SEARCH

SEARCH BY CITATION

Keywords:

  • tunicamycin;
  • heme oxygenase-1;
  • vascular smooth muscle cells;
  • proliferation;
  • migration

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

The abnormal proliferation and migration of vascular smooth muscle cell (VSMC), which is triggered by various external stimuli, contributes importantly to the pathogenesis of atherosclerosis and restenosis. Recent studies indicate that the endoplasmic reticulum (ER) stress is intensively involved in the pathophysiological changes of VSMCs by various stimuli. However, the direct effects of ER stress on VSMC proliferation and migration remain unknown. In this study, we found that pretreatment with tunicamycin (Tm), an ER stress inducer, significantly inhibited platelet-derived growth factor (PDGF)-BB-induced VSMC proliferation and migration in a dose-dependent manner without causing significant apoptosis. Tm stimulated the expression of the antioxidant gene heme oxygenase-1 (HO-1) both at the transcriptional and translational levels, while reducing phosphorylation and activation of mitogen-activated protein (MAP) kinases. The negative regulative effects of Tm were associated with a decrease in cyclins and cyclin-dependent kinases (CDKs) activation. More importantly, HO-1 siRNA partially abolished the beneficial effects of Tm on VSMCs. These results indicate that Tm-induced ER stress provides protection against the abnormal VSMC activation by PDGF-BB, which may be mediated by the induction of HO-1 and blockade of cell cycle reentry. Anat Rec, 2012. © 2012 Wiley Periodicals, Inc.

The increased proliferation and migration of vascular smooth muscle cells (VSMCs) are key events in the pathogenesis of atherosclerosis and restenosis (Newby and Zaltsman, 2000). In a normal artery, VSMCs stay in a nonproliferative quiescent state and demonstrate a differentiated contractile phenotype. However, when VSMCs are stimulated by various mitogenic factors including platelet-derived growth factor (PDGF)-BB, they will switch to the active “synthetic” state through the activation of intracellular signal transduction pathways that contribute to VSMC proliferation, migration, and collagen synthesis (Dzau et al., 2002). Among which, the phosphorylation of the extracellular signal regulated kinase (ERK) 1/2 and the progression of cell cycle are the common convergent points for the mitogenic signaling cascades (Sprague and Khalil, 2009). The activated VSMCs then migrate from the media to the intima of the vessel, where they proliferate and deposit extracellular matrix components, convert fatty streak into mature fibrofatty atheroma, and contribute to the progressive growth of atherosclerotic lesions (Cai, 2006). Therefore, inhibiting the abnormal VSMC proliferation and migration could be a key pharmacological strategy for the prevention of atherosclerosis (Tulis, 2006).

The endoplasmic reticulum (ER) plays critical roles in folding and processing nascent proteins and maintaining calcium homeostasis. Impairment of the ER local environment caused by the accumulation of misfolded proteins and calcium depletion in the ER leads to ER stress. To ameliorate this stress, mammalian cells evoke a specific signaling pathway termed the unfolded protein response (UPR). Three ER-resident transmembrane proteins, PERK, ATF6, and IRE1, are important regulators in the UPR process (Zhang and Kaufman, 2004). Activation of UPR by low-grade ER stress promotes cell survival via the upregulation of ER chaperones, suppression of global protein synthesis, and activation of proteasome-dependent degradation (Mori, 2000). However, persistent and severe ER stress impairs ER function and leads to apoptotic events. In particular, recent studies reveal that multiple atherosclerotic risk factors, including homocysteine (Werstuck et al., 2001), glucosamine (Werstuck et al., 2006), and free cholesterol (Kedi et al., 2009), induce ER stress in VSMCs, suggesting the possible link between ER stress and the pathophysiological changes of VSMCs during atherosclerosis. However, to our knowledge, the direct effects of ER stress on VSMC proliferation and migration, the highly important behavior, remain unknown.

Endogenous antioxidant defense is activated to protect cells against injury associated with oxidative stress. Heme oxygenase-1 (HO-1) plays an essential role in this process. HO-1 is a cytoprotective enzyme that degrades heme (a potent oxidant) to generate carbon monoxide (CO, a vasodilatory gas that has anti-inflammatory properties), bilirubin (an antioxidant derived from biliverdin), and iron (sequestered by ferritin) (Tenhunen et al., 1968). The beneficial effects of HO-1 up-regulation in anti-atherosclerosis, anti-diabetes, and renoprotection have been reported in a series of animal models (Duckers et al., 2001). In addition, HO-1 protects VSMCs from oxidative injury and antagonizes VSMC proliferation (Zhang et al., 2002; Kim et al., 2009). Importantly, HO-1 expression is induced by ER stress in VSMCs and inhibits cell apoptosis in an autocrine fashion (Liu et al., 2005). Based on these observations, we carried out this study to examine the role of ER stress in VSMC proliferation and migration by using an ER stress inducer—tunicamycin (Tm).

