SEARCH

SEARCH BY CITATION

Keywords:

  • ephrin-A3;
  • ephrin-A4;
  • angiogenesis;
  • brain microvascular endothelial cells;
  • microglia

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED

The association of microglia with brain vasculature during development and the reduced brain vascular complexity in microglia-deficient mice suggest the role of microglia in cerebrovascular angiogenesis. However, the underlying molecular mechanism remains unclear. Here, using an in vitro angiogenesis model, we found the culture supernatant of BV2 microglial cells significantly enhanced capillary-like tube formation and migration of brain microvascular endothelial cells (BMECs). The expression of angiogenic factors, ephrin-A3 and ephrin-A4, were specifically upregulated in BMECs exposed to BV2-derived culture supernatant. Knockdown of ephrin-A3 and ephrin-A4 in BMECs by siRNA significantly attenuated the enhanced angiogenesis and migration of BMECs induced by BV2 supernatant. Our further results indicated that the ability of BV2 supernatant to promote endothelial angiogenesis was caused by the soluble tumor necrosis factor α (TNF-α) released from BV2 microglial cells. Moreover, the upregulations of ephrin-A3 and ephrin-A4 in BMECs in response to BV2 supernatant were effectively abolished by neutralization antibody against TNF-α and TNF receptor 1, respectively. The present study provides evidence that microglia upregulates endothelial ephrin-A3 and ephrin-A4 to facilitate in vitro angiogenesis of brain endothelial cells, which is mediated by microglia-released TNF-α. Anat Rec, 297:1908–1918, 2014. © 2014 Wiley Periodicals, Inc.

Angiogenesis is the process that generating new blood vessels from pre-existing vascular networks by capillary sprouting (Weis and Cheresh, 2011; Marcelo et al., 2013). Angiogenesis is not only critical for embryogenesis and adult ovulation under physiological conditions, but also essential in many pathological processes such as wound healing, diabetic retinopathy, and tumorigenesis (Weis and Cheresh, 2011; Marcelo et al., 2013). Evidences suggest that angiogenesis is a multistep process involving endothelial cell migration and formation of lumen-containing tubular structures, regulated by the interactions between endothelial cells and perivascular supporting cells (Carmeliet and Jain, 2011; Weis and Cheresh, 2011).

In central nervous system (CNS), active angiogenesis has been demonstrated during brain development (Lee et al., 2009). Increased angiogenesis of brain microvessels was also associated with a variety of brain diseases such as infection, stroke, and neoplasia. At the microenvironment where angiogenesis occurs, there are multiple cell types including endothelial cells, pericytes, neurons, and glial cells, which as a whole are now recognized as a multi-cellular complex called neurovascular units (NVU) (Zlokovic, 2011; Drewes, 2012). The coordination of NVU implies the contribution of other cell types in NVU to the angiogenic process in brain. It has been shown that pericytes, which are closely associated with brain microvascular endothelial cells, play important roles in endothelial cell stimulation and guidance, as well as in endothelial maturation and stabilization (Ribatti et al., 2011; Sa-Pereira et al., 2012). Also, astrocytes are involved in the angiogenesis in developing retina and ischemia-induced retinal neovascularization (Scott et al., 2010; Weidemann et al., 2010; Hirota et al., 2011; Stenzel et al., 2011).

Microglia are bone marrow-derived macrophages in CNS and its role in pathological immune responses are clearly documented, whereas their crucial roles under physiological conditions were revealed until recently (Pont-Lezica et al., 2011). It was identified that microglia invade mouse brain early (E10.5) during embryonic development (Kierdorf et al., 2013). In brain parenchyma, the microglia were closely associated with blood microvessels (Grossmann et al., 2002; Arnold and Betsholtz, 2013). Moreover, in mice lacking microglia, Fantin et al. found the blood vessel intersections were reduced in the hindbrain (Fantin et al., 2010). These findings indicated the role of microglia in brain vascular angiogenesis; however, the involved molecular mechanism remains elusive.

Over the past decades, considerable progress has been obtained in elucidating the molecular mechanisms of vascular angiogenesis. VEGF family and angiopoietin/Tie2 family in angiogenesis have been studied extensively (Carmeliet and Jain, 2011). Recently, the importance of ephrin/Eph family in angiogenesis has been revealed in the literature. Ephrin/Eph family is the largest known subfamily of receptor tyrosine kinases, containing at least 8 ephrin ligands and 14 Eph receptors, both are anchored to the plasma membrane (Surawska et al., 2004). On the basis of sequence similarity and binding affinities, both ephrin ligands and Eph receptors are divided into two subclasses, A and B. The ephrin-A ligands are membrane-bound through glycosylphosphatidyl linkage, whereas ephrin-B ligands are anchored to the membrane via transmembrane domain. The stimulatory effect of ephrin-A ligands in vascular angiogenesis has been reported. Ephrin-A1 can promote in vitro vascular assembly of lung microvascular endothelial cells (Brantley-Sieders et al., 2004). Tube formation of RF/6A retina endothelial cells is enhanced by ephrin-A4 (Du et al., 2012).

In this study, we found that two angiogenic factors, ephrin-A3 and ephrin-A4, were simultaneously upregulated in brain endothelial cells treated with culture supernatant from microglial cells, which is required for the microglia-induced in vitro angiogenesis in brain endothelial cells.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED

Cells and Chemicals

Human brain microvascular endothelial cells (HBMECs) were a generous gift from Dr. Kwang Sik Kim (Johns Hopkins University School of Medicine, Baltimore, MD). They were cultured in RPMI 1640 medium, supplemented with 10% FBS (Gibco), 10% Nu-serum (BD Biosciences), 2 mM glutamine, 1 mM sodium pyruvate, 1 × nonessential amino acid, and 1 × MEM vitamin. BV2 microglial cell line was obtained from the American Type Culture Collection grown in DMEM (Gibco) containing 10% FBS. All cells were incubated at 37°C in a 5% CO2, 95% air humidified atmosphere.

