Wnt/β-Catenin Signaling Pathway Upregulates c-Myc Expression to Promote Cell Proliferation of P19 Teratocarcinoma Cells

Authors


Abstract

Aberrant activation of the Wnt/β-catenin signaling pathway is a common event in human tumor progression. Wnt signaling has also been implicated in maintaining a variety of adult and embryonic stem cells by imposing a restraint to differentiation. To understand the function and mechanism of Wnt/β-catenin signaling on the pathogenesis of teratocarcinoma, we used the mouse teratocarcinoma P19 cell line as a model in vitro. Gsk3β specific inhibitor (SB216763) was used to activate Wnt/β-catenin signaling. All trans-retinoic acid (RA) was used to induce P19 cell differentiation. At different culture times, gene expression was examined by immunofluorescence staining, quantitative real-time PCR, and Western-blotting; BrdU incorporation assays were performed to measure P19 cell proliferation. Small interference RNA technology was used to downregulate c-myc expression. The results showed that SB216763 induced the nuclear translocation of β-catenin, upregulated the expression of c-myc and pluripotency related genes, oct4, sox2 and nanog, and blocked cell differentiation induced by all trans-RA. The proliferation of P19 cells was significantly enhanced by SB216763, as well as c-myc overexpression. C-myc downregulation inhibited P19 cell proliferation caused by activation of Wnt/β-catenin signaling and induced P19 cell differentiation. In conclusion, activation of the Wnt/β-catenin pathway could promote the proliferation and inhibit the differentiation of mouse teratocarcinoma cells by upregulation of c-myc expression. Anat Rec, 2012. © 2012 Wiley Periodicals, Inc.

Testicular germ cell tumors are the most common solid malignancy in young males and the incidence has risen during the last decade (Cooper et al., 2008). They are divided into two groups: seminomas and nonseminomatous germ cell tumors. Teratocarcinoma is a form of malignant nonseminomatous germ cell tumor, which is more common in children, especially in the neonate and infant. Teratocarcinomas are made up of an undifferentiated embryonal carcinoma (EC) component and many differentiated derivatives that can include all three germ layers (Bulic-Jakus et al., 2006). Currently, treatment of teratocarcinoma has a high success rate (Gerl et al., 1996; Bosl, 1999). However, the molecular mechanisms of teratocarcinoma formation remain to be determined.

EC cells are believed to be the cancer stem cells of teratocarcinomas, which under nonneoplastic conditions can undergo self renewal and/or differentiation into multiple mature cell types similar to embryonic stem (ES) cells (Arechaga, 1993). When injected into mouse blastocysts, some EC cell lines are able to contribute to various somatic cell types, but most EC cell lines have limited developmental potential and contribute poorly to chimeric mice, the likely result of genetic changes acquired during teratocarcinoma formation (Rossant and Papaioannou, 1985). Mutations that confer growth advantages to EC cells are likely to accumulate during tumorigenesis, and EC cells in chimeras can result in tumor formation (Rossant and McBurney, 1982). The process of self-renewal is controlled in pluripotent stem cells and cancer stem cells via a number of pathways including Wnt/β-catenin signaling (Sato et al., 2005; Hao et al., 2006). The aberrant signal transduction pathways that may be important in the pathogenesis of teratocarcinoma remain poorly defined.

Wnt/β-catenin signaling is important for normal cell proliferation and differentiation, and mutations in pathway components are associated with human cancers (Logan and Nusse, 2004). Wnts are secreted signaling proteins that mediate their function via interaction with a variety of cell surface receptors, including members of the frizzled gene family or the low-density lipoprotein receptor-related proteins 5 or 6 (LRP5/6). In the absence of Wnt ligand signaling, glycogen synthase kinase 3β (GSK3β) actively phosphorylates β-catenin in the cytoplasm. This effectively targets β-catenin for ubiquitination and degradation by the proteosome. Wnt signaling is initiated by Wnt binding to frizzled or LRP5/6 and activation of disheveled, which represses GSK3β function, leading to cytoplasmic and then nuclear accumulation of β-catenin. Once accumulated within the nucleus, β-catenin interacts with members of the T-cell factor-lymphoid enhancer-binding factor (Tcf-Lef) family of transcription factors in order to regulate transcription of specific genes. The end results are changes in cellular proliferation and/or differentiation (Akiyama, 2000; Li et al., 2006; Baker, 2008).

