival identified the same significant variables as the analysis for overall survival (Table 5). The multivariate hazard ratio model identified the expression of VEGF-C (overall survival, P = 0.001; disease-free survival, P = 0.001) and VEGF-D (overall survival, P = 0.013; disease-free survival, P = 0.025) as independent prognostic factors for both overall survival and disease-free survival (Tables 4, 5). In contrast, VEGFR-3, lymphatic vessel number and lymph node metastasis showed no significant correlation with patients' overall survival or disease-free survival.

Table 4. Univariate analysis for overall survival
VariablesUnivariate analysis for overall survivalMultivariate analysis for overall survival
Hazard ratio95% CIP valueHazard ratio95% CIP value
Age (>45 vs. ≤45 years)1.3460.655–2.7650.419   
Gender (male vs. female)1.1400.607–2.4130.684   
Location (extremities vs. head, neck and trunk)0.6330.320–1.2520.189   
VEGF-C (positive vs. negative)3.7851.914–7.487<0.0013.8621.722–8.6590.001
VEGF-D (positive vs. negative)3.3641.687–6.7100.0012.7281.232–6.0410.013
VEGFR-3 (positive vs. negative)2.3421.195–4.5910.0131.1990.441–3.2590.721
Lymphatic vessel number (>10 vs. ≤10)2.7011.430–5.1020.0021.0640.466–2.4300.882
Lymph node metastasis (yes vs. no)1.2030.638–2.2670.568   
Tumor thickness (>1 vs. ≤1mm)2.0691.035–4.1360.0400.7540.314–1.8110.528
Ulceration (yes vs. no)2.0601.094–3.8790.0251.7370.803–3.7570.161
TNM stage (III IV vs. I II)1.9600.895–4.2890.092   
Table 5. Univariate analysis and multivariate analysis for disease-free survival
VariablesUnivariate analysis for disease-free survivalMultivariate analysis for disease-free survival
Hazard ratio95% CIP valueHazard ratio95% CIP value
Age (>45 vs. ≤45 years)1.3670.667–2.8000.393   
Gender (male vs. female)1.1870.635–2.2160.591   
Location (extremities vs. head, neck and trunk)0.6680.339–1.3150.243   
VEGF-C (positive vs. negative)3.8971.979–7.674<0.0013.8741.755–8.5480.001
VEGF-D (positive vs. negative)3.1111.590–6.0860.0012.4491.120–5.3540.025
VEGFR-3 (positive vs. negative)2.3841.223–4.6480.0111.3810.524–3.6400.514
Lymphatic vessel number (>10 vs. ≤10)2.5451.359–4.7650.0040.9360.420–2.0880.872
Lymph node metastasis (yes vs. no)1.1090.594–2.0690.746   
Tumor thickness (>1 vs. ≤1mm)2.0751.042–4.1320.0380.7560.315–1.8160.532
Ulceration (yes vs. no)1.9391.040–3.6180.0371.5670.740–3.3190.241
TNM stage (III IV vs. I II)1.9410.890–4.2330.095   

As far as the survival of patients was concerned, in multivariate analysis (adjusted for age, gender, location of the tumor, lymphatic vessel number, lymph node status, tumor thickness, ulceration, and TNM stage), both VEGF-C and VEGF-D expression were found to be significant independent indicators of poorer overall survival and reduced disease-free survival. Patients with VEGF-C–positive tumors were found to have significantly shorter survival times and reduced disease-free survival compared with those with VEGF-C–negative tumors (P < 0.001, Fig. 6A), and patients with high VEGF-D expression also showed poorer overall survival and reduced disease-free survival compared with those with VEGF-D–negative tumors (P < 0.001, Fig. 6B).

thumbnail image

Figure 6. Kaplan-Meier survival analysis of overall survival and disease-free survival depending on VEGF-C and VEGF-D expression in malignant melanoma. VEGF-C and VEGF-D expression exhibited significantly poorer overall survival and decreased disease-free survival than those with negative expression (P < 0.001, log-rank test).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

VEGF-C and VEGF-D Expression, Tumor Lymphangiogenesis, and Lymph Node Metastasis

Cutaneous malignant melanomas are distinguished by their propensity for metastatic spread, by means of the lymphatic vessels, to regional lymph nodes, even at the early stage of tumor invasion. Hence, lymphangiogenesis and lymph node metastasis, as determined by the analysis of regional lymph nodes, are important determinants in the staging and clinical management of melanomas (Balch et al., 2001).