After 48 h incubation, the culture medium of the BV2 cells was transferred into 15 mL tube and centrifuged at 1,000 rpm for 5 min. Then the supernatant was collected as BV2 supernatant for the further experiments.

Antimouse TNF-α neutralizing antibody (Goat anti-mouse, #AF-410-NA) and antihuman TNF receptor 1 (TNFR1) neutralizing antibody (Mouse antihuman, # MAB625) were from R&D Systems. Isotype mouse IgG and goat IgG were from Santa Cruz Biotech.

Capillary-Like Tube Formation Assay

HBMECs (2.5 × 104 cells/well) were seeded on a thin layer of Matrigel (BD Biosciences) in 24-well plates for 48 h. The images at indicated time points were acquired by an inverted microscope (Axiovert 40, Carl Zeiss, Germany) to measure the capillary-like structures. Tracks of endothelial cells organized into networks of cellular cords (tubes) were measured in randomly selected five microscopic fields (Rikitake et al., 2002). Three independent experiments were performed with each in triplicates.

Wound Healing Assay

Wound healing assay was performed as described previously (Zhou et al., 2011). In brief, HBMECs (5 × 104 cells/well) were seeded and grown to confluence in 6-well plates. After serum-starvation, the cells were wounded with a pipette tip to create a linear cell-free region. Detached cells were removed by washing twice with PBS. Then the media was added and the cells were returned to incubator. The progress of cell migration into the scratch was photographed at indicated time points using an inverted microscope (Axiovert 40). Results are presented as wound healing index which was calculated as follows: (Wound Area (initial) − Wound Area (final))/Wound area (initial). Data are from three independent experiments performed in duplicate.

Cell Proliferation Assay

The proliferation of HBMECs was determined by water-soluble tetrazolium salts (WST)−1 cell counting assay as described (Miyaji et al., 2005). Briefly, HBMECs (3 × 103 cells/well) were cultured in 96-well plates for the indicated times. Then WST-1 (10 μL/well) was added and the cells were incubated at 37°C for 4 h. Absorbance was read at 450 nm by microplate reader (Biotek).

Quantitative Real-Time Reverse Transcription (RT) PCR

Real-time RT-PCR was performed as previously described (Zhou et al., 2011). In brief, total RNA was extracted and reverse transcribed with M-MLV reverse transcriptase (Promega). Real-time RT-PCR was performed on ABI 7500 Real-time PCR system (Applied BioSystems) with SYBR Premix Ex Taq (TaKaRa Bio) according to manufacturer's instructions. The amplification conditions were as follows: 95°C for 10 s and 40 cycles of 95°C for 5 s and 60°C for 34 s. Each sample was tested in triplicate and the PCR products were verified by DNA sequencing. Results from three independent experiments were used to calculate relative gene expression with 2−ΔΔCT method. The mRNA expression of the target gene was normalized to GAPDH. All the PCR primers for the amplifications in BV2 microglial cells and HBMECs are listed in Tables 1 and 2.

Table 1. Real-time RT-PCR primers for BV2 microglial cells
Target geneAmplicon length (bp)Oligonucletide sequence, 5′–3′, forward, reverseTm (°C)Genbank accession no.
GAPDH127AGGTCGGTGTGAACGGATTTG60.0NM_008084
TGTAGACCATGTAGTTGAGGTCA58.4
PDGF-A61GAGGAAGCCGAGATACCCC61.9NM_008808
TGCTGTGGATCTGACTTCGAG60.0
PDGF-B155AAGTGTGAGACAGTAGTGACCCC62.0NM_011057
CATGGGTGTGCTTAAACTTTCG58.2
VEGF-A193CGGGCCTCGGTTCCAG61.8NM_001025250
CTGGGACCACTTGGCATGG61.9
TNF-α148CCTGTAGCCCACGTCGTAG61.9NM_013693
GGGAGTAGACAAGGTACAACCC61.9
EPO123ACTCTCCTTGCTACTGATTCCT58.2NM_007942
ATCGTGACATTTTCTGCCTCC58.0
ANGPT1109CACATAGGGTGCAGCAACCA59.8NM_009640
CGTCGTGTTCTGGAAGAATGA58.0
IL-6131CTGCAAGAGACTTCCATCCAG60.0NM_031168
AGTGGTATAGACAGGTCTGTTGG60.2
Table 2. Real-time RT-PCR primers for HBMECs
Target geneAmplicon length (bp)Oligonucletide sequence, 5′–3′, forward, reverseTm (°C)Genbank accession no.
GAPDH102AAGGTGAAGGTCGGAGTCAAC58.1NM_002046
GGGGTCATTGATGGCAACAATA62.1
ephrin-A179TCAGGCCCATGACAATCCAC59.9NM_004428
GTGACCGATGCTATGTAGAACC60.1
ephrin-A289ATCTCTGCCACGCCTCCCAATG63.8NM_001405
GCCTCGTACAGGGTCTCGTTGGTC67.1
ephrin-A380CATGCGGTGTACTGGAACAG56.9NM_004952
AGATAGTCGTTCACGTTCACCT55.7
ephrin-A483GGCCTCAACGATTACCTAGACA58.8NM_005227
TACAAAGCAAACGTCTCGGGG60.0
ephrin-A5143TCCAGAGGGGTGACTACCATA56.8NM_001962
GCAGGCACTGTAGCCATCAAA60.0
VEGF-A184TGGTCCCAGGCTGCACCCAT67.7NM_001171623
CGCATCGCATCAGGGGCACA70.3