To identify the role of Wnt/β-catenin signaling in the pathogenesis of teratocarcinoma, we undertook an in vitro study to investigate the effects of Wnt/β-catenin signaling pathway in the proliferation and differentiation of P19 cells. Our studies have shown that Wnt/β-catenin signaling pathway may be involved in teratocarcinoma formation by upregulation of c-myc expression.

MATERIALS AND METHODS

Cell Culture

P19 cells, which were provided by the cell center of Chinese Academy of Science, were cultured in DMEM/F12 with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen, CA). Cells were divided into four groups: the Con (control) group (normal culture medium), the RA group (medium with all trans-RA), the SB group (medium with SB216763) and the SB + RA group (medium with both SB216763 and all trans-RA). All trans-RA (Sigma-Aldrich, MO) was dissolved in dimethyl sulfoxide (DMSO) as a 10 mM stock solution and stored at −20°C. For determination of concentrations, varying concentrations of all trans-RA and SB216763 were investigated in terms of their cytotoxic effects on P19 cells to determine the optimal concentration for use in cultures. 2 × 104 cells were placed in a 24-well culture plate in a DMEM/F12 medium containing 10% FBS and antibiotics. After 24 hr the medium was supplemented with varying concentrations of all trans-RA or/and SB216763, including 1, 2, 5, and 10 μM. All cultures were maintained for an additional 48 hr at the end of which the cultures were evaluated for the number of viable cells. All trans-RA and SB216763 (Sigma-Aldrich, MO) were both used at a final concentration of 2 μM.

Immunofluorescence

P19 cells on Day 2 culture were stained according to a standard procedure. Briefly, cells on slides were washed twice in PBS and fixed in 4% paraformaldehyde for 20 min at room temperature followed by another three washes in PBS, then permeabilized with PBS containing 0.1% Triton X-100 for 20 min at room temperature. Cells were blocked with 10% normal goat or rabbit serum for 30 min at room temperature, then incubated overnight at 4°C in a humidified chamber with the respective antibodies at a final concentration of 2 μg/mL and then for 1 hr at 37°C with TRITC or FITC-conjugated secondary antibodies (anti-rabbit IgG and anti-goat IgG). Slides were washed and mounted in 50% glycerol in PBS and immediately examined by fluorescence microscopy (Olympus, Tokyo). Nuclei were counterstained with 1 μg/mL DAPI (Sigma-Aldrich, MO). Control experiments were performed using nonimmune immunoglobulins instead of the specific antibody.

The primary antibodies: anti-oct4 goat polyclonal (sc-1909), anti-β-catenin mouse polyclonal (sc-7443), and anti-c-myc rabbit polyclonal (sc-7442) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

BrdU Incorporation Assay

BrdU (Sigma-Aldrich, MO) at a final concentration of 15 μg/mL in culture medium was added to P19 cells cultured for 2 days under the four experimental conditions. Cells cultured on cover slips were fixed in 4% paraformaldehyde for 20 min at room temperature, and washed twice in PBS for 5 min each time. DNA denaturation was carried out by incubating the slides in 2 M HCl for 60 min at 37°C.The acid was neutralized by immersing the slides in 0.1 M borate buffer(pH 8.5) for 10 min with three changes of the buffer. Cells were then incubated overnight at 4°C in a humidified chamber with anti-BrdU goat antibody (1:100) and then for 1 hr at 37°C with goat anti-mouse FITC-conjugated secondary antibodies (1:100). Nuclei were counterstained with 1 μg/mL DAPI. BrdU positive cells were counted using a fluorescence microscope (Olympus, Tokoyo). BrdU-positive and DAPI staining cells were counted at × 200 magnification in 10 randomly selected fields of view, with 400–500 cells counted in each experiment.

