SEARCH

SEARCH BY CITATION

Keywords:

  • pancreatic carcinoma;
  • adenoviral vector;
  • IFNγ;
  • gene therapy

Abstract

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited

Pancreatic cancer is one of the most lethal human malignancies with a very low 5-year survival rate, which highlights urgent needs for more effective therapeutic strategies. In this study, we examined the potential therapeutic effects of an adenovirus encoding human interferon gamma (Ad-IFNγ) on pancreatic carcinoma cells Capan-2 in vitro and in vivo. The results indicated that Ad-IFNγ could significantly inhibit tumor cell growth via inducing cell apoptosis. After infection, IFNγ expressed durably and stably in xenografts, predominantly in tumor tissue, while much less in blood and liver. Thus, adenovirus-mediated intratumoral injection of human IFNγ gene could be an effective gene therapeutic system for the treatment of pancreatic carcinoma. Anat Rec, 296:604–610, 2013. © 2013 Wiley Periodicals, Inc.

Pancreatic cancer is a fatal disease characterized by its very poor prognosis. Although the incidence is relatively low, this aggressive disease ranked the 4th leading cause of cancer-related deaths in the United States (Siegel et al., 2012). The majority of patients were in advanced stages (locally advanced unresectable or metastastic) as they are diagnosed, only 15–20% are surgical candidates. Even with surgery, the 5-year survival following resection is 25–30% for node-negative disease and 10% for node-positive disease, most of which develop to metastasis/recurrent disease (Clark et al., 2012; Zaniboni et al., 2012). The 5-year survival rate is <1% with most patients dying within 1 year. The primary goals of treatment in this setting are to prolong survivals and improve life quality of patients (Rosenblatt et al., 2010).

Chemotherapy is a major choice for the advanced pancreatic cancer. In a phase III trial, gemcitabine administration was associated with significantly improvements in median overall survival and clinical response (Burris et al., 1997). The results of this study led to the approval of gemcitabine as first-line therapy of advanced pancreatic cancer by FDA. However, combinations of gemcitabine with fluorouracil, capecitabine, cisplatin, irinotecan, oxaliplatin, or pemetrexed produced little survival benefit (Stathis and Moore, 2010). Among the other approaches, small molecular inhibitors targeting human epidermal growth factor receptor (HER-1/EGFR) shows promise. In a phase III trial, the combination of gemcitabine with erlotinib significantly prolonged the overall survival of patients as compare to gemcitabine alone (Moore et al., 2007). Erlotinib plusgemcitabine were approved by FDA as first-line treatment for patients with advanced pancreatic cancer. But even with the rapid progress of therapies, the 5-year survival rate of advanced patients was extremely low stilly, which highlights urgent needs for more effective strategies.

Interferon gamma (IFNγ), a multifunctional cytokine which is mainly produced by T lymphocytes and natural killer cells (Boehm et al., 1997), exerts antiviral, antiproliferative, immunomodulatory, and antiangiogenesis effects on various cells (Bansal et al., 2012). As an important regulator of CD4+ T helper cells, IFNγ could upregulate the expression of MHC molecules on cancer and endothelial cells (Rakshit et al., 2012). A number of oncological experiments had proven an inhibitory role of IFNγ on cell growth (Zhao et al., 2007; Zuo et al., 2011). However, the clinical application of recombinant IFNγ protein is limited by its short half-life and significant side effects (Miyakawa et al., 2011). One possible way to improve the efficacy of IFNγ is to deliver the agent via a virus, which could achieve constant and efficient expression of the target gene during a specific period of time. Consequently, recombinant adenovirus carrying IFNγ gene showed potent effects both in animal models and in patients (Fathallah-Shaykh et al., 2000; Dummer et al., 2004).

In this study, we constructed a replication-defective adenovirus carrying human IFNγ gene and detected its potential antitumor activity on a pancreatic cell line Capan-2 in vitro and in vivo. The results showed that Ad-IFN-γ could effectively infect tumor cells and significantly inhibit the cell proliferation.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited

Cell Culture and Viruses

Pancreatic cancer cells Capan-2 were maintained in RPMI-1640 medium. WISH were routinely cultured in DMEM. All media contained 10% fetal bovine serum (Hyclone Laboratories, Logan, NJ) and 100 U mL−1 of penicillin and 100 µg mL−1 of streptomycin (GIBCO BRL, Gaithersburg, MD). All cells were obtained from American Type Culture Collection (ATCC, Manassas, VA).