Western Blot

Western blots were performed as previously described (Liu et al., 2012). Briefly, the cells were washed twice with ice-cold PBS and prepared with radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris–HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecylsulfate) containing protease inhibitor cocktail (Roche). Protein concentration of cell lysate was determined by BCA protein assay kit (Sangon Biotech). The samples were subjected to 11% SDS–PAGE and then transferred to PVDF membrane (Millipore). The PVDF membrane was blocked with 5% nonfat milk and incubated with antibody recognizing ephrin-A3 (1:1,000, Abcam), ephrin-A4 (1:1,000, Abcam) and GAPDH (1:5,000, Santa Cruz Biotech.), respectively, at 4°C overnight. Then, the blots were incubated with HRP-conjugated secondary antibody (1:10,000, Santa Cruz Biotech) for 1 h at room temperature and detected by Super Signal West Pico Chemiluminescent Substrate (Pierce) using LAS3000mini (Fuji Film).

Transfection of Small Interfering RNA (siRNA)

The siRNA targeting human ephrin-A3 (GCTTGAGAAGAGCATCAGC) and ephrin-A4 (ACCTCAACGATTACCTAGACAT) were synthesized by GenePharma. The siRNA was transfected into HBMECs using Lipofectamine 2000 (Invitrogen) following manufacturer's instructions. Nonsilencing siRNA (TTCTCCGAACGTGTCACGT) (Zhao et al., 2010) was used as control. Protein expression of target gene was measured by western blot at 48 h after transfection.

ELISA

Culture supernatant were collected from BV2 microglial cells and the concentrations of indicated cytokines were quantified with ELISA kits for mouse TNF-α, VEGF-A, PDGF-A, and PDGF-B (Uscnk) according to manufacturer's instructions. Absorbance was read at 450 nm by microplate reader (Biotek). All samples were analyzed in triplicate.

Statistical Analyses

Statistical significance between two groups was analyzed by Mann–Whitney test. Differences were considered statistically significant when P < 0.05.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED

Culture Supernatant from Microglial Cells Enhances In Vitro Angiogenesis of Brain Endothelial Cells

To evaluate the effect of microglia on the angiogenesis of brain endothelial cells, an in vitro angiogenesis model was established. That is, HBMECs seeded on a thin layer of Matrigel were incubated with the culture supernatant derived from BV2 microglial cells, followed by capillary-like tube formation assay. The results showed that, at 24 and 48 h after seeding, the forming of tubular structures in HBMECs treated with the BV2 supernatant were more obvious than that in the control group (Fig. 1A). Also, the tubular structures in HBMECs treated with BV2 supernatant were more organized than those in control (Fig. 1A). Quantitative analysis revealed that BV2 supernatant enhanced the tube formation of HBMECs as compared with control, which is statistically significant at 24 and 48 h after seeding (Fig. 1B). Given that the endothelial cell migration is an essential step in the process of vascular angiogenesis, migration ability of HBMECs incubated with the culture supernatant from BV2 microglial cells was analyzed by wound healing assay. The results showed that BV2 supernatant significantly promoted migration of HBMECs, which is statistically significant at 24 and 48 h after seeding (Fig. 1C,D). Cell proliferation assay revealed the inhibitory effect of BV2 supernatant on HBMECs proliferation (Fig. 1E), suggesting that the proangiogenic effects of BV2 supernatant are due to the induction of endothelial cell motility rather than proliferation.

image

Figure 1. Culture supernatant of BV2 microglial cells promoted migration and angiogenesis of HBMECs without affecting proliferation. (A) HBMECs were seeded on Matrigel and incubated with culture supernatant of BV2 microglial cells, with DMEM containing 10% FBS as control. The cells were allowed to undergo capillary-like tube formation and the images were captured at indicated time points. (B) Then the formed tubular structures were quantified as described in the Materials and Methods section. (C and D) HBMECs were cultured in 6-well plates and a scratch wound was made after serum starvation. The detached cells were removed followed by further incubation in BV2 supernatant, with DMEM containing 1% FBS as control. Wound closures were photographed immediately after wounding (0 h) or at indicated times after wounding, and the results were quantified as described in Materials and Methods section. (E) Effect of BV2 supernatant on the cell proliferation of HBMECs, with DMEM containing 10% FBS as control. Data were means ± standard deviation (SD) of three independent experiments. Scale bar, 50 µm. *P < 0.05, **P < 0.01.

Download figure to PowerPoint

Ephrin-A3 and Ephrin-A4 Are Increased in Brain Endothelial Cells Exposed to Microglial Culture Supernatant

Then we attempted to identify the angiogenic factors in brain endothelial cells that were involved in the enhanced angiogenesis induced by the culture supernatant of BV2 microglial cells. First, the mRNA expression of VEGF-A, which is a soluble growth factor well known for its angiogenic activity (Hoeben et al., 2004), was examined by real-time RT-PCR. The results showed that, compared with control, the mRNA transcript of VEGF-A was not affected in HBMECs treated with BV2 supernatant (Fig. 2A). Then we tried to assess the mRNA levels of ephrin-As, which are involved in regulating vascular development and tumor angiogenesis (Surawska et al., 2004). The results revealed a differential pattern of ephrin-As expression in HBMECs exposed to BV2 supernatant. Among the 5 ephrin-As detected, the mRNA expression of ephrin-A3 and ephrin-A4 were significantly increased in HBMECs treated with BV2 supernatant (Fig. 2D,E). Both ephrin-A3 and ephrin-A4 experienced a time-dependent increase. The mRNA levels of ephrin-A3 and ephrin-A4 began to rise at 4 h after the treatment, and remained increased up to 12 h. In contrast, the expression of ephrin-A2 and ephrin-A5 were barely affected (Fig. 2C,F). In addition, the mRNA expression of ephrin-A1 was reduced in HBMECs treated with BV2 supernatant (Fig. 2B).