VEGF-C and VEGF-D are well-known stimulators of lymphangiogenesis, through their activation of VEGFR-3 (Shida et al., 2006; Mylona et al., 2007). Experiments with transgenic mice have shown that overexpression of VEGF-C resulted in lymphatic endothelial proliferation and vessel enlargement (Jeltsch et al., 1997). Skobe et al. (2001b) reported that VEGF-C–overexpressing breast cancer cells induced tumoral lymphangiogenesis and lymph node metastasis. The significance of VEGF-C expression in relation to lymph node metastasis and patient outcome has been reported in cancers of the esophagus, stomach, and colorectum (Kitadai et al., 2001; Amioka et al., 2002; Furudoi et al., 2002). However, Dadras et al. (2003) detected only low-level expression of VEGF-C in human melanomas, which did not significantly correlate with the metastatic potential of the primary tumors. Conversely, our studies did find a correlation between the occurrence of tumor metastasis and tumor expression of VEGF-C, confirming previous studies that have reported positive relationships between VEGF-C expression in tumor cells and lymphangiogenesis and lymphatic metastasis (Skobe et al., 2001b; Stacker et al., 2002).

However, the relationships between VEGF-D expression, lymphangiogenesis and lymph node metastasis in tumors are still controversial (Yonemura et al., 2005). Stacker et al. (2001) demonstrated that VEGF-D induced lymphangiogenesis in a mouse tumor model. VEGF-D was detected in tumor cells and in vessels adjacent to immunopositive tumor cells, but not in vessels distant from the tumors. These findings were consistent with a model in which VEGF-D secreted by tumor cells activates endothelial cell receptors, and thereby contributes to the regulation of tumor lymphangiogenesis (Achen et al., 2001). Dadras et al. (2003) detected no expression of VEGF-D in melanoma cells. Lymphatic vessel growth might be stimulated by other, unknown growth factors, possibly including members of the fibroblast growth factor family (Kubo et al., 2002). Recent evidence has indicated that peritumoral inflammation and VEGF-C produced by inflammatory cells might also contribute to the induction of lymphangiogenesis (Skobe et al., 2001a). The involvement of both VEGF-C and VEGF-D in the lymphatic spread of melanoma cells may lead to a new clinical application for the evaluation of lymphatic invasion by cancer cells in patients with malignant melanomas. In our study, the expressions of VEGF-C and VEGF-D were associated with peritumoral lymphangiogenesis and showed a close relationship with lymph node metastasis in malignant melanomas. Findings reported by several investigators have supported the hypothesis that VEGF-C and VEGF-D are stimulators of lymphangiogenesis and lymph node metastasis in human cancers (Krishnan et al., 2003; Nakamura et al., 2005; Miyata et al., 2006). However, VEGF-C and VEGF-D do not always stimulate lymphangiogenesis, and several investigators have speculated that the properties of VEGF-C and VEGF-D in lymphangiogenesis and angiogenesis might depend on the degree of their proteolytic processing. Briefly, proteolytic processing alters the binding affinities for their receptor on the surface of the lymphatic and vascular endothelia (Miyata et al., 2006). Our results indicate that VEGF-C and VEGF-D expression could be a potentially powerful tool for the prediction of lymph node metastasis in malignant melanomas.