Quantitative Real-Time PCR Analysis

The total RNA of the four different groups of P19 cells cultured for one day were extracted using a Takara RNAiso kit (Takara, Dalian), according to the manufacturer's instructions. First-strand cDNA was synthesized from a 1 μg aliquot of the total RNA samples using Takara quantitative real-time PCR system (Takara, Dalian) according to the manufacturer's instructions. Endogenous mRNA levels were measured by quantitative real-time PCR analysis based on SYBR Green detection with the Epp-6300 real-time PCR machine (Eppendorf, Hamburg). Quantitative real-time PCR was performed in a 12-μL reaction mixture containing 5 μM forward/reverse primers, 1× SYBR GREEN reaction mix (Toyobo, Osaka), and 1 μL of sample template. The reaction was performed with preliminary denaturing for 10 min at 95°C to activate Taq DNA polymerase, followed by 40 cycles of denaturing at 95°C for 15 sec, annealing at 50–55°C for 30 sec, and extension at 63°C for 1 min. Each experiment was run in triplicate and was repeated twice. G3PDH was used as an internal control amplified in the same PCR assay. The real-time PCR primers used are shown in Table 1.

Table 1. Primer sequences and PCR product size
GenePrimer SequenceProduct size
G3PDHsense ACCACAGTCCATGCCCATCAC 
 antisense TCCACCACCCTGTTGCTGTA450
c-mycsense TGCACCCACATCATCTACAG 
 antisense ACTCGTCATTCCACTCCCAT138
oct4sense ATCGTAGAGGCAGAAGCAAT 
 antisense TTCAACCGTAAGACCACAGG126
sox2sense GCTCGCAGACCTACAT 
 antisense TCGGACTTGACCACAG106
nanogsense GGCACGAGCACAGACC 
 antisense TAACCCACTCCCACCG106
Hoxa1sense ATGCTGGGGGCACAGTGGGCT 
 antisense TTGGTGGCTGGCGTGGAGAGG119
Hoxd4sense ATGAAGTGGAAAAAAGAC 
 antisense GAAGAGGAGCAGGAAGAT74

Western Blotting

To examine the expression of pluripotency related genes and c-myc, day 2 culture P19 cells in four groups were harvested, washed in cold PBS and homogenized at 4°C in lysis buffer containing 10 mM Hepes pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM β-glycerophosphate, 0.1 mM sodium vanadate and a protease inhibitor cocktail (P8340, Sigma- Aldrich, MO). After 15 min on ice, cell debris was removed by centrifugation at 15,000g for 20 min at 4°C. Protein (10 μg) in the supernatant was run on a 10% SDS–polyacrylamide gel, and transferred to polyvinylidene fluoride membranes (Millipore Corp, MA). After blocking the membranes with 5% (w/v) fat-free milk for 1 hr at room temperature, they were reacted with either anti-oct4, anti-sox2, anti-nanog or anti-c-myc (Santa Cruz, CA) antibodies, overnight at 4°C, followed by reaction with peroxidase-conjugated anti-goat(or anti-rabbit) IgG antibody for 1 hr at room temperature. Reacted proteins were visualized with an electrochemiluminescence kit (Amersham Life Sciences Inc, IL). The membranes were then reacted with anti-β-actin antibody to monitor equal loading of cell lysates.