image

Figure 2. Ephrin-A3 and ephrin-A4 were significantly increased in HBMECs treated with BV2 culture supernatant. HBMECs were incubated with BV2 supernatant for indicated times, and the total RNA were extracted. Then real-time RT-PCR was performed to analyze the mRNA expression of VEGF-A (A), ephrin-A1 (B), ephrin-A2 (C), ephrin-A3 (D), ephrin-A4 (E) and ephrin-A5 (F) in HBMECs. The HBMECs incubated with DMEM containing 10% FBS were used as control. The mRNA expression levels were normalized to GAPDH. Data are means ± SD of three independent experiments.* P < 0.05, ** P < 0.01.

Download figure to PowerPoint

Knockdown of Ephrin-A3 and Ephrin-A4 Prevents the Microglia-Induced Brain Endothelial Angiogenesis

To evaluate the roles of ephrin-A3 and ephrin-A4 in microglia-induced angiogenesis in brain endothelial cells, loss-of-function experiments were performed with siRNAs against ephrin-A3 and ephrin-A4, with nonsilencing siRNA served as control. The knockdown effect in HBMECs transfected with siRNA was examined by western blot. The results showed that the endogenous ephrin-A3 and ephrin-A4 in HBMECs was effectively reduced by specific siRNA, respectively (Fig. 3A). Then we performed in vitro angiogenesis assay in the presence of BV2 supernatant using HBMECs transfected with siRNAs targeting ephrin-A3, ephrin-A4, or both. The results revealed that the BV2 supernatant-induced tube formation of HBMECs was efficiently prevented by knockdown of endothelial ephrin-A3 and ephrin-A4, respectively (Fig. 3B,C). Interestingly, the combined knockdown of both ephrin-A3 and ephrin-A4 had no additive effect on microglia-induced tube formation as compared to knockdown of ephrin-A3 or ephrin-A4 alone (Fig. 3B,C). Similarly, the BV2 supernatant-induced HBMECs migration was slowed down by knockdown of ephrin-A3, ephrin-A4, or both (Fig. 3D,E). Also, combined knockdown of both ephrin-A3 and ephrin-A4 in HBMECs had no additional effect on microglia-induced migration (Fig. 3D,E). In contrast, knockdown of ephrin-A3 and/or ephrin-A4 did not affect the proliferation kinetics of HBMECs (Fig. 3F). These data indicated that the increased ephrin-A3 and ephrin-A4 in brain endothelial cells were required for the enhanced angiogenesis and migration induced by microglial supernatant.

image

Figure 3. Microglia-induced brain endothelial angiogenesis was prevented by knockdown of ephrin-A3 and/or ephrin-A4. (A) HBMECs were transiently transfected with ephrin-A3 or ephrin-A4 siRNA, respectively, for 48 h. Then the protein expression of ephrin-A3 and ephrin-A4 were analyzed by western blot, with GAPDH as a loading control. (B and C) HBMECs were transfected with ephrin-A3 siRNA, ephrin-A4 siRNA, or ephrin-A3 siRNA together with ephrin-A4 siRNA. After 48 h, the cells were subjected to capillary-like tube formation assay. The normal HBMECs (control) and nonsilencing siRNA transfected HBMECs (NC siRNA) were used as controls. (D and E) HBMECs were transfected with ephrin-A3 siRNA, ephrin-A4 siRNA, or ephrin-A3 and ephrin-A4 siRNA together. 48 h later, the cells were subjected to wound healing assay. (F) HBMECs were transfected with ephrin-A3 siRNA, ephrin-A4 siRNA, or ephrin-A3 and ephrin-A4 siRNA together, for 48 h. Then the cells were used for proliferation assay. Values are means ± SD of three independent experiments. Scale bar, 50 µm. * P < 0.05, ** P < 0.01.

Download figure to PowerPoint

Microglia-Induced Brain Endothelial Angiogenesis is Attributed to Microglia-Derived TNF-α

The effects of BV2 supernatant on migration and angiogenesis of HBMECs implicated the involvement of microglia-produced soluble factors. To identify the potential microglia-derived factors, which may contribute to the effect of microglia on brain endothelial angiogenesis, the expression profile of several releasable angiogenic factors in BV2 microglial cells was examined by real-time RT-PCR. As shown in Fig. 4A, the mRNA transcripts of PDGF, VEGF, TNF-α, EPO, ANGPT1, and IL-6 were detected in BV2 cells. We found TNF-α was the most highly expressed of the 6 genes. In contrast, the Ct-values of EPO, ANGPT1, and IL-6 were above 32, reflecting a very low level of expression. Then ELISA assay was utilized to measure the secretion of PDGF, VEGF, and TNF-α in the supernatant of cultured BV2 microglial cells. We found there was a very high concentration of TNF-α (540 ± 78 pg/mL) in BV2 supernatant, which was about 5-folds greater than that of VEGF and 10-folds more than that of PDGF (Fig. 4B).

image

Figure 4. Microglia-induced brain endothelial angiogenesis was caused by microglia-produced TNF-α. (A) Total RNA of BV2 microglial cells was extracted, and the mRNA expression of PDGF-A, PDGF-B, VEGF-A, TNF-α, EPO, ANGPT1, and IL-6 were examined by real-time RT-PCR and normalized to GAPDH. (B) The presences of PDGF-A, PDGF-B, VEGF-A, and TNF-α in the supernatant of BV2 microglial cells were determined by ELISA. (C and D) HBMECs was subjected to capillary-like tube formation in the presence of BV2 supernatant containing antimouse TNF-α neutralization antibody (anti-TNF-α, 1 μg/mL), with BV2 supernatant containing isotype IgG served as control. The formed tubes were quantified as described in the Materials and Methods section. (E and F) Capillary-like tube formation was performed with HBMECs treated with BV2 supernatant containing antihuman TNFR1 antibody (anti-TNFR1, 5 μg/mL), with isotype IgG as control. Data were means ± SD of three independent experiments. Scale bar, 50 µm. * P < 0.05.

