Lingo-1 Inhibited by RNA Interference Promotes Functional Recovery of Experimental Autoimmune Encephalomyelitis

Authors

  • Chun-Juan Wang,

    1. Department of Neurology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for more papers by this author
  • Chuan-Qiang Qu,

    1. Department of Neurology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China
    Search for more papers by this author
  • Jie Zhang,

    1. Department of Neurology, People's Hospital of Zouping County of Shandong Province, Zouping, China
    Search for more papers by this author
  • Pei-Cai Fu,

    1. Department of Neurology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    Search for more papers by this author
  • Shou-Gang Guo,

    Corresponding author
    1. Department of Neurology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China
    • Correspondence to: Rong-Hua Tang; Department of Neurology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China. E-mail: jim1022@126.com or Shou-Gang Guo, Department of Neurology, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, China. E-mail: guoshougang@163.com.

    Search for more papers by this author
  • Rong-Hua Tang

    Corresponding author
    1. Department of Neurology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
    • Correspondence to: Rong-Hua Tang; Department of Neurology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China. E-mail: jim1022@126.com or Shou-Gang Guo, Department of Neurology, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, China. E-mail: guoshougang@163.com.

    Search for more papers by this author

ABSTRACT

Lingo-1 is a negative regulator of myelination. Repairment of demyelinating diseases, such as multiple sclerosis (MS)/experimental autoimmune encephalomyelitis (EAE), requires activation of the myelination program. In this study, we observed the effect of RNA interference on Lingo-1 expression, and the impact of Lingo-1 suppression on functional recovery and myelination/remyelination in EAE mice. Lentiviral vectors encoding Lingo-1 short hairpin RNA (LV/Lingo-1-shRNA) were constructed to inhibit Lingo-1 expression. LV/Lingo-1-shRNA of different titers were transferred into myelin oligodendrocyte glycoprotein-induced EAE mice by intracerebroventricular (ICV) injection. Meanwhile, lentiviral vectors carrying nonsense gene sequence (LVCON053) were used as negative control. The Lingo-1 expression was detected and locomotor function was evaluated at different time points (on days 1,3,7,14,21, and 30 after ICV injection). Myelination was investigated by luxol fast blue (LFB) staining.LV/Lingo-1-shRNA administration via ICV injection could efficiently down-regulate the Lingo-1 mRNA and protein expression in EAE mice on days 7,14,21, and 30 (P < 0.01), especially in the 5 × 108 TU/mL and 5 × 109 TU/mL LV/Lingo-1-shRNA groups. The locomotor function score in the LV/Lingo-1-shRNA treated groups were significantly lower than the untreated or LVCON053 group from day 7 on. The 5 × 108 TU/mL LV/Lingo-1-shRNA group achieved the best functional improvement (0.87 ± 0.11 vs. 3.05 ± 0.13, P < 0.001). Enhanced myelination/remyelination was observed in the 5 × 107, 5 × 108, 5 × 109 TU/mL LV/Lingo-1-shRNA groups by LFB staining (P < 0.05, P < 0.01, and P < 0.05).The data showed that administering LV/Lingo-1-shRNA by ICV injection could efficiently knockdown Lingo-1 expression in vivo, improve functional recovery and enhance myelination/remyelination. Antagonism of Lingo-1 by RNA interference is, therefore, a promising approach for the treatment of demyelinating diseases, such as MS/EAE. Anat Rec, 297:2356–2363, 2014. © 2014 Wiley Periodicals, Inc.

Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system (CNS), characterized by the destruction of myelin (Lassmann et al., 2007). Most MS patients present with a clinical course of relapse and remission. During the relapsing stage, the inflammation leads to the exposure of myelin and axonal damage. The nerve conduction is impaired through affected axons, producing symptoms, such as paralysis, sensory disorder, and visual impairment. During the remission stage, the symptoms relieve to different degrees, owing to different levels of remyelination (Prineas and Connell, 1979; Prineas et al., 1993; Patrikios et al., 2006). In the early phase of MS, the episodes of functional deficits could recover completely, and the patients may become totally normal in the remission stage. After repeated onsets, the disease may progress to the chronic phase with worsening symptoms and incomplete recovery. Incomplete recovery may lead to permanent functional impairment. Just as we know that MS is the most common disabling neurological disease of young adults.