The recombinant adenovirus carrying human IFNγ gene (Ad-IFNγ) was adenoviral serotype 5(Ad5) vector generated as previously described (Zhao et al., 2007). The adenovirus was regulated by cytomegalovirus (CMV)-immediate early promoter/enhancer and a downstream polyadenylation signal from SV40. In some experiments, adenovirus encoding LacZ gene (Ad-lacZ) was used as mock infection. All adenovirus particles were produced by human embryonic kidney 293 cells, purified by the method cesium chloride gradient centrifugation according to a standard protocol and tittered by Adeno-XTM Rapid titer Kit (BD Biosciences Clontech, USA).

Virus Infected and Conditional Supernatant Collection

Capan-2 cells were seeded in 24-well plates (Corning, 2 × 104cells well−1). Recombinant adenovirus (diluted with serum free medium) was added to the cultures 24 hr after plating. The plates were incubated at 37°C in 5% CO2 for 2 hr. Thereafter, the culture medium was replaced with fresh medium and incubated for another 96 hr. Then the conditioned medium was collected, centrifuged at 300 × g to get rid of cell debris, and stored at −20°C for further analysis.

ELISA Analysis and Bioactivity Test

The concentration of IFNγ was measured with a human IFNγ enzyme-linked immunosorbent assay (ELISA) kit (R & D systems, Minneapolis, MN) according the manufacturer's instructions, each replicated twice. The bioactivity of IFNγ was evaluated by its inhibition of the cytopathic effect of vesicular stomatitis virus (VSV) on human WISH cells (10). Viability of WISH cells was determined by absorbance at 550 nm after dyeing with crystal violet. Recombinant human IFNγ (a generous gift from Chinese National Institute for the control of pharmaceutical and biological products) produced by E. coli was used as standard control.

Effect of Ad-IFNγ on Cell Growth In Vitro

Effect of Ad-IFNγ on cell growth of Capan-2 was determined using an MTT assay. Capan-2 were seeded in a 96-well plate at a density of 6,000 cells per well with RPMI 1640 24 hr before infecting with Ad-IFNγ at MOIs of 100, 50, 10 orAd-lacZ at an MOI of 100. After incubation for 2 hr, the culture medium was replaced with fresh medium and kept for another 96 hr. For detection of cell growth, 20 μL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) (Fluka Biochemika, Buchs, Switzerland) was added to each well and the plate was incubated for an additional 4 hr at 37°C. Then, 100 μL dimethyl sulfoxide (DMSO) was added to each well within 1 hr and incubated for 10 min at 37°C. Absorbance was read at 450 nm. Each well was triplicated under the same conditions.

Effect of Ad-IFNγ on Cell Apoptosis In Vitro

Cells were plated at a density of 2 × 105 per 25 cm2 and adhered for 24 hr before infecting with virus at an MOI of 50 (Ad-LacZ or Ad-IFNγ). After treating for 5 days, the cells were trypsinized, wash twice with PBS, and stained with annexin V-FITC (BD Biosciences) according to the manufacturer's instructions. Flow cytometry was done immediately using a FACS Calibur flow cytometer (Beckman-Coulter, Miami, FL). Data was analyzed with cellQuest software (Becton Dickinson, San Jose, CA).