Prognostic Value of VEGF-C, VEGF-D

Although several clinical, histological, and molecular prognostic indicators have been described (Clemente et al., 1996; Elder, 1999; Duncan et al., 2001), cutaneous melanoma prognosis is currently based predominantly on tumor thickness (Balch et al., 2001). However, the prognostic value of tumor thickness is limited, because a considerable number of patients with thin melanomas die of metastatic disease, whereas many of those with thick tumors experience long-term survival. There is therefore an urgent need for new and more effective prognostic indicators of metastasis in patients with malignant melanomas (Dadras et al., 2003). In our study, multivariate analysis indicated no prognostic significance of tumor thickness in malignant melanoma.

With respect to the relationship between lymphangiogenesis and patient' survival, several investigators have reported that, for several cancer types, including malignant melanoma, lymphangiogenesis correlated with lymphatic invasion (Schoppmann et al., 2002; Dadras et al., 2005; Nakamura et al., 2005). In contrast, some investigators have reported that lymphangiogenesis was not associated with tumor invasion in cutaneous melanoma (Straume et al., 2003), head and neck cancer (Franchi et al., 2004), and bladder cancer (Miyata et al., 2006). Franchi et al. (2004) reported that high lymphatic vessel density was associated with lymph node metastasis, but not with patient survival. Furthermore, Nakamura et al. (2005) reported that high lymphatic vessel density was associated with a shorter duration of survival, but it was not identified as an independent prognostic factor by multivariate analysis. Our data are in line with the findings of Franchi and colleagues. Based on our results, we speculate that lymphangiogenesis is associated with tumor lymph node metastasis, but is not a significant prognostic indicator in cutaneous malignant melanoma.

A significant relationship between high VEGF-C and VEGF-D expression and poor prognosis has been reported in many different tumor types (Onogawa et al., 2004; Miyata et al., 2006; Shida et al., 2006; Mylona et al., 2007), although few studies have reported on VEGF-C expression and its prognostic significance in malignant melanoma (Goydos and Gorski, 2003; Schietroma et al., 2003), and to our knowledge, none have reported on the prognostic significance of VEGF-D in malignant melanoma.

Mylona et al. (2007) confirmed VEGF-C as an independent indicator of poor prognosis in breast carcinoma, and similar results have been shown for several cancer types (Herrmann et al., 2007; Mohammed et al., 2007). VEGF-D was defined as a novel, independent prognostic marker, aiding the identification of patients with poor prognoses after curative resection of gastric adenocarcinomas (Juttner et al., 2006). VEGF-D was also shown to be an independent prognostic factor for survival in patients with breast cancer (Nakamura et al., 2005) and colorectal carcinoma (White et al., 2002).

We evaluated the prognostic significance of VEGF-C and VEGF-D expression in melanoma patients. Those with cutaneous malignant melanomas expressing VEGF-C and VEGF-D protein and mRNA had poorer prognoses compared with those with expression-negative tumors. Univariate and multivariate analyses identified VEGF-C and VEGF-D as independent indicators for predicting both overall survival and disease-free survival in patients with malignant melanomas.

Our results show that VEGFR-3 expression was not restricted to the microvessel endothelium, but also appeared in tumor cells and in the peritumoral stroma. The expression of tumor VEGFR-3 has been found to be an independent indicator of poor prognosis in patients with breast cancer and gastric adenocarcinomas (Juttner et al., 2006; Mylona et al., 2007). However, VEGFR-3 does not serve as a valid prognostic marker for the prediction of lymph node involvement in patients with primary melanoma or colorectal carcinomas (White et al., 2002; Wobser et al., 2006). As lymphatic spread is a complex, multi-step process, several different biomarkers must be combined to define new prognostic subgroups in cutaneous melanoma (Wobser et al., 2006).