Plasmid Construction

The pCAG-puro construct was generated as described previously (Hao et al., 2006). The full length of mouse c-myc was amplified by PCR from the complementary DNA of mouse ES cells using primers (c-myc sense 5′-AGAATCGATGCTCCTCGAGCTGTTTGAAG -3′ and antisense 5′-TCTGCTAGCAGCTCCTCCTCGAGTTAGGT-3′). Then the PCR products were inserted between the CAG promoter and the IRES to generate CAG-c-myc construct. The c-myc encoding sequence was confirmed by DNA sequence analysis to be identical to that of GenBank, NM-010849. Plasmid transfection into P19 cells was carried out using Lipofectamine™ 2000 (Invitrogen, CA). After transfection, P19 cells were selected with 1.5 μg/mL puromycin for 7 days to obtain P19 cells with c-myc overexpression. The empty vector was used to generate stable control vector clones.

siRNA Transfection

For c-myc knockdown, siRNA specific to mouse c-myc (GenBank accession no. NM-010849) were synthesized by Invitrogen Corporation (Invitrogen, CA). The siRNA oligonucleotide sequences were as follows: c-myc siRNA sense 5′-UAGUCGAGGUCAUAGUUCCUGUUGG-3′ and antisense 5′-CCAACAGGAACUAUGACCUCGACUA-3′. siRNA control sense, 5′-CAGAAAUGUCCUGAGCAAUUU-3′ and antisense 5′-AUUGCUCAGGACAUUUCUGUU-3′. C-myc siRNA and negative control siRNA were dissolved in nuclease-free water at 10 μM. P19 cells were transfected with c-myc siRNA and negative control siRNA using Lipofectamine™ 2000 (Invitrogen, CA) at a final concentration of 50 nM in accordance with the manufacturer's instruction. At 48 hr post-transfection, cells were stimulated with SB216763 for proliferation assays, or cells were treated with SB216763 and all trans-RA for differentiation assays.

Statistical analysis

Fluorescence intensity (gray values) assay was performed using Image J software. Each slide (N = 3) was split into four equal-sized partitions. Two areas in each partition were randomly selected to measure the gray values of immunostained P19 cells. The intensity of immunostaining was reported as the mean of measured P19 cell gray value minus background gray value. The background gray value was measured at a cell-free area of the slice. Densitometry of Western blotting results was conducted using the Quantity One software with β-actin as internal controls. The values were presented as the mean±standard deviation of three separate experiments. Comparisons between groups were conducted using the Student's t-test. Results were considered statistically significant at P < 0.05.

RESULTS

Activation of Wnt/β-Catenin Signaling Inhibits P19 Cell Differentiation

To identify whether Wnt/β-catenin signaling affects the differentiation of P19 cells, the mRNA and protein expression of stem cell specific genes, oct4, sox2, and nanog, were examined by immunofluorescence analysis, quantitative real-time PCR and Western-blotting assays. RA-responsive genes, Hoxa1 and Hoxd4, were investigated by quantitative real-time PCR. The results demonstrated that SB216763 induced nuclear translocation of β-catenin and increased expression of stem cell specific genes, while this treatment inhibited the expression of RA-responsive genes. As shown in Fig. 1A,B, β-catenin immunostaining was localized mainly in the cytoplasm of P19 cells in the Con group and the RA group, and in the nuclei of P19 cells in the SB group and the SB + RA group. Compared with the Con group, Oct4 expression was downregulated in the RA group, and upregulated in the SB group and the SB + RA group (Fig.1A,B).

Figure 1.

Effects of Wnt/β-catenin signaling on the expression of stem cell specific genes and RA-responsive genes. A: Expressions of β-catenin (green) and oct4 (red) were detected by immunofluorescence in the Con, RA, SB, and SB + RA groups. Nuclei were counterstained by DAPI (blue). Arrows indicate β-catenin positive cells. Arrowheads indicate oct4 positive cells. Yellow arrows indicate β-catenin/oct4 positive cells. Merge images of β-catenin/oct4 labeling and nuclear staining show that the nuclear β-catenin immunostaining is lower in the Con and the RA groups than in the SB and the SB + RA groups (yellow arrow). High magnification images of nuclear β-catenin/oct4 immunostaining are shown in the square boxes. B: Semiquantitative analysis of the immunofluorescence results. C, D: Quantitative real-time PCR analysis for the mRNA levels of stem cell specific genes and RA responsive genes in four groups. The expression level of the Con group was set as 1 and compared with that of other groups. G3PDH served as the internal control. Fold difference values for Hoxa1 and Hoxd4 mRNA expression were normalized using a base 10 logarithmic scale (D). E: Western blotting analysis for Oct4, Sox2, and Nanog protein levels in four groups. β-actin served as the protein loading control. F: Semiquantitative densitometry analysis of Western blotting results. β-actin served as the internal control. The data are presented as means ± SD from three independent experiments. Statistically significant differences in comparison to the Con group are indicated by * (P < 0.05) and ** (P < 0.01). Scale bars indicate 10 μm.