Then what is the chief culprit for permanent disability? There are two pathological components of MS disability:axonal injury and impaired remyelination (Hanafy and Sloane, 2011). Intact, myelin sheath is the key for axonal integrity and signal conduction. Repeated loss of myelin may cause axonal injury, eventually leading to progressive and irreversible functional deficits. Studies have shown that long-term demyelination can cause mitochondrial dysfunction and axonal degeneration (Kiryu-Seo et al., 2010). Thus, to avoid axonal injury in MS, it is crucial to restore myelination as soon as possible. Pharmacological therapies for MS aim to immune-modulation or myelin repair (remyelination). Currently, immunomodulatory drugs to impede immune cells infiltration in the CNS are widely used but to date there is no efficient therapeutic agent for myelin repair. Remyelination is the process of creating new myelin sheaths on demyelinated axons. Many studies have confirmed the existence of remyelinationin MS lesions, but remyelination was insufficient (Perier and Gregoire, 1965; Prineas et al., 1993; Raine and Wu, 1993; Lassmann et al., 1997; Patrikios et al., 2006; Albert et al., 2007). In addition, the newly formed myelin sheaths may have abnormal structures, such as shorter intermodal length and thin myelin sheath (Prineas and Connell, 1979; Prineas et al., 1993). Remyelination depends on the survival, proliferation, migration, and maturation of oligodendrocyte precursor cells (OPCs). Numerous OPCs have been observed in MS lesions. There are a number of possible issues that limit remyelination within MS including oligodendrocyte maturation impediment (Kuhlmann et al., 2008), impaired oligodendrocyte migration and/or proliferation (Hanafy and Sloane, 2011). Thus, stimulating the endogenous OPCs is a realistic approach to promote remyelination (Franklin and Ffrench-Constant, 2008).

Leucine-rich repeat and immunoglobulin (Ig) domain containing protein-1 (Lingo-1) belongs to a larger family of LRR-Ig-containing proteins and is selectively expressed in neurons and oligodendrocytes in the brain and spinal cord. It is generally believed that Lingo-1 negatively regulates oligodendrocyte differentiation and myelination. Many studies have shown that antagonism of endogenous Lingo-1 function in OPCs by Lingo-1-Fc or dominant negative-Lingo-1 (DN-Lingo-1) or anti-Lingo-1 antibody promotes oligodendrocyte differentiation (Mi et al., 2005; Lee et al., 2007; Zhao et al., 2007).

Currently, five kinds of methods, such as soluble Lingo-1(Jepson et al., 2012), dominant-negative suppression (Inoue et al., 2007), antibody (Mi et al., 2007), RNA interference (Hutson et al., 2012), and genetic knockout of animals (Mathis et al., 2010) are commonly used to antagonize Lingo-1 function. The technology of gene knockout is limited to certain species of animals and certain kinds of cells. Moreover, soluble Lingo-1, dominant-negative suppression and antibody have low specificity and short-term effects (Inoue et al., 2007; Jepson et al., 2012). RNA interference is a method to degrade targeted mRNA by a protein complex called RNA induced silencing complex (Hannon, 2002), culminating in the specific knockdown of related gene expression. RNA interference, based on the introduction of short hairpin RNA (shRNA) into cells, is a promising experimental tool to silence gene expression in almost all cell types and various species (Roether and Meister, 2011). Small hairpin RNA or shRNA is carried by viral vectors (Lebedev et al., 2013). Adenovirus, adeno-associated virus, retrovirus, and lentivirus can act as viral vectors. Among of all, lentivectors possess several advantages over other viral vectors. First, lentiviral vectors could transduce a wide range of cell types regardless of their dividing status (Guo et al., 2009, 2012), including neurons (Hutson et al., 2012), astrocytes (Delzor et al., 2013), and oligodendrocytes (Wu et al., 2013).Second, Lentivectors lead to prolonged transgene expression due to integration into the host genome (Bokhoven et al., 2009). Finally, with respect to the toxicity of viral vectors, lentiviral vectors might induce less antivector immune response (He Y, et al., 2006; He Y and Falo LD, 2006). In additionally, the methods for lentiviral vectors encoding shRNA administration are convenient, such as intrathecal injection, oral, or intraperitoneal injection. Myelin oligodendrocyte glycoprotein (MOG)-induced experimental autoimmune encephalomyelitis (EAE) is a widely accepted animal model for MS. It has been demonstrated that inhibition of Lingo-1 function, through Lingo-1 knockout or Lingo-1 antagonist antibody could lower EAE clinical scores, improve axonal integrity, and enhance remyelination (Mi et al., 2007). Based on these researches, we attempt to test if inhibition of Lingo-1 by RNA interference contributes to EAE recovery.

