Transforming Growth Factor-β Suppressed Id-1 Expression in a smad3-Dependent Manner in LoVo Cells

Authors

  • Hongjiang Song,

    1. Department of Surgery, Tumor Hospital of Harbin Medical University, Harbin, China
    Search for more papers by this author
    • Hongjiang Song and Baoliang Guo contributed equally to this work.

  • Baoliang Guo,

    1. Department of Surgery, the Second Affiliated Hospital of Harbin Medical University, Harbin, China
    Search for more papers by this author
    • Hongjiang Song and Baoliang Guo contributed equally to this work.

  • Jianguo Zhang,

    1. Department of Surgery, the Second Affiliated Hospital of Harbin Medical University, Harbin, China
    Search for more papers by this author
  • Chunfang Song

    Corresponding author
    1. Department of Surgery, the First Affiliated Hospital of Harbin Medical University, Harbin, China
    • Department of General Surgery, the First Clinical College of Harbin Medical University, You Zheng Street 23, Harbin, 150000, China
    Search for more papers by this author
    • Fax: +86-451-84668252


Abstract

TGF-β plays an important role in regulating cell differentiation and proliferation in human cancers such as colorectal cancer. Id-1 has been identified as a marker in colorectal cancer progression. The aim of this study was to investigate the role of TGF-β in regulating Id-1 in LoVo cells. siRNA was used to silence smad2, smad3, and p38 MAPK gene expression in Lovo cells. Interference efficiency and the role of TGF-β on Id-1 expression were analyzed using a luciferase reporter assay, RT-PCR, and Western blotting. Cell viability was determined using the MTT assay. In this study, we demonstrated that TGF-β1 downregulated Id-1 protein expression in LoVo cells. Smad2 and smad3 siRNA inhibited TGF-β1-induced 4×SBE luciferase reporter activity. p38 MAPK siRNA inhibited TGF-β1-induced 3×AP-1 luciferase reporter activity. However, the suppression of Id-1 by TGF-β1 was recovered by smad3 siRNA but not smad2 or p38 MAPK siRNA. Moreover, TGF-β1 stimulated cellular proliferation and p21Waf1 protein expression, which might be mediated by suppressing Id-1 expression. In conclusion, this study demonstrated that TGF-β1 suppressed Id-1 expression in a smad3-dependent manner in LoVo cells using RNAi technology. These results provide new insight into the mechanisms of TGF-β function in colorectal cancer cells. Anat Rec, 2010. © 2009 Wiley-Liss, Inc.

Transforming growth factor-β (TGF-β) has a wide range of biological functions, such as the regulation of cell growth, differentiation, and immunological response in various types of cells (Moustakas et al.,2000). TGF-β is known to act as a tumor suppressor in early stages of tumorigenesis and promote tumor cell invasiveness and metastasis in advanced tumor stages (Roberts and Wakefield,2003). TGF-β signals through transmembrane serine/threonine kinase receptors and intracellular effectors, termed smad proteins (Shi and Massague,2003). Besides smad-mediated transcription, TGF-β also activates other signaling cascades including mitogen-activated protein kinase (MAPK) pathways (Yu et al.,2002). Taken together, these data suggest that both smad and MAPK pathways are involved in TGF-β signaling and TGF-β-regulated gene expression. However, it remains to be clarified how TGF-β regulates its target genes in various cell types.

Id-1 (inhibitor of DNA binding protein-1) is a member of the Id protein that belongs to the HLH (helix-loop-helix) transcription factor family. Id proteins lack a basic DNA binding domain and function as dominant negative regulators by forming heterodimers with bHLH (basic HLH) protein (Benezra et al.,1990), and they play a pivotal role in the regulation of cellular proliferation (Sikder et al.,2003). Id-1 is upregulated in many types of human cancers, including colorectal cancer, and increased Id-1 expression has been associated with a poor treatment outcome and shorter survival (Schoppmann et al.,2003; Lee et al.,2004; Forootan et al.,2007; Zhao et al.,2008). Recent studies have shown that Id-1 is one of the direct TGF-β1 target genes (Ling et al.,2002; Coppe et al.,2003). However, the molecular mechanisms of TGF-β regulated Id-1 expression in colorectal cancer remain unknown.

RNA interference (RNAi) technology provides a novel strategy for investigating gene expression and function (Shrivastava and Shrivastava,2008). Small interfering RNA (siRNA) has been shown to specifically inhibit gene expression in mammals through the RNAi mechanism, where it cleaves the mRNA that corresponds to the target gene (Sui et al.,2002). Thus, siRNA can be used to investigate gene function and gene-specific therapeutic activities through targeting the mRNA of the specific gene of interest.