Effect of Ad-IFNγ on Tumor Growth in Nude Mice

Female nu/nu nude mice (4–6 weeks old) were obtained from Beijing vital River Experimental Animals (Beijing, China; animal experimental license no.SCXKjing2002-0003) and maintained under pathogen-free conditions. After 1-week adaptation, the mice were injected subcutaneous injection (s.c.) in the flanks with Capan-2 at a density of 5 × 106 cells/each. Two weeks later intratumoral injection ofAd-IFNγ or Ad-lacZ was performed at 1 × 109 pfu day−1, for 5 days (n=5), in addition, five mice were injected with 200 μL saline as negative control. Tumors were measured with a caliper gauge regularly after 6 weeks since the initial injections. Tumor volume was determined twice a week with calipers and calculated by following formula: Tumor volume (V)=L × W2/2 (L, length; W, width). Upon termination of the experiment, tumors were harvested and weighted, then fixed for 24 hr in 10% neutral formaldehyde for histological analysis or frozen for targeted gene expression analysis. All animal experiments were conducted in accordance with Guidelines for the Welfare of Animals in Experimental Neoplasis and approved by the Sun Yat-sen University Institutional Animal Care and Use Committees.

RNA Preparation and Semiquantitative RT-PCR

Total RNA was extracted using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions. RNA was submitted to DNase digestion and aliquots of 1 µg were used for reverse transcription with reverse transcription system (Promega). PCR reaction was done using the following primers: human β-actin (Accession number: NM_001101.3), forward primer: 5′- GTCACCAACTGGGACGACAT -3′and antisense: 5′- GAGGCGTACAGGGATAGCAC -3′; Human IFNγ (Accession number : NM_000619) sense: 5′-CCCTCTAGATGTTACTGCCAGGACCCATA-3′ and antisense: 5′-CCCGCGGCCGCTTACTGGGATGC TCTTCGAC-3′. Cycle conditions for all PCR reactions were 1 min at 95°C, 1 min at 55°C, and 1 min at 72°C for 30 cycles. The size of expected PCR products was 209 bp for β-actin and 460 bp for IFNγ. The PCR products were separated on 1% agarose gels, stained by ethidium bromide and visualized by UV light. To assess distribution of gene expression, tumors, organs, and blood of mice on Day 3 after treatment were used for semiquantitative RT-PCR analysis.

IFN-γ Expression In Vivo

Frozen samples were grounded in 1 × TBS (25 mmol L−1 Tris, 138 mmol L−1 NaCl, and 3 mmol L−1 KCl, pH 7.4) and centrifuged at 8,000 g for 1 min. The supernatants were harvested for analysis. The levels of IFNγ expression were determined with a human IFNγ ELISA kit (R&D systems) according to the manufacturer's instructions.

Histological and Immunohistochemical Analyses

Tumor tissues were fixed in 10% buffered formalin, paraffin-embedded and cut into 4 -μm sections. Sections covering different areas of tumors were stained with hematoxylin and eosin. At least five representative tumor of each group were investigated for apoptosis or cellular proliferation. Apoptosis analysis was determined with a terminal deoxynucleotidyltransferase (TdT)-mediated dUTP neck end-labeling (TUNEL) kit (Roche Molecular Biochemicals, Germany). Following modifications were performed: sections were digested with proteinase K (20 μg mL−1) for 5 min and incubated with fluorescein-labeled deoxynucleotides and TdT at 37°C for 1 hr. Slides were examined with a fluorescence microscope (Leica). To assess the cell proliferation of tumor, immunohistochemical staining was perform using the monoclonal rabbit anti-human Ki-67 antibody (NeoMarkers). A total of 10 randomly chosen microscopy fields (200×) were evaluated for each tissue specimen.

Statistical Analysis

Results were evaluated using t test with SPSS 11.0 software (SPSS, Chicago, IL), unless otherwise specified. P<0.05 was considered statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited

Tumor Cells Can Effectively be Infected by Ad-IFNγ and Produce Bioactive IFNγ

Because highly effective expressions of IFNγ are the requirements for transgene therapy, we used ELISA assay to evaluate the efficiency of adenovirus infection in the Capan-2 cells. The culture supernatant of each group was collected to investigate IFNγ production at indicative time point. The expression profile of IFNγ in Capan-2 cells was shown as Fig. 1. IFNγ gene was efficiently expressed in the infected tumor cells, and concentrations of IFNγ levels in the conditioned supernatants rose slightly with increased amounts of virus. At 48 hr after infecting MOI of 100, the concentration of IFNγ reached to 34.67 ng mL−1. The activity of IFNγ produced by infected Capna-2 was 43.2 IU ng−1. Above assays indicated that relatively high-level bioactive IFNγ could be effectively expressed by the infected tumor cells with Ad-IFNγ.

image

Figure 1. Effect of Ad-IFNγ on the proliferation of capan-2 cell line. Capan-2 were infected with Ad-IFNγ at MOIs of 10, 50, and 100 MOI. Conditioned supernatants were harvest at 24-hr postinfection. The concentration of IFNγ in the supernatants were determined by ELISA (n=3).