The quantitative real-time PCR results showed oct4mRNA levels were significantly lower in the RA group, and 2-fold enriched in the SB group and the SB + RA group compared with the Con group. Sox2 and nanog mRNA expression exhibited an expression pattern similar to oct4 (Fig. 1C). Hoxa1 and Hoxd4 mRNA levels were significantly lower in the SB group, and much higher in the RA group and the SB + RA group than that of the Con group. Compared with the RA group, Hoxa1 and Hoxd4 mRNA expression were reduced significantly in the SB + RA group (P < 0.01, Fig. 1D). The results of Western blotting analysis showed Oct4, Sox2, and Nanog protein expression were downregulated in the RA group, and upregulated in the SB group and the SB + RA group when compared with the Con group (Fig. 1E,F).

Another Gsk3β inhibitor (LiCl) was used to activiate Wnt/β-catenin signaling in P19 cells. The results were similar to that of SB216763 (data not shown).

Activation of Wnt/β-Catenin Signaling Promotes P19 Cell Proliferation

To test whether Wnt/β-catenin signaling affects the proliferation of P19 cells, the cell proliferation in four groups was evaluated by BrdU incorporation assay (Fig. 2A). The percentage of BrdU positive cells and total cells was used as an indication of the effect of Wnt/β-catenin stimulation on cell proliferation (Fig. 2B). RA treatment for 48 hrs resulted in a significant decrease in the percentage of BrdU positive cells (P < 0.05). Compared with the Con group, there was significant increase in the percentage of BrdU positive cells in the SB group and the SB + RA group (P < 0.05). Activation of Wnt/β-catenin signaling by SB216763 or LiCl in a human teratocarcinoma cell line (NTera-2) also significantly promoted cell proliferation (data not shown).

Figure 2.

Activation of Wnt/β-catenin signaling enhances the proliferation of P19 cells. A: BrdU-positive P19 cells in the Con, RA, SB, SB + RA groups after 2-day culture. B: Quantitative analysis of P19 cell proliferation as indicated by the percentages of BrdU positive cells in four groups. Statistically significant differences (P < 0.05) in comparison to the Con group are indicated by a single asterisk. At least three separate experiments were carried out, BrdU-positive and DAPI staining cells were counted at ×200 magnification in 10 randomly selected fields of view, with 400–500 cells counted in each experiment. Scale bars indicate 10 μm.

Activation of Wnt/β-Catenin Signaling Upregulates the Expression of c-myc

To evaluate the effect of Wnt/β-catenin signaling pathway on the expression of c-myc in P19 cells, the mRNA and protein expression of c-myc were investigated by immunofluorescence analysis, quantitative real-time PCR, and Western-blotting assays. As shown in Fig. 3, the nuclear level of c-myc was significantly higher in the SB and the SB + RA groups than that of the Con and the RA groups (Fig. 3A,B). C-myc gene expression significantly increased in the SB and the SB + RA groups when compared with the Con group (Fig. 3C–E).

Figure 3.