Therefore, the aim of this study is to investigate the role of TGF-β in regulating Id-1 expression and to provide new insights into the mechanisms of TGF-β regulated genes in colorectal cancer cells.

MATERIALS AND METHODS

Materials

Human recombinant TGF-β1 was obtained from R&D Systems (Minneapolis, MN,). Anti-p38 MAPK, smad2, smad3, smad2/3, p-smad2/3, Id-1, p16INK4a, p21Waf1, and Id-1 siRNA, control siRNA for Id-1 siRNA were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-β-actin antibodies were purchased from Sigma–Aldrich (Steinheim, Germany). Anti-p-p38 MAPK, p38 MAPK siRNA, and control siRNA for p38 MAPK siRNA were purchased from Upstate (Lake Placid, NY). The 3×AP-1 luciferase reporter plasmid was bought from Promega (Madison, WI). The 4×SBE luciferase reporter plasmids were kindly provided by Dr. Carl-Henrik Heldin (Ludwig Institute for Cancer Research, Sweden). The MTT assay kit was obtained from R&D Systems (Minneapolis, MN).

Cell Culture

LoVo cells were obtained from the American Type Culture Collection (Rockville, MD). Cells were grown in DMEM/HAM F12 (1:1) supplemented with fetal calf serum (10%), glutamine (2 mM), nonessential amino acids (1%), and insulin (10 μg/mL) at 37°C in a humidified 95% air and 5% CO2 atmosphere. Cells were grown to 70%–80% confluency in the indicated medium on 24-well plates. For experiments, the LoVo cells were starved for 24 hr by incubation with FBS-free medium containing 0.2% bovine serum albumin (BSA).

siRNA Sequence

Smad2 and smad3 siRNAs were derived from the coding sequence of the human smad2 and smad3 genes (NM005901 and NM005902). The siRNA selection was based on the program at the Qiagen homepage (Tokyo, Japan,www1.qiagen.com). Sequences were identified against the GenBank database and were synthesized by Qiagen Company. Target sequences (5′–3′) and the siRNA duplexes are as follows: smad2: AACAAACCAGGTCTCTTGATG and smad3: AAGATAAAGAAACCAGTGACC. In addition, a nonspecific, scrambled siRNA duplex (Scramble II duplex), used as a control for siRNA transfection, was purchased from QIAGEN.

Transfection of siRNA Duplex and Luciferase Reporter Assay

Cells were grown to 70%–80% confluency in the indicated medium on six-well plates. Transfection of the target siRNA and the scrambled (control) duplex was performed with Lipofectamine reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. The amount of transfected siRNA was kept constant by addition of scrambled siRNA. For the reporter assay, the indicated plasmid construct and siRNA duplex were transfected with Lipofectamine reagent. CMV-β-galactosidase-containing plasmid was cotransfected as a control for monitoring transfection efficiency. Three hours after transfection, cells were allowed to recover in culture medium for 24 hr. Cells were then starved with FBS-free medium containing 0.2% BSA for 24 hr, followed by stimulation with TGF-β1 for 24 hr. After washing twice with cold phosphate-buffered saline (PBS), cells were lysed in 200 μL of reporter lysis buffer (Promega, Madison, WI). In 20 μL aliquots, the luciferase activity was measured using the Luciferase Assay System (Promega) and a luminometer (Auto LUMIcounter Nu1422ES; Nition, Tokyo, Japan). Luciferase activity was normalized using β-galactosidase activity.

Reverse Transcriptase-Polymerase Chain Reaction

Total RNA was extracted using TRIzol (Invitrogen) according to the manufacturer's instructions. RT-PCR was performed as previously described (Guo et al.,2004). Briefly, total RNA (1 μg) was reverse transcribed with random hexamers using the Gene-Amp RNA-PCR kit (Perkin-Elmer, Branchburg, NJ), following the manufacturer's directions. Smad2: forward, 5′-ACTATACCCACTCCATTCCA-3′, reverse, 5′-CACTATCACTTAGGCACTCG-3′. The cycling conditions were 30 cycles of 30 sec at 94°C, 45s at 50°C, and 60 sec at 72°C. Smad3: forward, 5′-ACAGCATGGACGCAGGTTCT-3′, reverse, 5′-TCACTGAGGCACTCCGCAAA-3′. The cycling conditions were 30 cycles of 45 sec at 94°C, 45 sec at 53°C, and 60 sec at 72°C. p38 MAPK: forward, 5′-TCGAGACCGTTTCAGTCCAT-3′, reverse, 5′-CCACGGACCAAATATCCACT-3′. The cycling conditions were 36 cycles of 30 sec at 94°C, 30 sec at 54°C, and 60 sec at 72°C. β-actin: forward, 5′-ACAATGAGCTGCGTGTGGCT-3′, reverse, 5′-TCTCCTTCTGCATCCTGTCG-3′. The cycling conditions were 25 cycles of 30 sec at 94°C, 30 sec at 58°C, and 60 sec at 72°C. The resulting products were separated on 1% agarose gel and stained with ethidium bromide, photographed, and scanned. The relative integrated density of each band was digitized by multiplying the absorbance of the surface area (Luminator Imaginator II; Funakoshi, Tokyo, Japan). All experiments were performed at least three times, with similar results.