Download figure to PowerPoint

Actually the stimulatory effect of TNF-α on angiogenesis has been demonstrated in previous studies (Frater-Schroder et al., 1987; Fajardo et al., 1992). We also found that recombinant TNF-α could promote the migration and angiogenesis of HBMECs (data not shown). To determine whether the TNF-α derived from BV2 supernatant was associated with the microglia-induced angiogenesis of HBMECs, antibody against TNF-α was applied to BV2 supernatant to block the activity of TNF-α, followed by capillary-like tube formation assay. Given that BV2 cells are murine microglial cell line, antimouse TNF-α neutralizing antibody was chose to neutralize the TNF-α in BV2 supernatant. According to manufacturer's instructions, this TNF-α neutralizing antibody has less than 1% cross-reactivity with human TNF-α. Our results showed that, compared to the isotype IgG, application of antimouse TNF-α neutralizing antibody significantly attenuated the tube formation of HBMECs induced by BV2 supernatant (Fig. 4C,D).

It is well known that the activity of TNF-α is mediated by its binding with the membrane-anchored TNF-α receptor (TNFR) (Croft et al., 2013). Bossen et al.'s study demonstrated that mouse TNF-α bound to human TNFR with similar affinity as compared to its binding with mouse TNFR (Bossen et al., 2006). Thus, from the findings we obtained, it is reasonable to propose that the murine TNF-α in BV supernatant bound with TNFR on HBMECs leading to the enhanced angiogenesis. To verify this possibility, we proceeded to test whether the enhancing effect of BV2 supernatant on HBMECs angiogenesis could be attenuated when the TNFR on HBMECs was blocked by specific neutralizing antibody. Studies have shown that signaling events induced by TNF-α in endothelial cells, as well as in other cell types, are primarily dependent on the interaction of TNF-α with TNF-α receptor 1 (TNFR1) (Chainy et al., 1996; Al-Lamki et al., 2005; Wang et al., 2011). Here, therefore, monoclonal antihuman TNFR1 neutralizing antibody was used to block the TNFR1 expressed on HBMECs. We found the BV2 supernatant-induced angiogenesis in HBMECs was significantly reduced in the presence of TNFR1 antibody (Fig. 4E,F). These results demonstrated that microglial cells released TNF-α to bind with TNFR1 receptor on brain endothelial cells, leading to the enhanced brain endothelial angiogenesis.

Microglia-Induced Upregulations of Ephrin-A3 and Ephrin-A4 Are Abolished by TNF-α and TNFR1 Neutralizing Antibody

In an attempt to determine whether the upregulated ephrin-A3 and ephrin-A4 were associated with the TNF-α present in BV2 supernatant, HBMECs were incubated with BV2 supernatant containing antimouse TNF-α neutralizing antibody and the mRNA transcripts of ephrin-A3 and ephrin-A4 in HBMECs were analyzed by real-time RT-PCR. The results showed that the increased mRNA expression of ephrin-A3 and ephrin-A4 in HBMECs were significantly attenuated by neutralization of BV2 supernatant with TNF-α antibody (Fig. 5A). Moreover, western blot analysis showed that the protein levels of ephrin-A3 and ephrin-A4 in HBMECs treated with BV2 supernatant were significantly increased, and this increase was effectively attenuated by the neutralizing antibody against TNF-α (Fig. 5B). We also found that, the BV2 supernatant-induced upregulations of ephrin-A3 and ephrin-A4 in HBMECs were effectively blocked by neutralization of TNFR1 receptor on HBMECs with the antihuman TNFR1 antibody (Fig. 5C,D). These data indicated that the microglia-induced upregulations of endothelial ephrin-A3 and ephrin-A4 were caused by the interaction between microglia-released TNF-α and TNFR1 receptor on brain endothelial cells.

image

Figure 5. Microglia-induced ephrin-A3 and ephrin-A4 upregulations were abolished by neutralizing antibody against TNF-α and TNFR1. HBMECs were incubated in BV2 supernatant containing antimouse TNF-α neutralizing antibody (1 μg/mL) and the expression of ephrin-A3 and ephrin-A4 were analyzed by real-time RT-PCR (A) and western blot (B). HBMECs were incubated in BV2 supernatant containing antihuman TNFR1 neutralizing antibody (5 μg/mL) and the expression of ephrin-A3 and ephrin-A4 were analyzed by real-time RT-PCR (C) and western blot (D). The HBMECs incubated with BV2 supernatant containing isotype IgG were served as control. All the bands densities in western blots were quantified by ImageJ (National Institutes of Health, Bethesda, MD). Values are means ± SD of three independent experiments. Scale bar, 50 µm. * P < 0.05, ** P < 0.01.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED

The important role of microglia in brain angiogenesis was recently identified by Fantin et al. utilizing microglia-deficient mice (Fantin et al., 2010). Nevertheless, in their efforts to explore the involved mechanism, the obtained evidence only argued against the involvement of VEGF in microglia-mediated vessel fusion during developmental brain angiogenesis, thus the mechanism underlying microglia-induced brain vascular angiogenesis remained to be determined. In this study, using an in vitro angiogenesis model, we found the culture supernatant derived from microglial cells promoted in vitro migration and angiogenesis of brain endothelial cells. Our results demonstrated that ephrin-A3 and ephrin-A4, but not VEGF, in brain endothelial cells were specifically upregulated by microglia, which is necessary for the microglia-induced angiogenesis.