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

Cell Culture

VSMCs were isolated from the thoracic aortas of 3- to 4-week-old male Sprague-Dawley rats as described previously (Gordon et al., 1986). All animal procedures in this investigation conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication No. 85–23, revised 1996) and the approved regulations set by the Laboratory Animal Care Committee at Nanjing Normal University. Isolated VSMCs were cultured in DMEM (Gibco-Invitrogen, Carlsbad) supplemented with 10% FCS (Gibco-Invitrogen), 25 mmol/L HEPES (pH 7.4), penicillin (100 U/mL), and streptomycin (100 mg/mL) at 37°C in a humidified atmosphere of 95% air and 5% CO2. Cells at passages 4–8 were used in experiments. To knock down HO-1 expression in VSMCs, the rat HO-1-specific siRNA (5′-CCG UGG CAG UGG GAA UUU AUG CCA U-3′) and nonspecific siRNA (Scrambled siRNA, 5′-CCG ACG GUG AGG UUA UAU CGUGCA U-3′) (serving as a negative control) were designed by using siRNA TargetFinder software and synthesized by Invitrogen. Each siRNA was transfected into VSMCs using X-tremeGENE HP transfection reagent (Roche) according to the manufacturer's instructions. Twenty-four hours after transfection, VSMCs were treated as described below.

XBP1 Splicing Detection

VSMCs were starved in serum-free DMEM for 24 hr at the density of 1 × 105 cells/well. Later, the cells were pretreated with Tm at the indicated doses for 6 hr, and then stimulated with or without PDGF-BB (10 ng/mL) for 24 hr in the presence of Tm. ER stress-induced splicing of XBP1 mRNA was evaluated by RT-PCR method. XBP1 primers were designed as followed: forward, 5′-ACGAGAGAAAACTCATGG-3′; reverse, 5′-ACAGGGTCCAACTTGTCC-3′. This pair of primers spanned the splice site and could detect both spliced and unspliced XBP1 at the size of 290 and 264 bp, respectively. The thermal cycling profile consisted of 34 cycles at 94°C for 30 sec, 51°C for 30 sec, and 72°C for 30 sec. PCR products were directly resolved on a 2% agarose gel, stained with ethidium bromide and visualized under ultraviolet illumination.

Cell Apoptosis Assay

VSMCs were treated with Tm and PDGF-BB as described above. At the end of the incubation, cells were washed with PBS and suspended in 100% ethanol at 4°C overnight. Fixed cells were then collected and the nuclei were stained for 30 min in the dark at 4°C with hypotonic fluorochrome solution, containing 0.1% sodium citrate, 0.1% Triton-X-100, 5 μL annexin-V-FITC (Invitrogen, San Diego), and 5 μL PI (Invitrogen). A fluorescence microscope (Nikon, Japan, Ti-S 533665) was used to observe the results. All assays were performed in triplicate.

Cell Viability Assay

The effect of Tm on VSMC viability was analyzed by using MTT assay. In brief, VSMCs were seeded in 96-well plates (1 × 104 cells per well). The cells were treated with Tm at the indicated doses for 30 hr. After that, MTT (0.2 mg/mL) was added to each well and incubated for 4 hr. The supernatant was removed and the formazan crystals were dissolved in DMSO. Cell viability was assessed by measuring the absorbance at 550 nm using a microplate reader.

VSMC Proliferation Assay

To assess cell proliferation, we either directly observed cell morphology by an inverted microscope (Olympus, Tokyo, Japan) or measured DNA synthesis using the 5-bromodeoxyuridine (BrdU) incorporation assay. VSMCs were treated as described above. After that, 10 μmol/L BrdU (Sigma, St. Louis) was added into medium for 2 hr, and cells were fixed with 4% paraformaldehyde. BrdU incorporation was determined by using anti-BrdU antibody (1:200 dilution, Abcam, Cambridge, UK) and goat polyclonal secondary antibody to rabbit IgG-FITC (1:200 dilution, Abcam). Cells were then counterstained with DAPI (Sigma). Signals were visualized by laser scanning confocal microscope, and the average ratios between BrdU-positive and total DAPI-stained nuclei were counted for statistic analyses.