Immunoblot Analysis

Western blotting was performed as previously described (Guo et al.,2005). LoVo cells were lysed in an ice-cold lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% SDS, 1% Nonidet P-40, and a protease inhibitor cocktail (Boehringer Mannheim, Germany). Equal amounts of cell lysate protein (30 μg of protein per lane) were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinyl difluoride membranes (Immobilon, Bedford, MA). The membranes were probed with the indicated specific antibodies. Bound primary antibodies were incubated with horseradish peroxidase-labeled secondary antibodies and then developed using an enhanced chemiluminescence detection system according to the manufacturer's instructions (New England Biolaboratory).

In Vitro Growth Assay

Cellular proliferation was determined by the MTT (3- [4, 5-dimethyltiazol-2-yl]-2,5-diphenyltetraolium) bromide assay. Briefly, cells were plated on 96-well plates at a density of 1 × 105 cells/well. After TGF-β stimulation for the indicated durations, cells were treated with a solution of MTT and incubated for 1 hr at 37°C. The cells were then washed gently with PBS, and 100 μL of dimethylsulfoxide was added to the wells followed by mild shaking to dissolve the MTT precipitate. The absorbance of each sample well was measured using an automated plate reader. All experiments were performed three times in triplicate.

Statistical Analysis

Results were expressed as the means ± SE. Analysis of variance with a subsequent Scheffe's test was used to determine significant differences in multiple comparisons. A P value of < 0.05 was considered statistically significant.

RESULTS

Effect of TGF-β on Id-1 Expression in LoVo Cells

Cells were grown between 70% and 80% confluency, then starved with FBS-free medium containing 0.2% BSA for 24 hr, followed by stimulation with TGF-β1 for the indicated times. Cells were harvested, and immunoblot analysis was performed. TGF-β1 stimulated smad2, smad3, and p38MAPK protein phosphorlyation (Fig. 1A). TGF-β1 inhibited Id-1 protein expression in a time-dependent manner with a statistically significant inhibition at 48 hr (Fig. 1B). A dose-dependency was also observed with a maximal inhibition at 1 ng/mL (Fig. 1C). In subsequent experiments, cells were treated with 1 ng/mL TGF-β1 for 48 hr.

Figure 1.

TGF-β1 inhibited Id-1 protein expression in LoVo cells. A: Cells were treated with TGF-β1 (1 ng/mL) for 15 min. Total protein (30 μg) was subjected to Western blot analysis. The membrane was reprobed with antibody, resepctively. TGF-β1 stimulated smad2, smad3, and p38 MAPK protein phosphorylations. B: Cells were treated with TGF-β1 for the indicated periods. TGF-β1 suppressed Id-1 protein expression in a time-dependent manner. Cells were incubated with TGF-β1 at the indicated concentrations for 48 hr. Immunoblot analysis was performed and densitometric analysis of three independent experiments was performed. The data are expressed as mean ± SE. * P < 0.05 versus control.

Suppression of smad2, smad3 and p38 MAPK mRNA and Protein Expression by Target siRNA in LoVo Cells

First, we examined the effect of target siRNA on TGF-β signal protein expression in LoVo cells. After transfection using target siRNA, the RT-PCR and immunoblot analysis were performed. As shown in Fig. 2A, smad2, smad3, and p38 MAPK mRNA expression were reduced, respectively. Western blot results showed smad2, smad3, and p38 MAPK protein expressions were significantly inhibited, respectively (Fig. 2B).

Figure 2.