Activation of Wnt/β-catenin signaling upregulates the expression of c-myc in P19 cells. A: Immunofluorescence analysis for c-myc expression in the Con, RA, SB, and SB + RA groups. C-myc was labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). B: Semiquantitative analysis of the immunofluorescence results. C: Quantitative real-time PCR analysis for c-myc mRNA levels in four groups. The expression level of the Con group was set as 1 and compared with that of other groups. G3PDH served as the internal control. D: Western-blotting analysis for c-myc protein levels in four groups. β-actin was used as the loading control. E: Semiquantitative densitometry analysis of Western-blotting results. β-actin served as the internal control. C-myc mRNA (C) and protein (A, B, D, E) levels were significantly reduced in the RA group, and significantly induced in the SB group and the SB + RA group when compared with the Con group. The data are presented as means ± SD from three independent experiments. Statistically significant differences (P < 0.05) in comparison to the Con group are indicated by a single asterisk. Scale bars indicate 10 μm.

Overexpression of c-myc Promotes P19 Cell Proliferation and Inhibits P19 Cell Differentiation

As shown by Fig. 4A,B, c-myc protein expression was upregulated in c-myc transfected cells. BrdU incorporation assay was used to access cell proliferation of the empty vector transfected cells, c-myc transfected cells with or without RA. Results showed that overexpression of c-myc stimulated P19 cell proliferation when compared with the empty vector control group (Fig. 4C,D).Compared with the empty vector + RA group, there was significant increase in the percentage of BrdU positive cells in the c-myc + RA group (Fig. 4C,D). The quantitative real-time PCR results showed that the mRNA expression of oct4, sox2 and nanog were significantly upregulated in the c-myc transfected group and c-myc + RA group compared with the empty vector control group, Hoxa1, and Hoxd4 mRNA levels were significantly lower in the c-myc transfected group, and much higher in the empty vector + RA group and the c-myc + RA group than that of the empty vector control group. Compared with the empty vector + RA group, Hoxa1 and Hoxd4 mRNA expression were reduced significantly in the c-myc + RA group (P < 0.05, Fig. 4E,F).

Figure 4.

Effects of c-myc on P19 cell proliferation and differentiation. A: Western-blotting analysis for c-myc protein levels after c-myc and empty vector transfection. B: Semiquantitative densitometry analysis of Western-blotting results. β-actin served as the internal control. Statistically significant differences in comparison to normal culture control are indicated by a double asterisk (P < 0.01). C: BrdU-positive P19 cells in the empty vector control, the empty vector + RA, the c-myc, the c-myc + RA groups. D: Quantitative analysis of P19 cell proliferation as indicated by the percentages of BrdU positive cells in four groups. At least three separate experiments were carried out, BrdU-positive and DAPI staining cells were counted at ×200 magnification in 10 randomly selected fields of view, with 400–500 cells counted in each experiment. Statistically significant differences in comparison to the empty vector control are indicated by a single asterisk (P < 0.05). E, F: Quantitative real-time PCR analysis for stem cell specific genes and RA responsive genes in four groups. The expression levels of the empty vector control group were set as 1 and compared with that of other groups. G3PDH served as the internal control. Fold difference values for Hoxa1 and Hoxd4 mRNA expression were normalized using a base 10 logarithmic scale (F). The data are presented as means ± SD from three independent experiments. Statistically significant differences in comparison to negative control are indicated by a single asterisk (P < 0.05) and a double asterisk (P < 0.01). Scale bars indicate 10 μm.

Figure 5.