VSMC Migration Assay

Cell migration was determined either by scratch wound motility assay or Transwell assay. For the scratch wound motility assay, VSMCs were seeded in 6-well plates (1.5 × 105 cells/well) and grew to confluence. Twenty-four hours after serum deprivation, the cells were pre-incubated with Tm for 6 hr and then were mounted to a reusable template to create a standard wound (<3 mm) (This time point was set as 0 hr). Later, PDGF-BB (10 ng/mL) was added to the cells and incubated for 24 hr in the presence of Tm. Wound closure rates were followed with a reference point in the field of the wound at the bottom of the plate by direct microscopic visualization. The procedure permitted photographing the identical spot each time. The remaining cell-free area was determined via microphotography and performed immediately after 24 hr injury. For the Transwell assay, a 24-well modified Boyden chamber containing fibronectin-coated polycarbonate membranes (8-μm pore-size, BD Bioscience) was used. Briefly, the lower wells of the chamber were filled with phenol red-free DMEM supplemented with/without 10 ng/mL PDGF-BB in the presence or absence of Tm, as indicated above. The filters were coated with 50 mg/ml fibronectin and fixed atop the bottom wells. 1 × 105 per well VSMCs were allowed to migrate for 6 hr and non-migrated cells were removed from the upper side of the membrane with cotton swabs. Cells on the lower side of the membrane were stained with Hoechst 33342, and then counted in five randomly selected squares per well with a fluorescence microscope (Nikon, Japan). Data were presented as numbers of migrated cells per field.

RT-qPCR

Total RNA from VSMCs was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). Two micrograms of total RNA was reverse-transcribed into complementary DNA. 18s ribosomal RNA served as an internal control for total complementary DNA content. mRNA levels were quantified by RT-qPCR using SYBRGreen Master Mix (Applied Biosystems, Foster City, CA). Samples were amplified using the Mastercycler ep realplex2 system (Eppendorf, Hamburg, Germany). Primer sequences are shown in Table 1.

Table 1. RT-qPCR Primers
GeneForward primerReverse primer
ATF6GGAAGTTACCAAGGCTTCTTTGACTGGGTGGTAGCTGGTAATAGCA
BipACGTCCAACCCGGAGAACATTCCAAGTGCGTCCGATGA
CHOPTGGCACAGCTTGCTGAAGAGTCAGGCGCTCGATTTCCT
HO-1TTCACCTTCCCGAGCATGCCTCTTCTGTCACCCTGT
18sAAACGGCTACCACATCCAAGCCTCCAATGGATCCTCGTTA

Western Blotting

VSMCs were lysed in RIPA buffer and the protein concentration was quantified with Dc protein assay reagent (Bio-Rad, Hercules, CA). Equal amounts of protein were loaded and separated by 10% SDS-PAGE and then transferred onto PVDF membranes (Bio-Rad). The membranes were incubated overnight with appropriate primary antibodies. Bound antibodies were then visualized using alkaline phosphatase-conjugated secondary antibodies. Quantitative analysis was performed by NIH Image J 1.32j software. For antibody information, anti-HO-1 antibody was obtained from Stressgen (Ann Arbor, MI). Anti-proliferating cell nuclear antigen (PCNA), anti-cyclin-dependent kinase 2 (CDK2), anti-cyclin E, anti-cyclin D1, anti-p21, anti-p27, phospho-specific anti-ERK1/2, and anti-total ERK1/2 antibodies were obtained from Cell Signaling (Danvers, MA). Anti-CDK4 antibody was obtained from BD Biosciences (Franklin Lakes). Anti-MMP-2, Anti-KDEL (this antibody recognizes both Grp 94 and Bip at the same time), anti-unspliced XBP1 (XBP1u), anti-spliced XBP1 (XBP1s), and anti-GAPDH antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

ROS Detection

Mitochondrial and cytoplasmic ROS generation in VSMCs was measured by loading cells with MitoTracker Red probe (CM-H2XRos) (10 μmol/L) or 2′, 7′-dichlorodihydrofluorescein diacetate (DCF-DA, Sigma) (10 μmol/L) for 30 min at 37°C. Cells were then rinsed twice with PBS, and the cultures were photographed with a fluorescence microscope (Nikon, Japan, Ti-S 533665).