We found that the microglia-induced brain endothelial angiogenesis was effectively prevented by knockdown of endogenous ephrin-A3 and ephrin-A4, respectively. Interestingly, there was no additive effect after simultaneous knockdown of ephrin-A3 and ephrin-A4 in brain endothelial cells (Fig. 3B–E), indicating that ephrin-A3 and ephrin-A4 act in the same pathway. It was thought that ephrin-A3 and ephrin-A4 ligands could bind with the same receptor, EphA2, respectively (Surawska et al., 2004). The role of EphA2 receptor in promoting endothelial cell migration and angiogenesis reported in our lab (Zhou et al., 2011) and in other research group (Brantley-Sieders et al., 2004; Sainz-Jaspeado et al., 2013), allowed us to infer that microglia could upregulate endothelial ephrin-A3 and ephrin-A4, which coordinately interact with EphA2 receptor on brain endothelial cells, resulting in augmented endothelial angiogenesis. It should be mentioned that ephrin-A1 in brain endothelial cells was decreased in response to microglial supernatant treatment (Fig. 2B). Given that the precise effect of ephrin-A1 on angiogenesis remained controversial (Surawska et al., 2004; Ojima et al., 2006), it will be interesting to clarify the exact roles of ephrin-A1 in microglia-induced angiogenesis.

In our study, the culture supernatant derived from microglia enhanced angiogenesis in brain endothelial cells. It has been reported that mouse EOC2 microglial cells stimulated vessel sprouting and branching in aortic ring cultures in the absence of a direct contact (Rymo et al., 2011), which is consistent with our findings. The facilitating effect of microglial supernatant on brain endothelial angiogenesis pointed out the existence of soluble angiogenic factors released from microglia. Our further results identified high level of TNF-α in microglial supernatant. The promoting effect of recombinant TNF-α on migration and angiogenesis of HBMECs was observed (data not shown), which is in line with the angiogenic potential of TNF-α (Fajardo et al., 1992). Moreover, the microglial supernatant-induced angiogenesis of HBMECs was effectively blocked by the neutralizing antibody against mouse TNF-α and human TNF receptor (TNFR1), respectively. These data indicated that TNF-α, released from murine BV2 microglial cells, bound with TNFR1 receptor on human brain endothelial cells to promote the endothelial angiogenesis. Our results, together with the inability of VEGF in microglia-induced angiogenesis in brain (Fantin et al., 2010), as well as the evidence against the involvement of VEGF-A in microglia-stimulated angiogenesis in an aortic ring model (Rymo et al., 2011), indicated that microglia-derived TNF-α, rather than VEGF, plays a critical role in microglia-induced brain endothelial angiogenesis.

The molecular links between TNF-α and ephrin-As remain unclear because of limited number of studies. In our study, TNF-α of microglial cells promoted transcription of ephrin-A3/4 in brain endothelial cells, leading to increased levels of ephrin-A3/4 protein. A previous study indicated that TNF-α could induce expression of ephrin-A1 in endothelial cells, which is mediated by JNK and p38-MAPK signaling pathway (Cheng and Chen, 2001). These studies suggested exogenous TNF-α could regulate ephrin-As expression through intracellular signaling. In contrast, a recent study found that TNFR1, directly interacts with EphA7 receptor upon stimulation with ephrin-A5, the ligand of EphA7, forming a three-protein complex (Lee et al., 2013). Also, the induction of cell apoptosis by ephrin-A5 (Yue et al., 1999; Depaepe et al., 2005; Lee et al., 2013; Park et al., 2013) is in line with the pro-apoptotic effect of TNF-α (Aggarwal, 2003). Thus, the physical association of TNFR1 with EphA7 and the functional similarity between their ligands suggested that TNF-α may directly affect the signaling responses to ephrin-A5 via the membrane-anchored TNFR1-EphA7 complex. Do these observations imply that TNF-α could regulate ephrin-As activity through both intracellular signaling and membrane-bound receptors? This is an interesting question needs to be addressed in future studies.

Our analysis revealed that endothelial ephrin-A3/4 protein was significantly increased at 4 and 8 h after BV2 supernatant treatment (Fig. 5B,D). Also, this increase was significantly attenuated by neutralizing antibody against TNF-α and TNFR1, respectively (Fig. 5B,D). These data were consistent with the realtime RT-PCR results (Fig. 5A,C). In contrast, at 12 h post-treatment, the ephrin-A3/4 protein was only slightly increased, without statistical significance. Thus the decrease of ephrin-A3/4 protein at 12 h in response to the neutralizing antibody was not obvious compare to that at 4 and 8 h time point. This discrepancy between mRNA and protein changes at 12 h post-treatment, but not earlier, suggested a translational regulation of endothelial ephrin-A3/4 at the later stages of BV2-supernatant treatment. It is thus suggested that ephrin-A3/4 is primarily involved in the early steps of microglia-induced angiogenesis.

Apart from the stimulatory effect on endothelial migration and angiogenesis, we found microglial supernatant suppressed the growth of brain endothelial cells (Fig. 1E), which was not likely caused by the TNF-α in microglial supernatant because recombinant TNF-α had no obvious effect on endothelial proliferation (data not shown). We thought this inhibitory effect of microglial supernatant on the proliferation of brain endothelial cells was associated with the presence of proliferation inhibitory cytokines, rather than TNF-α, in the microglial supernatant. In consistent with our results, it had been reported that endothelial proliferation was reduce by the supernatant derived from resting microglia, which was partially due to TGF-β1, but not TNF-α (Welser et al., 2010).