MATERIALS AND METHODS

Lentiviral Vectors Construction

The lentiviral vectors were constructed by the GeneChem Company (Shanghai, China) to specifically silence the Lingo-1 gene. In addition, a green fluorescent protein (GFP) tag was encoded in the vector sequence. Lentivirus particles carrying GFP were prepared as described previously (Rubinson et al., 2003). The final lentiviral vector titers achieved were 5 × 109 TU/mL.

Animals and EAE Induction

Eight to 10-weeks-old female C57/BL6 mice, weighing 18–20 g, were purchased from Shanghai Laboratory Animal Center (Shanghai, China). All animal experimental procedures were in compliance with the guidelines of the National Animal Care and Use Committee.

Mice were immunized subcutaneously on the back and foot with 200 µg of MOG35-55 peptide (MGVGTTASPPSAVVHLTAAGL; Sigma) emulsified in complete Freund's adjuvant containing 4 mg/mL of mycobacterium tuberculosis(obtained from Shanghai Biological Products Institute). In addition, the mice were given an intraperitoneal injection of 200 ng of pertussis toxin (Sigma) at the time of immunization and 48 hr later. Mice were scored daily for clinical signs of EAE using an arbitrary scale of 0–5 as described previously (Yan et al., 2010) (Table 1).

Table 1. Locomotor assessment scale of EAE
scoreManifestations
0No clinical sign
1fully limp tail
2paralysis of one hind limb
3paralysis of both hind limbs
4paralysis of trunk
5moribund or death
Table 2. Primers used in RT-PCR to assess the expression of Lingo-1 in mice brain
NameForward SequenceReverse SequenceBp
Lingo-1TCTATCACGCACTGCAACCTGACAGCATGGAGCCCTCGATTGTA44
Beta-actinCACCCGCGAGTACAACCTTCCCCATACCCACCATCACACC40
Table 3. Incidence of EAE in mice induced with MOG
ImmunogenMorbidityTime of onset (d)Mean score of onset
MOG35-5581.3%(65/80)7.43±1.142.45±0.94

Intracerebroventricular Injection

Treatments were administered at the onset of EAE. Mice with the score between two and three were anesthetized by intraperitoneal injection of phenobarbital (6 mg/100 g). A stereotaxic instrument was used to immobilize the heads of anesthetized mice. A clean guide cannula was placed 1.5 mm lateral and 2 mm dorsal with respect to bregma. Intracerebroventricular (ICV) injection was administered using a 10 µL Hamilton syringe attached to the cannula that extended 1 mm beyond the tip of the guide cannula. All mice received treatments in 5 µL injection volume into both lateral ventricles over a 5-min time period followed by an additional 2-min delay to allow diffusion before removing the cannula.