Data Analysis

Data shown in the graphs represent the mean values ± standard deviation of three independent experiments performed. Data were analyzed using one-way ANOVA followed by Fisher's LSD post-hoc test. Calculations were performed using SPSS for Windows version 12.5S statistical package (SPSS, Chicago). A value of P < 0.05 was considered statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

Measurement of ER Stress

We first tested Tm, a known ER stressor, in VSMCs. As expected, Tm-induced ER stress, as shown by the appearance of the spliced form of XBP1, regardless of the presence of PDGF-BB or not (Fig. 1A). However, PDGF-BB alone did not create any notable ER stress in the cells. To confirm this finding, we measured the protein expression levels of other ER stress hallmarks, including GRP94, Bip, and spliced XBP1. As shown in Fig. 1B, Tm increased their protein levels in a dose-dependent manner while leaving unspliced XBP1 unaltered. At the transcriptional level, Tm robustly upregulated the mRNA expression levels of ATF6 and Bip (Fig. 1C). Collectively, these results indicated that Tm, but not PDGF, induced ER stress in VSMCs.

thumbnail image

Figure 1. Tm induces ER stress in VSMCs. (A) XBP1 splicing detection in VSMCs treated by Tm and/or PDGF-BB. VSMCs were either treated by Tm (1 μg/mL) or PDGF-BB (10 ng/mL) alone, or pre-treated with Tm (0.1, 0.5, or 1 μg/mL) for 6 hr and then co-incubated with 10 ng/mL PDGF-BB for another 24 hr. VSMCs were treated the same as described here in the following experiments unless otherwise indicated. (B) Protein expression levels of other ER stress hallmarks including GRP94, Bip, and spliced XBP1 (XBP1s). (C) mRNA expression levels of ATF6 and Bip. **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group.

Download figure to PowerPoint

Detection of Cell Apoptosis and Viability

Annexin-V-FITC/PI double staining was used to monitor the progress of apoptosis in VSMCs after the addition of Tm. Annexin-V-FITC staining targets the membranes of apoptotic cells, showing green fluorescence, while PI staining targets the nuclei of penetrated cells, showing red fluorescence. As shown in Fig. 2A, VSMCs exposed to 1 μg/mL Tm showed a few of fluorescent green cell membranes, indicating the occurrence of the mild apoptosis. In addition, CHOP, an activating regulator involved in ER stress-induced apoptosis, was robustly induced by Tm at the mRNA level (Fig. 2B). Next, we performed MTT assay to determine whether Tm-induced mild apoptosis would affect cell viability. As shown in Fig. 2C, cell viability kept intact at all the tested doses except the treatment of 2 μg/mL Tm for 30 hr.

thumbnail image

Figure 2. Tm induces mild apoptosis in VSMCs. (A) Cells were treated with Tm and PDGF-BB, followed by the annexin V and PI double staining to assess apoptosis. Note: during the early stages of apoptosis, externalization of phosphatidylserine (membrane phospholipids) can be detected by annexin V (green dots indicated by arrows). (B) CHOP mRNA expression levels. (C) Determination of cell viability by MTT assay. VSMCs were treated with Tm alone at the indicated doses for 30 hr and then MTT assay was performed.

Download figure to PowerPoint

VSMC Proliferation Assays

According to the morphology observations, the VSMC proliferation became robust with PDGF-BB stimulation. In contrast, Tm alone showed little effect on VSMC proliferation, but significantly inhibited the pro-proliferative function of PDGF-BB in a dose-dependent manner (Fig. 3A). The results from morphology observations were confirmed by BrdU incorporation assay (Fig. 3B). As can be seen, pretreatment of PDGF-BB-stimulated VSMCs with Tm (0.1, 0.5, or 1 μg/mL) led to a significant decrease in cell numbers. Notably, the lowest dose (0.1 μg/mL) of Tm already inhibited cell proliferation rate to the level lower than that of control even when PDGF-BB was present.

thumbnail image

Figure 3. Inhibition of PDGF-BB-induced VSMC proliferation by Tm. (A) Morphology observation. “0 hr” refers to the time-point when PDGF-BB was added to the cells. Magnification: 200×. (B) Representative photographs of BrdU incorporation assay. Total nuclei and BrdU-positive nuclei were stained with DAPI (blue) and fluorescein isothiocyanate (FITC) (green), respectively. Magnification: 400×. Scale bar: 20 μm. (C) Quantification of the BrdU results. *P < 0.05; **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group.