In summary, our study demonstrates that VEGF-C and VEGF-D produced by tumor cells play important roles in tumor lymphangiogenesis, and that the expression of VEGF-C and VEGF-D are closely correlated with lymph node metastasis, as well as patient survival. The results of univariate and multivariate analyses identified VEGF-C and VEGF-D as independent prognostic indicators in malignant melanoma. Thus, the determination of VEGF-C and VEGF-D expression could further enhance the accuracy of prognostic evaluation in patients with malignant melanoma. Prospective clinical trials are needed to further validate the prognostic value of tumor lymphangiogenesis for metastasis and patient survival in malignant melanoma.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

The authors thank Yingzhun Chen and Xiaomei Li for their excellent assistance.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED
  • Achen MG,Williams RA,Minekus MP,Thornton GE,Stenvers K,Rogers PA,Lederman F,Roufail S,Stacker SA. 2001. Localization of vascular endothelial growth factor-D in malignant melanoma suggests a role in tumor angiogenesis. J Pathol 193: 147154.
  • Amioka T,Kitadai Y,Tanaka S,Haruma K,Yoshihara M,Yasui W,Chayama K. 2002. Vascular endothelial growth factor-C (VEGF-C) expression predicts lymph node metastasis of human gastric carcinomas invading the submucosa. Eur J Cancer 38: 14131419.
  • Balch CM,Buzaid AC,Soong SJ,Atkins MB,Cascinelli N,Coit DG,Fleming ID,Gershenwald JE,Houghton AJr,Kirkwood JM,McMasters KM,Mihm MF,Morton DL,Reintgen DS,Ross MI,Sober A,Thompson JA,Thompson JF. 2001. Final version of the American joint committee on cancer staging system for cutaneous melanoma. J Clin Oncol 19: 36353648.
  • Clemente CG,Mihm MCJr,Bufalino R,Zurrida S,Collini P,Cascinelli N. 1996. Prognostic value of tumor infiltrating lymphocytes in the vertical growth phase of primary cutaneous melanoma. Cancer 77: 13031310.
  • Dadras SS,Paul T,Bertoncini J,Brown LF,Muzikansky A,Jackson DG,Ellwanger U,Garbe C,Mihm MC,Detmar M. 2003. Tumor lymphangiogenesis, A novel prognostic indicator for cutaneous melanoma metastasis and survival. Am J Pathol 162: 19511960.
  • Dadras SS,Lange-Asschenfeldt B,Velasco P,Nguyen L,Vora A,Muzikansky A,Jahnke K,Hauschild A,Hirakawa S,Mihm MC,Detmar M. 2005. Tumor lymphangiogenesis predicts melanoma metastasis to sentinel lymph nodes. Mod Pathol 18: 12321242.
  • Duncan LM,Deeds J,Cronin FE,Donovan M,Skober AJ,Kauffman M,McCarthy JJ. 2001. Melastatin expression and prognosis in cutaneous malignant melanoma. J Clin Oncol 19: 568576.
  • Elder D. 1999. Tumor progression, early diagnosis and prognosis of melanoma. Acta Oncol 38: 535547.
  • Franchi A,Gallo O,Massi D,Baroni G,Santucci M. 2004. Tumor lymphangiogenesis in head and neck squamous cell carcinoma. A morphometric study with clinical correlations. Cancer 101: 973978.
  • Furudoi A,Tanaka S,Haruma K,Kitadai Y,Yoshihara M,Chayama K,Shimamoto F. 2002. Clinical significance of vascular endothelial growth factor C expression and angiogenesis at the deepest invasive site of advanced colorectal carcinoma. Oncology 62: 157166.