Assessment of Locomotor Function

Mice (N = 105) were randomly divided into five groups. Group 1 received 5 µL 5 × 109 TU/mL LV/Lingo-1-shRNA by ICV injection. Group 2 received 5 µL 5 × 108 TU/mL LV/Lingo-1-shRNA by ICV injection. Group 3 received 5 µL 5 × 107 TU/mL LV/Lingo-1-shRNA by ICV injection. Group 4 received 5 µL lentiviral vectors carrying nonsense gene sequence (LVCON053) by ICV injection. Group 5 received no treatment. Locomotor function was assessed on days 1,3,7,14,21, and 30 after ICV injection as mentioned above (Table 1).

RNA Isolation and Real-Time qPCR

Total RNA was extracted from the brain tissue on days 1,3,7,14,21, and 30 after lentiviral vectors injection using TRIZOL reagent (Invitrogen, Paisley, UK), treated with DNase I and purified using RNAiso Plus kit (Takara). Concentration was measured using a NanoVue spectrophotometer (GE Healthcare Biosciences, PA). RNA was reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara) according to the manufacturer's instructions. Real-time qPCR was performed using the SYBR Premix Ex TaqTM II kit (Takara). Forward and reverse primer sequences are shown in Table 2. All PCR amplifications were normalized to β-actin level.

Western Blot

Protein lysates were extracted from the cerebral cortex (on days 1,3,7,14,21, and 30 after sh-RNA administration) by incubating in RIPA buffer supplemented with PMSF. Protein samples were separated by 10% SDS-PAGE, transferred to PVDF membranes and incubated with primary antibodies followed by blocking with 5%BSA. Primary antibodies were Lingo-1(ABCAM) and β-actin. Protein levels in tissues were quantified by densitometry and normalized to β-actin.

Histopathological Analysis

On day 30, the mice (N = 3) in each group were anesthetized with 10% chloral hydrate. Then myocardial perfusion was performed. The cerebral hemispheres were removed and embedded in paraffin. Slices were drawn from coronal sections around the periventricular zone with 6 µm thickness. The myelin was detected using Luxol fast blue (LFB) stain (Sigma, NY). To quantify the histologic findings, the staining intensity measured in the white matter was normalized to the intensity measured in the cortex with MetaMorph (Universal Imaging Corp., NY). The lower normalized intensity value corresponded to the less intense staining, which suggested the presence of demyelination in the white matter.

Statistical Analysis

The data were expressed as mean ± SEM. Statistical analysis was performed by one-way analysis of variance followed by post hoc tests (Tukey's HSD) for comparisons of more than two groups, or paired-samples t test for comparisons in the same group. Data were analyzed with the Graphpad Prism5 software. P < 0.05 was considered as statistically significant.

RESULTS

Establishment of EAE Models

Decreased activity and loss of appetite was observed in mice from day 5 and onward after inoculation. Dyskinesia occurred 7 days after inoculation. In this study, the overall incidence of EAE in mice was 81.3%, and the mean motor function score at onset was 2.45 ± 0.94 (Table 3).

Lingo-1 Expression Increased in EAE Mice

We compared the Lingo-1mRNA and protein expression levels between untreated EAE and normal mice on days 1,3,7,14,21, and 30. The results showed that the Lingo-1 mRNA and protein expression levels were significantly higher in the untreated EAE mice group than normal mice at any time (2.18 ± 0.09, 2.80 ± 0.10, 3.14 ± 0.05, 2.40 ± 0.09, 1.90 ± 0.10, and 1.69 ± 0.10, respectively, P < 0.01). The levels first increased and then decreased with time. On day 30, expression levels of Lingo-1 in untreated EAE mice were still higher than normal mice (Figs. 1 and 2). Thus, Lingo-1 expression was elevated in EAE mice and changed over time.

Figure 1.