Download figure to PowerPoint

VSMC Migration Assays

To assess the effects of Tm on PDGF-BB-stimulated VSMC migration, the images of the cell culture after wound-healing experiments were photographed and analyzed at different time intervals. The results showed that the number of migrated VSMCs was significantly increased at 24 hr with PDGF-BB treatment. However, the VSMC migration was retarded by Tm pretreatment in a dose-dependent manner (Fig. 4A). Transwell chamber assay also showed that PDGF-BB-stimulated VSMCs migrated 1.7-fold faster than the control cells, but Tm almost inhibited VSMC migration to a quiescent level without any effect on quiescent VSMCs where PDGF-BB was absent (Fig. 4B).

thumbnail image

Figure 4. Inhibition of PDGF-BB-induced VSMC migration by Tm. (A) Representative images of scratch wound motility assay. The images were taken at the identical spots at 0 hr and 24 hr, respectively. Magnification: 200×. (B) Transwell migration assay. (C) Quantification of the Transwell assay results. *P < 0.05, **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group.

Download figure to PowerPoint

Assessments of HO-1 Expression Levels and Functional Roles in VSMCs

HO-1 is a key regulator involved in endogenous antioxidant defense and protects VSMCs against oxidative stress and abnormal activation. The induction of HO-1 has been shown in Tm-treated VSMCs. Indeed, we found that HO-1 mRNA levels were markedly decreased in PDGF-BB-stimulated VSMCs, but they were completely restored or even higher than that in the control group with Tm pretreatment (Fig. 5A). The protein expression levels of HO-1 gene showed similar trends (Fig. 5B). To explore whether the beneficial effects of Tm were dependent on the HO-1 induction, we specifically knocked down HO-1 expression in VSMCs by transfecting cells with HO-1 siRNA (Fig. 6A) and found that the blockade of VSMC proliferation by Tm was partially released (Fig. 6B). The results from morphology observations were confirmed by BrdU incorporation assay (Fig. 6C, the green dots represent BrdU-incorporated nuclei). Similarly, HO-1 siRNA attenuated the inhibitory effects of Tm on VSMC migration (Fig. 7A,B). We also evaluated the mitochondrial and cytoplasmic ROS generation in VSMCs. As shown in Fig. 8, treatment with PDGF-BB (10 ng/mL) for 30 min caused a greater increase of MitoTracker red fluorescence compared with control cells. However, pretreatment with Tm (1 μg/mL) for 6 hr significantly inhibited ROS generation and the HO-1 siRNA attenuated such inhibition. The data from DCF-DA staining showed a similar trend (Fig. 8, the below panel). These results strongly suggest that HO-1 mediates the inhibitory effects of Tm on VSMC abnormal activation.

thumbnail image

Figure 5. Induction of HO-1 gene expression by Tm. (A) Quantifications of HO-1 mRNA expression levels by RT-qPCR analysis. (B) Representative blots with anti-HO-1 antibody. **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group.

Download figure to PowerPoint

thumbnail image

Figure 6. HO-1 mediates the inhibitory effect of Tm on VSMC proliferation. Before Tm and PDGF-BB treatments, VSMCs were transfected with HO-1 siRNA for 24 hr to sufficiently knockdown HO-1 expression. A non-specific siRNA oligonucleotide (Scrambled siRNA) was also transfected as a negative control. (A) Validation of the knockdown efficiency of siRNA against HO-1. (B) Morphology observation. (C) Representative photographs of BrdU incorporation assay. **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group; ++P < 0.01 compared with the group treated with PDGF-BB and Tm.

Download figure to PowerPoint

thumbnail image

Figure 7. HO-1 mediates the inhibitory effect of Tm on VSMC migration. (A) Representative images of scratch wound motility assay. (B) Transwell migration assay. **P < 0.01 compared with the control group; ##P < 0.01 compared with the PDGF-BB-treated group; ++P < 0.01 compared with the group treated with PDGF-BB and Tm.

Download figure to PowerPoint

thumbnail image

Figure 8. Detection of mitochondrial and cytoplasmic ROS generation by MitoTracker Red and DCF-DA staining, respectively. Note: VSMCs were pretreated with Tm at the indicated doses for 29.5 hr and then stimulated with 10 ng/mL PDGF-BB for 30 min in these experiments.