Download figure to PowerPoint

Ad-IFNγ Inhibited Proliferation of Capan-2 In Vitro

It has been reported that r-hu-IFNγ can directly inhibit cell proliferation of various tumor cells, including nasopharyngeal carcinoma. To test whether the Ad-IFNγ has the same effect on the growth of Capna-2 we measured cell viability using MTT assay. The result showed that infection with control vector Ad-LacZ had not significantly decreased cell growth, while infection with Ad-IFNγ at MOLs of 10, 50, and 100 remarkably inhibit cell growth for 57.86, 47.06, and 41.30% respectively, indicating that Ad-IFNγ infection can produce bioactive IFNγ and inhibit cell growth effectively in Capan 2 (Fig. 2).

image

Figure 2. Cell growth was determined with the MTT assay (96 hr). Results were expressed as the percentage of absorbance value obtained in the MTT assay at indicated MOI in comparison with untreated cells. Capan-2 cell treated with Ad-Lac Z at a MOI of 100 was also used in this assay. There were five parallel samples at each MOI, the experiment was triplicated under identical conditions.

Download figure to PowerPoint

AdIFN-γ Infection Induced Cell Apoptosis of Capan-2

Capan-2 cells infected with Ad-IFNγ or control adnovirus were collected at indicated time points. The apoptotic index was significantly higher in Ad-IFNγ group (39.4%±1.0%) than in Ad-LacZ group (4.3%±1.0%, P < 0.001). The result indicated that AdIFN-γ infection could effectively induce cell apoptosis of Capan 2 (Fig. 3).

image

Figure 3. Ad-IFNγ induced apoptosis in Capan-2 cells. Apoptotic cells determined by flow cytometry assay (P<0.01);

Download figure to PowerPoint

Ad-IFNγ Intratumoral Injection Inhibited the Growth of Capan-2 Xenografted Tumors

To investigate whether the introduction of IFNγ gene could inhibit tumor growth, we established a Capan-2 xenograft tumor model in nu/nu nude mice. Ad-IFNγ was injected intratumorally once a week, and the volume of tumor was measured regularly twice a week at first week, then once a week for 5 weeks. During the treatment, animals in both saline control group and Ad-LacZ group showed extensive tumor proliferation (Fig. 4A). At the terminal of experiment, the maximum tumor size in saline control group was bigger than 717.5±148.0 mm3, the Ad-LacZ group was about 638.7±81.1 mm3, while the treated group was only 305.33±61.39 mm3. The inhibition rate in Ad-LacZ group was 42.6%±8.5% as compared with saline control group and 47.8%±9.0% as compared with Ad-LacZ group. There were significant differences between Ad-IFNγ and other two groups (saline or Ad-LacZ, P < 0.05). At Day 35 (Fig. 4B), we observed an average of 59.15% suppression of tumor growth in Ad-IFNγ group (tumor weight: 0.29±0.05 g) in comparison with saline group (0.71±0.08 g, P < 0.01). There was no significant difference in growth kinetics and tumor weight between Ad-LacZ and saline group.

image

Figure 4. Effect of treatment with saline, Ad-LacZ, or Ad-IFNγ on human pancreatic cancer xenografts. (A) Time-dependent growth of tumor volume in mice inoculated with Capan-2 cells. (B) Tumor weight of xenografted mice after 4 weeks of treatment. P < 0.01.