C-myc mediates the effects of Wnt/β-catenin signaling on P19 cell proliferation and differentiation. A: Western-blotting analysis for c-myc protein levels after siRNA transfection. B: Semiquantitative densitometry analysis of Western-blotting results. β-actin served as the internal control. Statistically significant differences in comparison to normal culture control are indicated by a double asterisk (P < 0.01). C: BrdU-positive P19 cells in negative control siRNA, negative control siRNA treated with SB216763, c-myc siRNA, c-myc siRNA treated with SB216763. D: Quantitative analysis of P19 cell proliferation as indicated by the percentages of BrdU positive cells in four groups. At least three separate experiments were carried out, BrdU-positive and DAPI staining cells were counted at × 200 magnification in 10 randomly selected fields of view, with 400–500 cells counted in each experiment. Statistically significant differences in comparison to negative control siRNA are indicated by a single asterisk (P < 0.05). A black triangle was used to show the significant differences (P < 0.05) when negative control siRNA treated with SB216763 against c-myc siRNA treated with SB216763. E, F: Quantitative real-time PCR analysis for stem cell specific genes and RA responsive genes in negative control siRNA, negative control siRNA treated with SB216763 + RA, c-myc siRNA, c-myc siRNA treated with SB216763 + RA. The expression level of negative control siRNA group was set as 1 and compared with that of other groups.G3PDH served as the internal control. Fold difference values for Hoxa1 and Hoxd4 mRNA expression were normalized using a base 10 logarithmic scale (F).The data are presented as means ± SD from three independent experiments. Statistically significant differences in comparison to negative control siRNA are indicated by a single asterisk (P < 0.05) and a double asterisk (P < 0.01). A black triangle was used to show the significant differences (P < 0.05) when negative control siRNA treated with SB216763 + RA against c-myc siRNA treated with SB216763 + RA. Scale bars indicate 10 μm.

C-myc Mediates the Effects of Wnt/β-Catenin Signaling Pathway on P19 Cell Proliferation and Differentiation

We knocked down the expression of c-myc by siRNA that specifically targeted the c-myc mRNA, and tested whether the proliferation stimulation and differentiation inhibition effects of Wnt/β-catenin signaling on P19 cells could also be abolished. As shown by Fig. 5A,B, c-myc protein expression in P19 cells was significantly reduced in the c-myc siRNA transfected group compared with normal culture control and negative control siRNA group (P < 0.01). Importantly, BrdU positive cells were significantly reduced in c-myc siRNA treated with SB216763 group compared with negative control siRNA treated with SB216763 group (Fig. 5C,D). Quantitative real-time PCR results showed that the mRNA expression of oct4, sox2, and nanog were significantly downregulated, and the mRNA expression of Hoxa1 and Hoxd4 were significantly upregulated in c-myc siRNA treated with SB216763 + RA group compared with negative control siRNA treated with SB216763 + RA group (Fig. 5E,F).

DISCUSSION

EC cells share multiple similarities with ES cells, including the expression of the pluripotency markers and the ability to form tumors in immunodeficient mice. One key difference between the two cell lines is that, while ES cells give rise to teratoma with differentiated tissues of all three germ layers that grow at a much slower rate, euploid EC cell line transplantation leads to the formation of teratocarcinoma (Andrews et al., 2005). Gene expression profiling on microarrays have been performed to investigate differences in gene expression between teratocarcinoma and ES control in cell cultures as well as in nude mice tumors. Results have shown the involvement of several signaling pathways, including the cell cycle pathway in the induction of teratocarcinoma (Andrews et al., 2005). Sperger (2003) found 330 genes that were shared by ES cells, EC cells and seminomas, and among them was gene POU5F1 (oct4). Ectopic expression of oct-4 was associated with tumorigenesis (Hochedlinger et al., 2005). It was reported that long-term cultivation of human ES cells could induce teratocarcinoma (Bonner et al., 2004). Human ES cells appear poised to develop chromosomal abnormalities in long-term in vitro cultures, which may be related to abnormal activation of certain signaling pathways. Andrews (2005) hypothesized that EC cells might have a stronger selection for mutations that would increase self-renewal capacities and limit differentiation. Similarly, mutations have been observed when growing hESCs in culture over longer passages.