In summary, our data provides a novel mechanism for microglia-induced angiogenesis, that is, microglial cells upregulate angiogenic factors ephrin-A3 and ephrin-A4 in brain endothelial cells, which is mediated by microglia-released TNF-α, to promote angiogenesis of brain endothelial cells. Further study is required to investigate the ephrin-A3/4 initiated intracellular signaling pathways in brain endothelial cells. In addition, the expression of ephrin-A3 and ephrin-A4 in mouse brain microvessels was recently identified in our lab (data not shown), thus it will be interesting to explore the in vivo significance of ephrin-A3/4 in microglia-induced brain vascular angiogenesis.

ACKNOWLEDGEMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED

The authors are grateful to Drs. Monique Stins and Kwang Sik Kim (Department of Pediatrics, John Hopkins University School of Medicine) for providing HBMECs.

LITERATURE CITED

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGEMENTS
  7. LITERATURE CITED
  • Aggarwal BB. 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 3:745756.
  • Al-Lamki RS, Wang J, Vandenabeele P, Bradley JA, Thiru S, Luo D, Min W, Pober JS, Bradley JR. 2005. TNFR1- and TNFR2-mediated signaling pathways in human kidney are cell type-specific and differentially contribute to renal injury. FASEB J 19:16371645.
  • Arnold T, Betsholtz C. 2013. The importance of microglia in the development of the vasculature in the central nervous system. Vasc Cell 5:4.
  • Bossen C, Ingold K, Tardivel A, Bodmer JL, Gaide O, Hertig S, Ambrose C, Tschopp J, Schneider P. 2006. Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J Biol Chem 281:1396413971.
  • Brantley-Sieders DM, Caughron J, Hicks D, Pozzi A, Ruiz JC, Chen J. 2004. EphA2 receptor tyrosine kinase regulates endothelial cell migration and vascular assembly through phosphoinositide 3-kinase-mediated Rac1 GTPase activation. J Cell Sci 117:20372049.
  • Carmeliet P, Jain RK. 2011. Molecular mechanisms and clinical applications of angiogenesis. Nature 473:298307.
  • Chainy GB, Singh S, Raju U, Aggarwal BB. 1996. Differential activation of the nuclear factor-kappa B by TNF muteins specific for the p60 and p80 TNF receptors. J Immunol 157:24102417.
  • Cheng N, Chen J. 2001. Tumor necrosis factor-alpha induction of endothelial ephrin A1 expression is mediated by a p38 MAPK- and SAPK/JNK-dependent but nuclear factor-kappa B-independent mechanism. J Biol Chem 276:1377113777.
  • Croft M, Benedict CA, Ware CF. 2013. Clinical targeting of the TNF and TNFR superfamilies. Nat Rev Drug Discov 12:147168.
  • Depaepe V, Suarez-Gonzalez N, Dufour A, Passante L, Gorski JA, Jones KR, Ledent C, Vanderhaeghen P. 2005. Ephrin signalling controls brain size by regulating apoptosis of neural progenitors. Nature 435:12441250.
  • Drewes LR. 2012. Making connexons in the neurovascular unit. J Cereb Blood Flow Metab 32:14551456.
  • Du W, Yu W, Huang L, Zhao M, Li X. 2012. Ephrin-a4 is involved in retinal neovascularization by regulating the VEGF signaling pathway. Invest Ophthalmol Vis Sci 53:19901998.
  • Fajardo LF, Kwan HH, Kowalski J, Prionas SD, Allison AC. 1992. Dual role of tumor necrosis factor-alpha in angiogenesis. Am J Pathol 140:539544.
  • Fantin A, Vieira JM, Gestri G, Denti L, Schwarz Q, Prykhozhij S, Peri F, Wilson SW, Ruhrberg C. 2010. Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction. Blood 116:829840.
  • Frater-Schroder M, Risau W, Hallmann R, Gautschi P, Bohlen P. 1987. Tumor necrosis factor type alpha, a potent inhibitor of endothelial cell growth in vitro, is angiogenic in vivo. Proc Natl Acad Sci U S A 84:52775281.
  • Grossmann R, Stence N, Carr J, Fuller L, Waite M, Dailey ME. 2002. Juxtavascular microglia migrate along brain microvessels following activation during early postnatal development. Glia 37:229240.
  • Hirota S, Liu Q, Lee HS, Hossain MG, Lacy-Hulbert A, McCarty JH. 2011. The astrocyte-expressed integrin alphavbeta8 governs blood vessel sprouting in the developing retina. Development 138:51575166.
  • Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. 2004. Vascular endothelial growth factor and angiogenesis. Pharmacol Rev 56:549580.
  • Kierdorf K, Erny D, Goldmann T, Sander V, Schulz C, Perdiguero EG, Wieghofer P, Heinrich A, Riemke P, Holscher C, Muller DN, Luckow B, Brocker T, Debowski K, Fritz G, Opdenakker G, Diefenbach A, Biber K, Heikenwalder M, Geissmann F, Rosenbauer F, Prinz M. 2013. Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nat Neurosci 16:273280.
  • Lee H, Park E, Kim Y, Park S. 2013. EphrinA5-EphA7 complex induces apoptotic cell death via TNFR1. Mol Cells 35:450455.