Download figure to PowerPoint

Dynamic Expression of IFNγ In Vivo

Here we used RT-PCR to detect dynamic expression of IFNγ at mRNA level, which demonstrated that high-levels of IFNγ were expressed inside tumor tissues after infection (Fig. 5A) even at the 7th day. This result suggested that Ad-IFNγ treatment could lead to production of IFNγ for more than 7 days. ELISA kit had also been utilized to examine the target gene production at protein level (Fig. 5B). The assay showed that IFNγ was dominantly distributed in tumor tissues, thus may cause less toxicity against normal tissues. These data indicated that Ad-IFNγ could infect tumor cells durably and stably for at least 7 days after one single intratumoral injection.

image

Figure 5. (A) RT-PCR analysis of IFNγ gene expression in the pancreatic tumor tissue. β-actin was used as the loading control. (B) Distribution of IFNγ in the main organ of mice which were intratumoral injection AdIFNγ 1 × 109 PFU at the indicated day postinjection.

Download figure to PowerPoint

Histological and Immunohistochemical Analyses

Representative tumors harvested from each group were processed for histological and immonohistochemical analysis (Fig. 6). From HE-stained sections, we could clearly observe extensive necrosis in Ad-IFNγ group, while few areas in saline group and Ad-LacZ group. Cell proliferation and apoptosis were evaluated using anti-Ki-67 staining and TUNEL method, respectively. Results were shown in Table 1. The median number of Ki-67 positive tumor cells in saline group and Ad-LacZ group were 620±188 and 653±169, respectively, while Ad-IFNγ group were decreased to 409±126 (both P<0.05). The mean number of TUNEL-positive cells was negatively correlated to the number of Ki-67 positive cells. The average value of TUNEL positive cells in saline and Ad-LacZ group were 10±3 and 9±3, respectively, while Ad-IFNγ group were 132±30 (both P<0.05).

image

Figure 6. Histological examination of xenografts (Saline, Ad-LacZ, or Ad-IFNγ) growing in balbc nu/nu mice. (A) Slides are stained with H&E after Ad-IFNγ treatment (to show necrosis, × 100). (B) Immunostaining of Ki-67 antigen (to show cell proliferation). (C) TUNEL (FITC; to show apoptosis cells). Representative samples (×200, excluded H&E stained) are shown.

Download figure to PowerPoint

Table 1. Immuohistochemical analysis of human pancreatic cancer Capan-2 s.c. xenogrft tumors
Teatment groupKi-6aTUNELa
  1. a

    Number (Mean ± SD) Proliferating cells(Ki-67), apoptosis cells(TUNEL stain), respectively, positive cells/field measurement from10 random high Power fields (×200).

  2. b

    P<0.05 compare with saline.

  3. c

    P<0.05 compare with Ad-LacZ.

  4. d

    P<0.001 compare with saline.

  5. e

    P<0.001 compare with Ad-LacZ.

PBS619.9±188.49.5±2.8
Ad-LacZ652.6±169.39.0±2.9
Ad-IFNγ409±125.7b, c131±29.5d, e

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited

Characterized by notable aggressiveness, early present local-regional and hepatic metastasis, pancreatic cancer is a highly malignant disease. Despite advances in diagnostic imaging, improvements in radiation therapy techniques, and availability of new systemic therapies, the survival and mortality of patients with pancreatic tumor remained relatively low (Shamirkhanian et al., 1971). In contrast with other malignancies, pancreatic cancer is resistant to regularly used chemotherapy and radiation regimens (Kanai et al., 2011). It is of great importance to establish new effective therapeutic strategies. In this study, we found that intratumoral injection with Ad-IFNγ could produce bioactive IFNγ which has anticancer effects on a pancreatic cell line Capna-2 through inducing cell apoptosis.

The antitumor activities of IFNγ are direct actions on tumor cells and indirect function on immunomudulation and antiangiogenesis. Antiproliferative effect of IFNγ had been reported previously, more specifically, it can influence cell cycle arrest, proapoptosis, or both in a cell type-specific pattern (Zhao et al., 2007; Zuo et al., 2011). Moreover, many studies also showed that IFNγ can induce apoptosis through upregulation of a number of apoptosis-related proteins, including tumor necrosis factor receptor, Fas, and other death receptors, as well as their correspondent ligands, several Bcl-2 family members, and caspases proteins (Barton et al., 2005). In our study, flow cytometric analysis and TUNEL assay indicated that IFNγ could induce apoptosis in pancreatic cells. The effect of IFNγ on cell apoptosis seemed like a direct one in vitro experiments, but in vivo it appeared more complicated. Previous studies had revealed that IFNγ could directly inhibit neovascularization of tumor by inducing apoptosis of endothelial cell in vivo (Fathallah-Shaykh et al., 2000; Kowalczyk et al., 2003), as well as induce production of IP-10 in endothelial cells to inhibit endothelial cells differentiation and exert potent antiangiogenesis activity by inhibiting (Wong et al., 2004). In nude mice xenografts models, these direct and indirect antitumor effects of IFNγ may contribute to tissue necrosis and apoptotic cells.