The mRNA levels of Lingo-1 in mice were detected with real-time qPCR at different times after ICV injection (day 1,3,7,14,21, and 30 after ICV injection of LV/Lingo-1shRNA). All PCR amplifications were normalized to β-actin level. Analysis was performed using one way ANOVA with Tukey's HSD post hoc, *P < 0.05, **P < 0.01 compared to the data of normal mice and ΔP < 0.05, ΔΔP < 0.01 compared to the data of untreated mice. (Group 1: 5 × 107 TU/mL LV/Lingo-1-shRNA, Group 2: 5 × 108 TU/mL LV/Lingo-1-shRNA, Group 3: 5 × 109 TU/mL LV/Lingo-1-shRNA, Group 4: LVCON053, and Group 5: Untreated, N = 3 per group).

Figure 2.

The levels of Lingo-1 protein in mice were detected at different times after ICV injection (day 1,3,7,14,21, and 30 after ICV injection of LV/Lingo-1shRNA). Relative quantification (A) and representative images (B) of western blots of Lingo-1 were presented, respectively. β-actin was applied as a loading control. Analysis was performed using one way ANOVA with Tukey post hoc,*P < 0.05, **P < 0.01 compared to the data of normal mice and ΔP < 0.05, ΔΔP < 0.01 compared to the data of untreated mice. (Group 1: 5 × 107 TU/mL LV/Lingo-1-shRNA, Group 2: 5 × 108 TU/mL LV/Lingo-1-shRNA, Group 3: 5 × 109 TU/mL LV/Lingo-1-shRNA, Group 4: LVCON053, and Group 5: Untreated, N = 3 per group).

Lingo-1 mRNA and Protein Levels were Significantly Down-Regulated by LV/Lingo-1-shRNA

To confirm the effect of LV/Lingo-1-shRNA in vivo, we compared the expression levels of Lingo-1 mRNA and protein in animals treated with different concentrations of LV/Lingo-1-shRNA,untreated EAE mice, and normal mice(Figs.1 and 2). The expression levels were significantly decreased in the 5 × 108 TU/mL LV/Lingo-1-shRNA and 5 × 109 TU/mL LV/Lingo-1-shRNA groups. The Lingo-1 mRNA expression began to decrease significantly from day 7 after LV/Lingo-1 shRNA injection (1.77 ± 0.09, 1.97 ± 0.13 vs. 1.10 ± 0.10, P < 0.01). On day 14, the expression of Lingo-1mRNA in the 5 × 108 TU/mL LV/Lingo-1-shRNA and 5 × 109 TU/mL LV/Lingo-1-shRNAgroups were close to that of the normal group (1.19 ± 0.11, 1.46 ± 0.10 vs. 1.03 ± 0.09, P > 0.05, P < 0.05). Compared to the untreated and LVCON053 groups, the Lingo-1 protein expression also decreased significantly in the LV/Lingo-1-shRNA treated groups on day 7 (1.99 ± 0.07, 2.08 ± 0.06 vs. 3.14 ± 0.04, 3.08 ± 0.05, P < 0. 01), but reached close to the normal group on day 21. The Lingo-1 expression was also reduced in the 5 × 107 TU/mL LV/Lingo-1-shRNA group, but the reduction rate was significantly lower than the 5 × 108 TU/mL LV/Lingo-1-shRNA and 5 × 109 TU/mL LV/Lingo-1-shRNA groups (2.53 ± 0.10 vs. 1.99 ± 0.13, 2.08 ± 0.10, P < 0.01).Our results indicate that ICV injection of LV/Lingo-1-shRNA can suppress Lingo-1 expression in vivo.

Motor Function Score

To evaluate the effect of Lingo-1 suppression by RNA interference on motor function in EAE mice, we assessed the motor function score in EAE mice treated with different concentrations of LV/Lingo-1-shRNA at different times (Fig. 3). No significant difference in motor function score was observed on day 1 and 3 in all LV/Lingo-1-shRNAtreated groups (P > 0.05). On day 7, motor function of mice treated with different concentrations of LV/Lingo-1-shRNA (5 × 107, 5 × 108, and 5 × 109 TU/mL) was significantly improved, compared to the untreated or LVCON053 groups (2.78 ± 0.13, 1.58 ± 0.16, 2.34 ± 0.10 vs. 3.47 ± 0.13, 3.28 ± 0.14, P < 0.01). Motor function improved most significantly in the 5 × 108 TU/mL LV/Lingo-1-shRNA group (0.87 ± 0.11 vs. 3.05 ± 0.13, P < 0.01) on day 30.This suggested that antagonism of Lingo-1 by LV/Lingo-1-shRNA ameliorated motor function in EAE. However, motor function was not enhanced by increasing LV/Lingo-1-shRNA dose, and the moderate dose achieved the best functional improvement.