Download figure to PowerPoint

Assessments of the Effects of Tm on Key Molecular Regulators

The MAP kinases ERK1/2 have been proposed to play key roles in VSMC hypertrophy and respond to inflammation and oxidative stress. In this study, phosphorylated (active) ERK1/2 was increased by PDGF-BB stimulation in VSMCs. On the contrary, Tm pretreatment markedly decreased ERK1/2 phosphorylation (Fig. 9A). In addition, the cell cycle progression is a downstream event of ERK1/2 mitogenic signaling pathway, which is controlled by cyclins and CDKs. As shown in Fig. 9B, treatment with Tm (0.1–1 μg/mL) reduced the protein expression levels of PCNA, verifying the inhibitory effects of Tm on VSMC proliferation. The PDGF-BB-induced protein expression of CDK2, CDK4, cyclin E, cyclin D1, and p21 was also suppressed by Tm in a concentration-dependent manner. In contrast, p27, a negative regulator of the protein kinase CDK2/cyclin E, was accordingly induced by Tm. On the other hand, Tm inhibited the protein expression levels of matrix metalloproteinase-2 (MMP-2), a major enzyme that regulates cell matrix composition and cell migration. The concentrations of MMP-2 in the culture medium were also reduced by Tm pretreatment (Fig. 9C).

thumbnail image

Figure 9. Tm suppresses key regulators involved in VSMC abnormal activation. (A) ERK1/2 phosphorylation. Note: VSMCs were pretreated with Tm at the indicated doses for 29.75 hr and then stimulated with 10 ng/mL PDGF-BB for 15 min in these experiments. (B) Protein levels for cell cycle regulators (PCNA, CDK2, CDK4, cyclin E, cyclin D1, p21, and p27) and MMP-2. (C) The concentrations of MMP-2 in the culture medium were determined by ELISA.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

PDGF-BB plays an important role in vascular remodeling during cellular and extracellular responses to injury (Majesky et al., 1990; Heldin and Westermark, 1999). This cytokine initially binds to its receptor termed PDGFRβ and then activates different signaling pathways regulating VSMC proliferation (e.g., MAPK) and migration (e.g., Akt) (Yang et al., 2006). In this study, we showed that Tm had potent and concentration-dependent inhibitory effects on PDGF-BB-stimulated VSMC proliferation and migration without inducing significant apoptosis. At the molecular level, Tm pretreatment robustly induced the antioxidant HO-1 gene expression while inhibiting mitogenic ERK1/2 signaling events and the key regulators promoting cell cycle reentry. More importantly, knockdown of HO-1 expression attenuated the effects of Tm on VSMCs, indicating that HO-1 is one of the major mediators responsible for the protective functions of Tm.

During the progression of atherosclerosis, oxidative stress is associated with VSMC dysfunction. To eliminate oxidative stress, endogenous antioxidant defense including HO-1 induction is evoked. The anti-atherosclerotic effect of HO-1 induction is mediated by various mechanisms, including the blockade of innate and adaptive immune responses and increased production of CO (Durante, 2011). This study showed that HO-1 mRNA and protein expression was reduced in PDGF-BB-stimulated VSMCs, suggesting a heavier oxidative burden in culture cells. In contrast, Tm dramatically induced HO-1 expression, accompanied by the inhibition of mitochondrial ROS generation. Our data are in accordance with previous report (Liu et al., 2005) and strongly suggest that Tm attenuates oxidative stress in VSMCs via induction of HO-1. Of note, because PDGF-BB stimulates ROS production from multiple derivations in VSMCs (Görlach et al., 2001; Lassègue et al., 2001; Kreuzer et al., 2003), we cannot rule out the possibility that Tm also negatively regulates ER-derived ROS or catalytic subunits of NADPH oxidase including p22phox, NOX 1, and NOX 4. The mechanism through which Tm induces HO-1 should also be elucidated in the future study. On the other hand, most other studies indicate that tunicamycin increases oxidative stress, which seems to be contradictory to our findings. One possible explanation is that the effect of tunicamycin on the regulation of ROS generation and oxidative stress is cell type-specific and dose-dependent. For example, it has been reported that tunicamycin inhibits TNF-α-induced ROS generation in murine fibrosarcoma L929 cells (Xue et al., 2005). Given the complexicity of this aspect, further investigations are required to provide the exact mechanism through which tunicamycin regulates oxidative stress.