The clinical application of recombinant IFNγ is hampered by its short half-life and significant systemic side effects, which urges the necessity for repeat low-dose injection continuously (Dummer et al., 2004). Attempts to enhance the antitumoral efficacy by increasing the dose and the exposure to IFNγ could actually result in higher toxicities and lower efficacy (Dummer et al., 2004; Zeytin et al., 2008). The dilemma may be circumvented by construction of a recombined adenovirus, which can persistently express IFNγ in tumors without unwanted system side effects. Both our in vitro and in vivo studies showed that the bioactive IFNγ produced by Ad-IFNγ-infected capan-2 cell could even express persistently for more than 7 days. Safety and toxicity analysis indicated that the transgenic product IFNγ expressed predominantly in the tumor tissues, particularly durably and stably at plasma comparing with the recombinant protein that treated in patients. During the treatment, no obvious systemic toxicity was observed. At the end of the treatment, the heart, liver, spleen, and kidney sections of each group were fixed and stained with hematoxylin and eosin, minimal tissue pathologic changed were observed (data not shown). These results indicated the application of Ad-IFNγ is safe and clinically feasible.

In conclusion, intratumoral injection with Ad-IFNγ could persistently and stably express therapeutical IFNγ, which may reduce side effect of IFNγ and perform more effective antitumor effect. Considering the multimodality therapy of malignant, Ad-IFNγ combined with conventional treatment maybe even more powerful to inhibit tumor progression and metastasis.