Figure 3.

Lingo-1 inhibition by ICV injection of LV/Lingo-1shRNA ameliorated locomotor function of EAE mice. Analysis was performed using one way ANOVA with Tukey's HSD post hoc among different groups and using paired samples t test for comparisons in the same group at different times, *P < 0.05, **P < 0.01, ***P < 0.001, N = 3 per group.

LV/Lingo-1-shRNA Enhanced Myelination in the Periventricular Zone of the Brain

After being treated with ICV injection of LV/Lingo-1-shRNA, myelination was assessed on day 30. Significant demyelination was observed in the untreated EAE group, compared to the normal group (Fig. 4). Myelination in the LV/Lingo-1-shRNA treated groups was significantly higher than the untreated group, but was lower than the normal group. Among different LV/Lingo-1-shRNA treated groups, myelination was most significant in the 5 × 108 TU/mL LV/Lingo-1-shRNA group (P < 0.01). No significant difference in the degree of myelination was observed between the 5 × 107 TU/mL LV/Lingo-1-shRNA group and the 5 × 109 TU/mL LV/Lingo-1-shRNA group (P > 0.05), but the degree of myelination in these groups was better than the untreated group (P < 0.05). Thus, Lingo-1 down-regulation could promote myelination in EAE.

Figure 4.

Representative images of LFB myelin staining were presented (A) and LFB staining intensities of the lesions normalized to the cortex were examined (B) from mice on day 30 after ICV injection. The degree of myelination was identified by the density of LFB staining. Scale bar = 100 um. *P < 0.05 compared to the data of untreated group. **P < 0.01 compared to the data of untreated group. ΔP < 0.05 compared to the data of normal mice. ΔΔP < 0.01 compared to the data of normal mice. ΔΔΔP < 0.001 compared to the data of normal mice. (Group 1: 5 × 107 TU/mL LV/Lingo-1-shRNA, Group 2: 5 × 108 TU/mL LV/Lingo-1-shRNA, Group 3: 5 × 109 TU/mL LV/Lingo-1-shRNA, Group 4: LVCON053, and Group 5: Untreated, N = 3 per group).

DISCUSSION

Lingo-1 is a transmembrane protein expressed in normal CNS, specifically by neurons and oligodendrocytes with enriched expression in the neocortex and limbic system (Carim-Todd et al., 2003). It is also expressed by Purkinje cells in the cerebellum and many nuclei of the midbrain, pons, and medulla (Benoit et al., 2007). The expression of Lingo-1 has been shown to increase in CNS diseases, such as essential tremor (Kuo et al., 2013), spinal cord injury, and MS (Mi et al., 2004). In this study, by comparing the Lingo-1 mRNA and protein levels between EAE mice and normal mice, we found that Lingo-1 expression in the cerebrum of EAE mice was markedly higher than that of normal mice. This may be related to the fact that OPCs in MS/EAE express much more Lingo-1, and the activated microglias and astrocytes during the disease could also express Lingo-1 (Satoh et al., 2007).

Previous studies have showed that lentiviral vectors could efficiently knock down Lingo-1 expression in vitro (Hutson et al., 2012) and in vivo (Wu et al., 2013). Here, we applied LV/Lingo-1-shRNA to suppress Lingo-1 in MOG-induced EAE mice. We found that ICV injection of LV/Lingo-1-shRNA down-regulated Lingo-1 mRNA and protein expression in the EAE mice. The titers of 5 × 108 and 5 × 109 TU/mL LV/Lingo-1-shRNA achieved similar effects in terms of inhibition of Lingo-1 expression. However, the efficiency of suppression did not increase with the increasing viral vectors dose. Thus, administering appropriate dose of LV/Lingo-1-shRNA via ICV injection is a feasible strategy to inhibit Lingo-1 expression in vivo.