In VSMCs, ERK phosphorylation is increased by various mitogenic stimuli including intracellular ROS, and in turn promotes cell proliferation and migration. In this study, we demonstrated that Tm inhibited PDGF-BB-induced increase of phosphorylated ERK1/2 levels, suggesting that the inhibitory effects of Tm on VSMCs are achieved by comprehensive mechanisms involving upstream second messengers such as ROS and downstream redox-sensitive signaling cascades. Secondly, we found that the expression of CDKs (CDK2 and CDK4) and cyclins (cyclin D1 and cyclin E) markedly decreased in Tm-pretreated VSMCs, which was associated with the accumulation of p27, a negative regulator of the protein kinase CDK2/cyclin E (Egozi et al., 2007). These observations strongly suggest that the cell cycle is arrested, which may contribute to the anti-proliferative effects of Tm. Of note, the changes of another CDK inhibitor, p21, showed the opposite trends. Although the induction of p21 by PDGF-BB has already been reported (Zhan et al., 2003), the exact reason remains unknown.

Like many other stress-induced signaling pathways, the UPR can act as a “double-edged sword” and exert both protective and detrimental effects. It is believed that most of the initial UPR responses are oriented toward protection and relief of the ER stress (Xu et al., 2005). However, if the ER stress continues unresolved, the UPR activated pathways can enhance apoptosis, helping to cleaning out cells that are irreversibly damaged by prolonged ER stress. Given that the doses of Tm we used here are relatively lower than that (usually >2 μg/mL) used in other studies, the protection from abnormal proliferation and migration of VSMCs by Tm may be mimicking the initial, protective role of endogenous ER stress response. Of course, it does not escape our notice that mild apoptosis, as well as the mRNA expression levels of apoptotic genes such as CHOP, was induced in our settings although the cell viability was not altered. Our findings are supported by two recent studies, which respectively show that Tm causes apoptosis in VSMCs (Ohta et al., 2011) without changing cell viability (Martinet et al., 2007). However, Ohta and colleagues found that in the presence of LPS and interferon-γ, Tm reduces VSMC viability in a concentration-dependent manner, with a nearly 60% reduction observed at the dose of 10 μg/mL. This is probably because that LPS and interferon-γ used in their setting lead to severe inflammatory response within cells which aggravates Tm-induced apoptosis. Taken together, all these observations suggest that the range of window in which the beneficial and detrimental effects of Tm are separated is narrow and must be finely adjusted.