Literature Cited

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  • Bansal R, Tomar T, Ostman A, Poelstra K, Prakash J. 2012. Selective targeting of interferon gamma to stromal fibroblasts and pericytes as a novel therapeutic approach to inhibit angiogenesis and tumor growth. Mol Cancer Ther.
  • Barton C, Davies D, Balkwill F, Burke F. 2005. Involvement of both intrinsic and extrinsic pathways in IFN-gamma-induced apoptosis that are enhanced with cisplatin. Eur J Cancer 41:14741486.
  • Boehm U, Klamp T, Groot M, Howard JC. 1997. Cellular responses to interferon-gamma. Annu Rev Immunol 15:749795.
  • Burris HA III, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, Von Hoff DD. 1997. Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial. J Clin Oncol 15:24032413.
  • Clark CJ, Graham RP, Arun JS, Harmsen WS, Reid-Lombardo KM. 2012. Clinical outcomes for anaplastic pancreatic cancer: a population-based study. J Am Coll Surg 215:627634.
  • Dummer R, Hassel JC, Fellenberg F, Eichmuller S, Maier T, Slos P, Acres B, Bleuzen P, Bataille V, Squiban P, Burg G, Urosevic M. 2004. Adenovirus-mediated intralesional interferon-gamma gene transfer induces tumor regressions in cutaneous lymphomas. Blood 104:16311638.
  • Fathallah-Shaykh HM, Zhao LJ, Kafrouni AI, Smith GM, Forman J. 2000. Gene transfer of IFN-gamma into established brain tumors represses growth by antiangiogenesis. J Immunol 164:217222.
  • Kanai M, Yoshimura K, Asada M, Imaizumi A, Suzuki C, Matsumoto S, Nishimura T, Mori Y, Masui T, Kawaguchi Y, Yanagihara K, Yazumi S, Chiba T, Guha S, Aggarwal BB. 2011. A phase I/II study of gemcitabine-based chemotherapy plus curcumin for patients with gemcitabine-resistant pancreatic cancer. Cancer Chemother Pharmacol 68:157164.
  • Kowalczyk DW, Wlazlo AP, Giles-Davis W, Kammer AR, Mukhopadhyay S, Ertl HC. 2003. Vaccine-induced CD8+ T cells eliminate tumors by a two-staged attack. Cancer Gene Ther 10:870878.
  • Miyakawa N, Nishikawa M, Takahashi Y, Ando M, Misaka M, Watanabe Y, Takakura Y. 2011. Prolonged circulation half-life of interferon gamma activity by gene delivery of interferon gamma-serum albumin fusion protein in mice. J Pharm Sci 100:23502357.
  • Moore MJ, Goldstein D, Hamm J, Figer A, Hecht JR, Gallinger S, Au HJ, Murawa P, Walde D, Wolff RA, Campos D, Lim R, Ding K, Clark G, Voskoglou-Nomikos T, Ptasynski M, Parulekar W. 2007. Erlotinib plus gemcitabine compared with gemcitabine alone in patients with advanced pancreatic cancer: a phase III trial of the National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 25:19601966.
  • Rakshit S, Ponnusamy M, Papanna S, Saha B, Ahmed A, Nandi D. 2012. Immunotherapeutic efficacy of Mycobacterium indicus pranii in eliciting anti-tumor T cell responses: critical roles of IFNgamma. Int J Cancer 130:865875.
  • Rosenblatt E, Jones G, Sur RK, Donde B, Salvajoli JV, Ghosh-Laskar S, Frobe A, Suleiman A, Xiao Z, Nag S. 2010. Adding external beam to intra-luminal brachytherapy improves palliation in obstructive squamous cell oesophageal cancer: a prospective multi-centre randomized trial of the International Atomic Energy Agency. Radiother Oncol 97:488494.
  • Shamirkhanian ST, Nersisian VM, Uzunian L, Pogosian AS, Shcherbakova LN. 1971. The relationship between multiple blood transfusions and the appearance of isoimmunization to the formed elements of the blood. Zh Eksp Klin Med 11:8690.
  • Siegel R, DeSantis C, Virgo K, Stein K, Mariotto A, Smith T, Cooper D, Gansler T, Lerro C, Fedewa S, Lin C, Leach C, Cannady RS, Cho H, Scoppa S, Hachey M, Kirch R, Jemal A, Ward E. 2012. Cancer treatment and survivorship statistics, 2012. CA Cancer J Clin 62:220241.
  • Stathis A, Moore MJ. 2010. Advanced pancreatic carcinoma: current treatment and future challenges. Nat Rev Clin Oncol 7:163172.
  • Wong RJ, Chan MK, Yu Z, Ghossein RA, Ngai I, Adusumilli PS, Stiles BM, Shah JP, Singh B, Fong Y. 2004. Angiogenesis inhibition by an oncolytic herpes virus expressing interleukin 12. Clin Cancer Res 10:45094516.
  • Zaniboni A, Aitini E, Barni S, Ferrari D, Cascinu S, Catalano V, Valmadre G, Ferrara D, Veltri E, Codignola C, Labianca R. 2012. FOLFIRI as second-line chemotherapy for advanced pancreatic cancer: a GISCAD multicenter phase II study. Cancer Chemother Pharmacol 69:16411645.
  • Zeytin H, Reali E, Zaharoff DA, Rogers CJ, Schlom J, Greiner JW. 2008. Targeted delivery of murine IFN-gamma using a recombinant fowlpox virus: NK cell recruitment to regional lymph nodes and priming of tumor-specific host immunity. J Interferon Cytokine Res 28:7387.
  • Zhao P, Zhu YH, Wu JX, Liu RY, Zhu XY, Xiao X, Li HL, Huang BJ, Xie FJ, Chen JM, Ke ML, Huang W. 2007. Adenovirus-mediated delivery of human IFNgamma gene inhibits prostate cancer growth. Life Sci 81:695701.
  • Zuo Y, Wu J, Xu Z, Yang S, Yan H, Tan L, Meng X, Ying X, Liu R, Kang T, Huang W. 2011. Minicircle-oriP-IFNgamma: a novel targeted gene therapeutic system for EBV positive human nasopharyngeal carcinoma. PLoS One 6:e19407.