Silencing target gene mRNA and protein expressions by siRNA in LoVo cells. Cells were transfected with smad2 siRNA, smad3 siRNA, or p38 MAPK siRNA. Scrambled control siRNA was cotransfected as an internal control. Total RNA and protein were extracted. Target gene mRNA and protein expression were detected by RT-PCR (Fig. 2A) and immunoblot analysis (Fig. 2B). A representative blot from three independent experiments is shown.

Effect of Target siRNA on TGF-β Signaling

We next investigated the effect of siRNA on TGF-β-responsive luciferase reporter activities. As shown in Fig. 3A, the 4×SBE luciferase reporter was activated by TGF-β1 in LoVo cells. When cells were cotransfected with smad2 or smad3 siRNA, TGF-β1-activated 4×SBE reporter activity was significantly inhibited. Our previous report (Guo et al.,2004) suggested that the activation of the MAPK pathway by TGF-β was followed by the activation of the transcription factor, activator protein-1 (AP-1), and the induction of TGF-β-responsive gene transcription. Thus, we next examined the effect of p38 MAPK siRNA on 3×AP-1 reporter activity. As shown in Fig. 3B, the 3×AP-1 reporter activity was increased after TGF-β1 stimulation, and this activation was significantly inhibited by cotransfection with p38 MAPK siRNA. These results suggested that both smad and MAPK participate in the TGF-β1-induced smad signaling pathway in LoVo cells.

Figure 3.

Effect of target siRNA on TGF-β1-induced reporter activities. Smad2 or smad3 siRNA suppressed 4×SBE luciferase reporter activity induced by TGF-β1 (A). p38 MAPK siRNA suppressed 3×AP-1 luciferase reporter activity induced by TGF-β1 (B). Cells were transiently transfected with the indicated construct plasmids and siRNAs. Cells were lysed and luciferase activity was measured. Luciferase activity was normalized against β-galactosidase activity, and the results are expressed as the mean ± SE. Results were obtained in triplicate in at least three independent experiments. * P < 0.05 versus control. #P < 0.05 versus TGF-β1.

Effect of Target siRNA on TGF-β1-Inhibited Id-1 Protein Production

We next investigated the effect of target siRNA on TGF-β-inhibited Id-1 production. As shown in Fig. 4A, Id-1 protein expression was decreased by TGF-β1 stimulation for 48 hr, and the inhibition was recovered after transfection with smad3, but not with smad2. In addition, p38 MAPK siRNA also did not affect TGF-β1-inhibited Id-1 production (Fig. 4B).

Figure 4.

Effect of siRNA on TGF-β1-inhibited Id-1 protein expression. TGF-β1-surpressed Id-1 protein expression was recovered by smad2 siRNA (A), but not smad3 siRNA(A) and p38 MAPK siRNA (B). Three hours after transfection with smad2, smad3, or p38 MAPK siRNA, cells were recovered for 16 hr and starved for an additional 24 hr followed by stimulation with TGF-β1 for 48 hr. Total proteins were analyzed by immunoblotting. The membrane was reprobed with β-actin. A representative example from three independent experiments is shown. * P < 0.05 versus control. #P < 0.05 versus TGF-β1.

Effect of TGF-β on Cellular Proliferation and p21Waf1 Protein Expression in LoVo Cells

Cell viability was determined using the MTT assay as described in materials and methods. As shown in Fig. 5A, the viability of LoVo cell proliferation was decreased by TGF-β in a time-dependant manner. TGF-β significantly decreased cell proliferation at 48 and 72 hr compared with static cells. Recent studies showed that Id-1 exerts its function by downregulating CDK inhibitors, which effect mammalian cell growth and differentiation. We examined the effect of TGF-β stimulation on p16INK4A and p21Waf1protein expression. Results demonstrated TGF-β stimulated p21Waf1 protein expression but not p16INK4A protein expression (Fig. 5B). Further, Id-1 siRNA was used to clarify the relationship for TGF-β/Id-1/ p21Waf1. Western blot showed that Id-1 protein expression was inhibited and TGF-β-stimulated-p21Waf1 expression was enlarged by Id-1 siRNA (Fig. 5C). These results indicated that TGF-β-stimulated-p21Waf1 expression might be mediated by Id-1.

Figure 5.

Effect of TGF-β on cellular proliferation and p21Waf1 protein expression in LoVo cells. A: Cell viability was measured using the MTT assay. Cells are treated with 1 ng/μL TGF-β for the indicated periods. Results represent the mean ± SE of three independent experiments (*P < 0.001 versus baseline; # P < 0.01 versus control static cells). B: TGF-β1 stimulated p21Waf1 protein expression but not p16INK4A protein expression significantly. C: Id-1 siRNA inhibited Id-1 protein expression and enlarged TGF-β1-induced-p21Waf1 protein expression. Cells were transfected by Id-1 siRNA for 24 hr and then stimulated by TGF-β1 for 48 hr. Total proteins were analyzed by immunoblotting. The membrane was reprobed with β-actin. A representative example from three independent experiments is shown.