  • Goydos JS,Gorski DH. 2003. Vascular endothelial growth factor C mRNA expression correlates with stage of progression in patients with melanoma. Clin Cancer Res 9: 59625967.
  • Herrmann E,Eltze E,Bierer S,Kopke T,Gorge T,Neumann J,Hertle L,Wulfing C. 2007. VEGF-C, VEGF-D and Flt-4 in transitional bladder cancer: relationships to clinicopathological parameters and long-term survival. Anticancer Res 27: 31273133.
  • Jeltsch M,Kaipanen A,Joukov V,Meng X,Lakso M,Rauvala H,Swartz M,Fukumura D,Jain RK,Alitalo K. 1997. Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science 276: 14231425.
  • Juttner S,Wissmann C,Jons T,Vieth M,Hertel J,Gretschel S,Schlag PM,Kemmner W,Hocker M. 2006. Vascular endothelial growth factor-D and its receptor VEGFR-3: two novel independent prognostic markers in gastric adenocarcinoma. J Clin Oncol 24: 228240.
  • Kitadai Y,Amioka T,Haruma K,Tanaka S,Yoshihara M,Sumii K,Matsutani N,Yasui W,Chayama K. 2001. Clinicopathological significance of vascular endothelial growth factor (VEGF)-C in human esophageal squamous cell carcinomas. Int J Cancer 93: 662666.
  • Krishnan J,Kirkin V,Steffen A,Hegen M,Weih D,Tomarey S,Wilting J,Sleeman JP. 2003. Differential in vivo and in vitro expression of vascular endothelial growth factor-C and -D in tumors and its relationship to lymphatic metastasis in immunocompetent rats. Cancer Res 63: 713722.
  • Kubo H,Cao R,Brakenhielm E,Makinen T,Cao Y,Alitalo K. 2002. Blockade of vascular endothelial growth factor receptor-3 signaling inhibits fibroblast growth factor-2 induced lymphangiogenesid in mouse cornea. Proc Natl Acad Sci U S A 99: 88688873.
  • Kurahara H,Takao S,Maemura K,Shinchi H,Natsugoe S,Aikou T. 2004. Impact of vascular endothelial growth factor-C and -D expression in human pancreatic cancer: its relationship to lymph node metastasis. Clin Cancer Res 10: 84138420.
  • Leong SPL. 2004. Paradigm of metastasis for melanoma and breast cancer based on the sentinel lymph node experience. Ann Surg Oncol 11: 192S197S.
  • Leong SPL,Thelmo MC,Kim RP,Gokhale R,Rhee JY,Achtem TA,Morita E,Allen RE,Kashani-Sabet M,Sagebiel RW. 2003. Delayed harvesting of sentinel lymph nodes after previous wide local excision of extremity melanoma. Ann Surg Oncol 10: 196200.
  • McColl BK,Stacker SA,Achen MG. 2004. Molecular regulation of the VEGF family-inducers of angiogenesis and lymphangiogenesis. APMIS 112: 463480.
  • Miyata Y,Kanda S,Ohba K,Nomata K,Hayashida Y,Eguchi J,Hayashi T,Kanetake H. 2006. Lymphangiogenesis and angiogenesis in bladder cancer: prognostic implications and regulation by vascular endothelial growth factors-A, -C, and -D. Clin Cancer Res 12: 800806.
  • Mohammed RA,Green A,El-Shikh S,Paish EC,Ellis IO,Martin SG. 2007. Prognostic significance of vascular endothelial cell growth factors -A, -C and -D in breast cancer and their relationship with angio- and lymphangiogenesis. Br J Cancer 96: 10921100.
  • Mylona E,Alexandrou P,Mpakali A,Giannopoulou I,Liapis G,Markaki S,Keramopoulos A,Nakopoulou L. 2007. Clinicopathological and prognostic significance of vascular endothelial growth factors (VEGF)-C and -D and VEGF receptor 3 in invasive breast carcinoma. Eur J Surg Oncol 33: 294300.