  • Lee HS, Han J, Bai HJ, Kim KW. 2009. Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface. FEBS J 276:46224635.
  • Liu D-X, Zhao W-D, Fang W-G, Chen Y-H. 2012. cPLA2α-mediated actin rearrangements downstream of the Akt signaling is required for Cronobacter sakazakii invasion into brain endothelial cells. Biochem Biophys Res Commun 417:925930.
  • Marcelo KL, Goldie LC, Hirschi KK. 2013. Regulation of endothelial cell differentiation and specification. Circ Res 112:12721287.
  • Miyaji M, Jin ZX, Yamaoka S, Amakawa R, Fukuhara S, Sato SB, Kobayashi T, Domae N, Mimori T, Bloom ET, Okazaki T, Umehara H. 2005. Role of membrane sphingomyelin and ceramide in platform formation for Fas-mediated apoptosis. J Exp Med 202:249259.
  • Ojima T, Takagi H, Suzuma K, Oh H, Suzuma I, Ohashi H, Watanabe D, Suganami E, Murakami T, Kurimoto M, Honda Y, Yoshimura N. 2006. EphrinA1 inhibits vascular endothelial growth factor-induced intracellular signaling and suppresses retinal neovascularization and blood-retinal barrier breakdown. Am J Pathol 168:331339.
  • Park E, Kim Y, Noh H, Lee H, Yoo S, Park S. 2013. EphA/ephrin-A signaling is critically involved in region-specific apoptosis during early brain development. Cell Death Differ 20:169180.
  • Pont-Lezica L, Béchade C, Belarif-Cantaut Y, Pascual O, Bessis A. 2011. Physiological roles of microglia during development. J Neurochem 119:901908.
  • Ribatti D, Nico B, Crivellato E. 2011. The role of pericytes in angiogenesis. Int J Dev Biol 55:261268.
  • Rikitake Y, Hirata K, Kawashima S, Ozaki M, Takahashi T, Ogawa W, Inoue N, Yokoyama M. 2002. Involvement of endothelial nitric oxide in sphingosine-1-phosphate-induced angiogenesis. Arterioscler Thromb Vasc Biol 22:108114.
  • Rymo SF, Gerhardt H, Wolfhagen Sand F, Lang R, Uv A, Betsholtz C. 2011. A two-way communication between microglial cells and angiogenic sprouts regulates angiogenesis in aortic ring cultures. PloS One 6:e15846.
  • Sa-Pereira I, Brites D, Brito MA. 2012. Neurovascular unit: a focus on pericytes. Mol Neurobiol 45:327347.
  • Sainz-Jaspeado M, Huertas-Martinez J, Lagares-Tena L, Martin Liberal J, Mateo-Lozano S, de Alava E, de Torres C, Mora J, Del Muro XG, Tirado OM. 2013. EphA2-induced angiogenesis in ewing sarcoma cells works through bFGF production and is dependent on Caveolin-1. Plos One 8:e71449.
  • Scott A, Powner MB, Gandhi P, Clarkin C, Gutmann DH, Johnson RS, Ferrara N, Fruttiger M. 2010. Astrocyte-derived vascular endothelial growth factor stabilizes vessels in the developing retinal vasculature. Plos One 5:e11863.
  • Stenzel D, Lundkvist A, Sauvaget D, Busse M, Graupera M, van der Flier A, Wijelath ES, Murray J, Sobel M, Costell M, Takahashi S, Fassler R, Yamaguchi Y, Gutmann DH, Hynes RO, Gerhardt H. 2011. Integrin-dependent and -independent functions of astrocytic fibronectin in retinal angiogenesis. Development 138:44514463.
  • Surawska H, Ma PC, Salgia R. 2004. The role of ephrins and Eph receptors in cancer. Cytokine Growth Factor Rev 15:419433.
  • Wang L, Chopp M, Teng H, Bolz M, Francisco MA, Aluigi DM, Wang XL, Zhang RL, Chrsitensen S, Sager TN, Szalad A, Zhang ZG. 2011. Tumor necrosis factor alpha primes cerebral endothelial cells for erythropoietin-induced angiogenesis. J Cereb Blood Flow Metab 31:640647.
  • Weidemann A, Krohne TU, Aguilar E, Kurihara T, Takeda N, Dorrell MI, Simon MC, Haase VH, Friedlander M, Johnson RS. 2010. Astrocyte hypoxic response is essential for pathological but not developmental angiogenesis of the retina. Glia 58:11771185.
  • Weis SM, Cheresh DA. 2011. Tumor angiogenesis: molecular pathways and therapeutic targets. Nat Med 17:13591370.
  • Welser JV, Li L, Milner R. 2010. Microglial activation state exerts a biphasic influence on brain endothelial cell proliferation by regulating the balance of TNF and TGF-beta1. J Neuroinflammation 7:89.
  • Yue Y, Su J, Cerretti DP, Fox GM, Jing S, Zhou R. 1999. Selective inhibition of spinal cord neurite outgrowth and cell survival by the Eph family ligand Ephrin-A5. J Neurosci 19:1002610035.
  • Zhao WD, Liu W, Fang WG, Kim KS, Chen YH. 2010. Vascular endothelial growth factor receptor 1 contributes to Escherichia coli K1 invasion of human brain microvascular endothelial cells through the phosphatidylinositol 3-kinase/Akt signaling pathway. Infect Immun 78:48094816.
  • Zhou N, Zhao W-D, Liu D-X, Liang Y, Fang W-G, Li B, Chen Y-H. 2011. Inactivation of EphA2 promotes tight junction formation and impairs angiogenesis in brain endothelial cells. Microvasc Res 82:113121.
  • Zlokovic BV. 2011. Neurovascular pathways to neurodegeneration in Alzheimer's disease and other disorders. Nat Rev Neurosci 12:723738.