Abnormal activation in the Wnt/β-catenin pathway has been implicated in several forms of cancer (Reya and Clevers, 2005). The best studied to date is colon cancer, in which 80% of all tumors show mutations in both alleles of APC. APC mutations result in the accumulation of nuclear β-catenin thereby enhancing tumor's ability to activate transcription of cyclin D1 (Tetsu and McCormick, 1999) and c-myc (He et al, 1998), and to increase proliferation (Behrens, 1999). Mutations in the β-catenin gene and overexpression of β-catenin are found in about 50% of human hepatocellular carcinomas (HCC) (Ban et al, 2003). In recent years, several articles have reported that Wnt signaling is linked to the ability of stem cells for self-renewal (Dravid et al., 2005; Huang et al., 2010; Miki et al., 2011). Activation of Wnt signaling by 6-bromoindirubin-3′-oxime (BIO), a pharmacological GSK3-specific inhibitor, can maintain the pluripotency in human and mouse ES cells, but little is understood about the exact mechanism undertaken in this process (Sato et al., 2004). Hao (2006) found that β-catenin, a component of the Wnt signaling pathway, might play a role in the self-renewal of ES cells. Altered Wnt ligand/receptor interactions significantly retard the growth of tumor xenografts derived from two EC cell lines, namely PA-1 and NTera-2, suggesting that the Wnt/β-catenin signaling pathway is involved in the regulation of cell proliferation of teratocarcinoma (DeAlmeida et al., 2007). The expression of Wnt and β-catenin is suppressed and GSK3β is induced in the inhibition of P19 cell proliferation caused by overexpression of cyclinL2 (Zhou et al., 2009). Our results also demonstrated that activation of the Wnt/β-catenin signaling pathway stimulated the proliferation of P19 cells, maintained high expression of oct4, sox2, and nanog.

Hoxa1 and Hoxd4 are direct targets of RA receptor during trans-RA induced differentiation (Marshall et al., 1996). Our results showed that treatment with RA triggered P19 cell differentiation by reducing oct4, sox2, and nanog expression and upregulating Hoxa1 and Hoxd4 expression. However, cotreatment with SB216763 antagonized stem cell marker downregulation, and partially inhibited trans-RA responsive gene upregulation. High levels of both stem cell and differentiation markers were observed in P19 cells treated with trans-RA and SB216763. It seems that P19 cells remain between the differentiated and undifferentiated state after treatment with trans-RA and SB216763. The effects of all-trans RA and Wnt/β-catenin signaling on cell fate determination is worthy of investigation in the future studies.

C-myc gene is a known oncogene whose activation significantly promotes the proliferation of tumor cells (Shachaf et al., 2004; Giuriato et al., 2006). C-myc activation is directly targeted by Wnt/β-catenin signaling pathway (He et al., 1998). Ectopic expression of myc inhibits the differentiation of murine ES cells when LIF is removed from the medium (Cartwright et al., 2005). By contrast, inhibition of myc induces differentiation of ES cells even in the presence of LIF, demonstrating that myc is critical for the maintenance of ES cell self-renewal (Varlakhanova et al., 2010).The human EC cell line NT2/D1 expresses high levels of c-myc that significantly decrease during differentiation (Miller et al., 1990; Freemantle et al., 2007). C-myc expression is also suppressed by the inhibition of P19 cell growth (Zhen et al., 2010). In this study, we show activation of Wnt/β-catenin signaling induced the expression of c-myc and nuclear localization in P19 cells. And c-myc mediated the effects of the Wnt/β-catenin signaling pathway on P19 cell proliferation and differentiation. However, c-myc may not be the only target of Wnt/β-catenin signaling responsible for enhanced proliferation and inhibited differentiation of P19 cells. Knockdown of c-myc transcription resulted in a ∼ 70% decrease in cell proliferation promoted by Wnt/β-catenin signaling, demonstrating that knockdown of c-myc does not completely abolish the regulation of stem cell specific genes and RA-responsive genes caused by Wnt/β-catenin signaling. Further studies will need to be carried out to examine the effect of Wnt/β-catenin signaling on other factors, as well as to know how these factors might contribute to Wnt/β-catenin signaling induced P19 cell proliferation.

The present results suggest that the Wnt/β-catenin signaling pathway may promote EC cell proliferation via upregulation of c-myc expression, and that Wnt/β-catenin signaling may become a target for the future treatment of teratocarcinoma.

Ancillary