DISCUSSION

The results of this study demonstrated that TGF-β1 suppressed Id-1 protein expression in LoVo cells, and this suppression was recovered after transfection with smad3 siRNA but not with smad2 or p38 MAPK siRNA. These findings indicated that TGF-β1 downregulated Id-1 expression in a smad3-dependent manner. Moreover, these results also suggested that TGF-β probably inhibited cell proliferation via suppression of Id-1 expression.

TGF-β mobilizes complex signaling networks to regulate cellular differentiation, proliferation, motility, adhesion, and apoptosis. The TGF-β signaling pathway has been considered as both a tumor suppressor pathway and a promoter of tumor progression and invasion (Derynck et al.,2001). In colorectal cancer cell lines, TGF-β has been shown to play an important role in growth inhibition (Ilyas et al.,1999; Yu et al.,2005). Malfunctions in signaling downstream of TGF-β are implicated in serious human diseases such as cancer (Blobe et al.,2000; Massagué et al.,2000). Clarifying the molecular mechanism of the TGF-β signaling pathway could provide opportunities for the development of novel cancer therapies against specific molecular targets. It is well known that TGF-β regulates gene expression via the smad and/or MAPK pathways in various cell types (Derynck and Zhang,2003). Our results showed that TGF-β stimulated smad2, smad3, and p38MAPK protein phosphorylations. These results indicated that both smad and MAPK participate in TGF-β1-induced smad signaling pathway in LoVo cells. However, the suppression of Id-1 by TGF-β was blocked by smad3 siRNA, but not smad2 or p38MAPK siRNA, indicating that smad3 plays a central role in the suppression of Id-1 by TGF-β1 in LoVo cells. Consistent with our results, other reports have shown that smad protein defects are clearly associated with advanced disease and poor prognosis in human colorectal cancer (Xie et al.,2003). Thus these data insisted that the TGF-β/smad pathway plays an important role in regulating Id-1 expression in colorectal cancer cells.

Id-1 plays important roles in controlling cell growth in both normal and cancer cells. Recent reports have shown that downregulated Id-1 expression is associated with TGF-β-induced growth arrest in prostate epithelial cells and in human hepatoma cells (Damdinsuren et al.,2006). Our results first demonstrated that TGF-β1 inhibited Id-1 expression in LoVo cells, supporting the idea that TGF-β is one of the upstream regulators of Id-1. Moreover, we demonstrated TGF-β inhibited Id-1 expression in a smad3-dependent manner. In addition, previous studies showed that the role of Id-1 in cell proliferation might involve cyclin-dependent kinase inhibitors, such as p16INK4A and p21Waf1 (Lee et al.,2003; Hui et al.,2006). Thus, we examined the effect of TGF-β on growth inhibition and p16INK4A and p21Waf1 protein expression. Results demonstrated that TGF-β inhibited cellular proliferation and stimulated p21Waf1 but not p16INK4A protein expression. Further, Id-1 siRNA enlarged the function of TGF-β-stimulated-p21Waf1 expression. Thus by comparing previous results from other cells (Lee et al.,2003; Hui et al.,2006), it is possible that Id-1 might be involved in TGF-β-induced growth inhibition by regulating p21Waf1 protein expression in LoVo cells. However, further research is needed to clarify this process.

In this study, we used siRNA to identify the mechanism of Id-1 regulation by TGF-β. Compared with traditional methods, siRNA can successfully knock-down any disease-related genes with high specificity and efficiency (Yamanaka et al.,2008). Thus, these results may provide a new therapeutic treatment for TGF-β-related colorectal cancer. In summary, we demonstrated for the first time that TGF-β suppressed Id-1 expression in a smad3-dependent manner in LoVo cells using RNAi technology. This study provides a clear molecular basis for TGF-β-regulated Id-1 expression in LoVo cells, and might provide new insights into the mechanisms of TGF-β-regulated cell proliferation in colorectal cancer cells.

Acknowledgements

The authors are grateful to Dr. C.H. Heldin for the 4×SBE-luc reporter plasmid. We acknowledge the support of Professor Atsunori Kashiwagi and Masakazu Haned from Shiga University of Medical Science and Asahikawa Medical College in Japan.

Ancillary