EAE results in loss of locomotor function, which is a proof to judge whether EAE model is successfully established or not. Motor function in EAE animal models was quantified using aforementioned scoring method. The anti-Lingo-1 antibody can decrease the severity of EAE across all stages of disease. Mice deficient in Lingo-1 or treated with an antibody antagonist against Lingo-1 have been demonstrated to exhibit increased remyelination and functional recovery from EAE, a model of immune-mediated demyelination(Mi et al., 2007). EAE scores have also been shown to be significantly lower in Lingo-1 knockout mice (Mi et al., 2007). In our study, down-regulation of Lingo-1 expression by RNA interference significantly improved motor function in mice, and the improvement of motor function was observed on day 7 after the first injection. Compared to the untreated and LVCON053 groups, treatment with LV/Lingo-1-shRNA delayed EAE progression, thereby promoting functional recovery. The most significant decrease in scores appeared in the 5 × 108 TU/mL LV/Lingo-1-shRNA group, which was consistent with the inhibition of Lingo-1 expression. The results showed that LV/Lingo-1-shRNA significantly improved motor function and promoted functional recovery in EAE. However, the 5 × 109 TU/mL LV/Lingo-1-shRNA group did not achieve the same effect as that of the 5 × 108 TU/mL LV/Lingo-1-shRNA group. Motor function in the 5 × 108 TU/mL LV/Lingo-1-shRNA group was better than the 5 × 109 TU/mL LV/Lingo-1-shRNA group. The exact mechanism for this difference is not clear. One possible explanation is that RNA interference with high titers may be related to the induction of cytotoxicity (Hutson et al., 2012).

MS is caused by an immune attack on the myelin sheath (Franklin and Ffrench-Constant, 2008). Remyelination is an essential process required for functional recovery in demyelinating disease. The major contributor of clinical decline in chronic MS is the significant degeneration of demyelinated axons(Nave and Trapp, 2008; Stadelmann and Bruck, 2008).Therefore, to prevent axonal loss in MS, it is crucial to restore CNS myelin. Myelin, a discontinuous fatty insulation that ensheaths axons, is critical for the normal function of the CNS. It is generally accepted that Lingo-1 is a negative regulator of myelination. Many studies have confirmed delayed formation of myelin sheaths and reduced spinal cord myelination in transgenic mice expressing axonal Lingo-1 (Lee et al., 2007). Overexpression of FL-Lingo-1 has been shown to decrease the number of myelinating MBP+cells (Mi et al., 2005). It has been demonstrated that blocking Lingo-1 function could strengthen myelination (Mi et al., 2005, 2008; Jepson et al., 2012; Wu et al., 2013). In this study, we observed enhanced myelination in the LV/Lingo-1-shRNA treated groups, compared to the untreated group. The results show that Lingo-1 inhibition by RNA interference contributes to myelination/remyelination. The most significant myelination/remyelination was observed in the 5 × 108 TU/mL LV/Lingo-1-shRNA group. It is reasonable to infer that functional recovery may be associated with the promotion of myelination/remyelination after injecting LV/Lingo-1-shRNA in EAE.

In summary, our data showed that blocking Lingo-1 function in EAE mice by knocking down Lingo-1 expression can effectively improve motor function and promote remyelination. We also confirmed that lentiviral vector is a safe tool for gene therapy by virtue of stability, high specificity, and immune escape. It has been extensively used in clinical trials (Nielsen et al., 2009). Following the ICV injection, the therapeutic reagents rapidly diffuse in the CNS via cerebrospinal fluid circulation. ICV injection is an accepted drug delivery method in treating disseminated CNS diseases. Taken together, administering LV/Lingo-1-shRNA via ICV injection may be a promising treatment in EAE/MS.

Ancillary