  • Nakamura Y,Yasuoka H,Tsujimoto M,Imabun S,Nakahara M,Nkao K,Nakamura M,Mori I,Kakudo K. 2005. Lymph vessel density correlates with nodal status, VEGF-C expression, and prognosis in breast cancer. Breast Cancer Res Treat 91: 125132.
  • Onogawa S,Kitsadai Y,Tanaka S,Kuwai T,Kimura S,Chayama K. 2004. Expression of VEGF-C and VEGF-D at the invasive edge correlates with lymph node metastasis and prognosis of patients with colorectal carcinoma. Cancer Sci 95: 3239.
  • Schietroma C,Cianfarani F,Lacal PM,Odorisio T,Orechia A,Kanitakis J,D'Atri S,Failla CM,Zambruno G. 2003. Vascular endothelial growth factor-C expression correlates with lymph node localization of human melanoma metastases. Cancer 98: 789797.
  • Schoppmann SF,Birner P,Stockl J,Kalt R,Ullrich R,Caucig C,Kriehuber E,Nagy K,Alitalo K,Kerjaschki D. 2002. Tumor-associated macrophage express lymphatic endothelial growth factors and are related to peritumoral lympangiogenesis. Am J Pathol 161: 947956.
  • Shida A,Fujioka S,Ishibashi Y,Kobayashi K,Nimura H,Mitsumori N,Suzuki Y,Kawakami M,Yanaga K. 2005. Prognostic significance of vascular endothelial growth factor D in gastric carcinoma. World J Surg 29: 16001607.
  • Shida A,Fujioka S,Kobayashi K,Ishibashi Y,Nimura H,Mitsumori N,Yanaga K. 2006. Expression of vascular endothelial growth factor (VEGF)-C and -D in gastric carcinoma. Int J Oncol 11: 3843.
  • Skobe M,Hamberg LM,Hawighorst T,Schirner M,Wolf GL,Alitalo K,Delmar M. 2001a. Concurrent induction of lymphangiogenesis, angiogenesis and macrophage recruitment by VEGF-C in melanoma. Am J Pathol 159: 893903.
  • Skobe M,Hawighorst T,Jackson DG,Prevo R,Janes L,Velasco P,Riccardi L,Alitalo K,Claffey K,Detmar M. 2001b. Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat Med 7: 192198.
  • Stacker SA,Caesar C,Baldwin ME,Thornton G,Williams RA,Prevo R,Jackson DG,Nishikawa S,Kubo H,Achen MG. 2001. VEGF-D promotes the metastatic spread of tumor cells via the lymphatics. Nat Med 7: 186191.
  • Stacker SA,Achen MG,Jussila L,Baldwin ME,Alitalo K. 2002. Lymphangiogenesis and cancer metastasis. Nat Rev Cancer 2: 573583.
  • Straume O,Jackson DG,Akslen LA. 2003. Independent prognostic impact of lymphatic vessel density and presence of low-grade lymphangiogenesis in cutaneous melanoma. Clin Cancer Res 9: 250256.
  • White JD,Hewett PW,Kosuge D,McCulloch T,Enholm BC,Carmichael J and Murray JC. 2002. Vascular endothelial growth factor-D expression is an independent prognostic marker for survival in colorectal carcinoma. Cancer Res 62: 16691675.
  • Wobser M,Siedel C,Schrama D,Brocker EB,Becker JC,Vetter-Kauczok CS. 2006. Expression pattern of the lymphatic and vascular markers VEGFR-3 and CD31 does not predict regional lymph node metastasis in cutaneous melanoma. Arch Dermatol Res 297: 352357.
  • Yokoyama Y,Charnock-Jones DS,Licence D,Yanaihara A,Hastings JM,Holland CM,Emoto M,Sakamoto A,Maruyama H,Sato S,Mizunuma H,Smith SK. 2003. Expression of vascular endothelial growth factor D and its receptor VEGFR-3, as a prognostic factor in endometrial carcinoma. Clin Cancer Res 3: 13611369.
  • Yonemura Y,Endo Y,Tabata K,Kawanura T,Yun HY,Bandou E,Sasaki T,Miura M. 2005. Role of VEGF-C and VEGF-D in lymphangiogenesis in gastric cancer. Int J Clin Oncol 10: 318327.