In conclusion, we provide evidence that pretreatment with the ER stress inducer, Tm, protects against PDGF-BB-induced abnormal proliferation and migration of VSMCs. The beneficial effects of Tm are mediated at least dominantly, if not totally, by the induction of HO-1 expression and the blockade of cell cycle reentry. Considering that the UPR is conserved among all eukaryotic cells and participates in the various cardiovascular diseases, our findings will further illuminate the potential involvement of ER stress in vascular health and pathology.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED
  • Cai X. 2006. Regulation of smooth muscle cells in development and vascular disease: current therapeutic strategies. Expert Rev Cardiovasc Ther 4: 789800.
  • Duckers HJ, Boehm M, True AL, Yet SF, San H, Park JL, Clinton Webb R, Lee ME, Nabel GJ, Nabel EG. 2001. Heme oxygenase-1 protects against vascular constriction and proliferation. Nat Med 7: 693698.
  • Durante W. 2011. Protective role of heme oxygenase-1 against inflammation in atherosclerosis. Front Biosci 17: 23722388.
  • Dzau VJ, Braun-Dullaeus RC, Sedding DG. 2002. Vascular proliferation and atherosclerosis: new perspectives and therapeutic strategies. Nat Med 8: 12491256.
  • Egozi D, Shapira M, Paor G, Ben-Izhak O, Skorecki K, Hershko DD. 2007. Regulation of the cell cycle inhibitor p27 and its ubiquitin ligase Skp2 in differentiation of human embryonic stem cells. FASEB J 21: 28072817.
  • Gordon D, Mohai LG, Schwartz SM. 1986. Induction of polyploidy in cultures of neonatal rat aortic smooth muscle cells. Circ Res 59: 633644.
  • Görlach A, Diebold I, Schini-Kerth VB, Berchner-Pfannschmidt U, Roth U, Brandes RP, Kietzmann T, Busse R. 2001. Thrombin activates the hypoxia-inducible factor-1 signaling pathway in vascular smooth muscle cells: Role of the p22 (phox)-containing NADPH oxidase. Circ Res 89: 4754.
  • Heldin CH, Westermark B. 1999. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 79: 12831316.
  • Kedi X, Ming Y, Yongping W, Yi Y, Xiaoxiang Z. 2009. Free cholesterol overloading induced smooth muscle cells death and activated both ER- and mitochondrial-dependent death pathway. Atherosclerosis 207: 123130.
  • Kim JE, Kang YJ, Lee KY, Choi HC. 2009. Isoproterenol inhibits angiotensin II-stimulated proliferation and reactive oxygen species production in vascular smooth muscle cells through heme oxygenase-1. Biol Pharm Bull 32: 10471052.
  • Kreuzer J, Viedt C, Brandes RP, Seeger F, Rosenkranz AS, Sauer H, Babich A, Nürnberg B, Kather H, Krieger-Brauer HI. 2003. Platelet-derived growth factor activates production of reactive oxygen species by NAD(P)H oxidase in smooth muscle cells through Gi1,2. FASEB J 17: 3840.
  • Lassègue B, Sorescu D, Szöcs K, Yin Q, Akers M, Zhang Y, Grant SL, Lambeth JD, Griendling KK. 2001. Novel gp91 (phox) homologues in vascular smooth muscle cells: nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ Res 88: 888894.
  • Liu XM, Peyton KJ, Ensenat D, Wang H, Schafer AI, Alam J, Durante W. 2005. Endoplasmic reticulum stress stimulates heme oxygenase-1 gene expression in vascular smooth muscle. Role in cell survival. J Biol Chem 280: 872877.
  • Majesky MW, Reidy MA, Bowen-Pope DF, Hart CE, Wilcox JN, Schwartz SM. 1990. PDGF ligand and receptor gene expression during repair of arterial injury. J Cell Biol 111: 21492158.
  • Martinet W, Croons V, Timmermans JP, Herman AG, De Meyer GR. 2007. Nitric oxide selectively depletes macrophages in atherosclerotic plaques via induction of endoplasmic reticulum stress. Br J Pharmacol 152: 493500.
  • Mori, K. 2000. Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell 101: 451454.
  • Newby AC, Zaltsman AB. 2000. Molecular mechanisms in intimal hyperplasia. J Pathol 190: 300309.
  • Ohta S, Hattori Y, Nakanishi N, Sugimoto H, Kasai K. 2011. Differential modulation of immunostimulant-triggered NO production by endoplasmic reticulum stress inducers in vascular smooth muscle cells. J Cardiovasc Pharmacol 57: 434438.
  • Sprague AH, Khalil RA. 2009. Inflammatory cytokines in vascular dysfunction and vascular disease. Biochem Pharmacol 78: 539552.
  • Tenhunen R, Marver HS, Schmid R. 1968. The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc Natl Acad Sci 61: 748755.
  • Tulis DA. 2006. Methods for identifying cardiovascular agents: a review. Recent Pat Cardiovasc Drug Discov 1: 4756.
  • Werstuck GH, Khan MI, Femia G, Kim AJ, Tedesco V, Trigatti B, Shi Y. 2006. Glucosamine-induced endoplasmic reticulum dysfunction is associated with accelerated atherosclerosis in a hyperglycemic mouse model. Diabetes 55: 93101.
  • Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY, Zhou J, Maeda N, Krisans SK, Malinow MR, Austin RC. 2001. Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest 107: 12631273.
  • Xu C, Bailly-Maitre B, Reed JC. 2005. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 115: 26562664.
  • Xue X, Piao JH, Nakajima A, Sakon-Komazawa S, Kojima Y, Mori K, Yagita H, Okumura K, Harding H, Nakano H. 2005. Tumor necrosis factor α (TNFα) induces the unfolded protein response (UPR) in a reactive oxygen species (ROS)-dependent fashion, and the UPR counteracts ROS accumulation by TNFα. J Biol Chem 280: 3391733925.
  • Yang X, Thomas DP, Zhang X, Culver BW, Alexander BM, Murdoch WJ, Rao MN, Tulis DA, Ren J, Sreejayan N. 2006. Curcumin inhibits platelet-derived growth factor-stimulated vascular smooth muscle cell function and injury-induced neointima formation. Arterioscler Thromb Vasc Biol 26: 8590.
  • Yumei Z, Shokei K, Yasukatsu I, Yasuhiro I, Takafumi N, Hitoshi M, Hiroshi I. 2003. Role of JNK, p38, and ERK in platelet-derived growth factor-induced vascular proliferation, migration, and gene expression. Arterioscler Thromb Vasc Biol 23: 795801.
  • Zhang K, Kaufman RJ. 2004. Signaling the unfolded protein response from the endoplasmic reticulum. J Biol Chem 279: 2593525938.
  • Zhang M, Zhang BH, Chen L, An W. 2002. Overexpression of heme oxygenase-1 protects smooth muscle cells against oxidative injury and inhibits cell proliferation. Cell Res 12: 123132.