SEARCH

SEARCH BY CITATION

Keywords:

  • miRNA;
  • gastric carcinoma;
  • cell cycle;
  • cell growth

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED

MicroRNAs (miRNAs) are the class of small noncoding RNAs, and play an important role in the regulation of gene expression at the posttranscriptional level. In this study, we explored the effect of miR-129-1-3p on the growth and cell cycle of human gastric cancer cell line BGC-823. The miR-129-1-3p mimics or inhibitors were transfected into the BGC-823 cell line, and the cell cycle and cell growth was measured by flow cytometry and real-time cell analyzer, respectively. The possible targets of miR-129-1-3p were analyzed by quantitative real time-PCR (QRT-PCR), Western blotting and Luciferase reporter assay. The results showed that miR-129-1-3p could promote the growth and cell cycle of BGC-823 cells. Although protein expression of programmed cell death 2 (PDCD2) was not changed with miR-129-1-3p, QRT-PCR showed that expression of PDCD2 mRNA was negatively related to the miR-129-1-3p. Luciferase reporter assay revealed that PDCD2 is one of the targets of miR-129-1-3p. Our results indicated that miR-129-1-3p might promote proliferation of BGC-823 cells by targeting PDCD2. Anat Rec, 297:2273–2279, 2014. © 2014 Wiley Periodicals, Inc.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED

Gastric carcinoma is one of the most leading causes of death in the world (Cho, 2013). Although the survival time of patients with early gastric carcinoma has been greatly extended with improved diagnostic and therapeutic technologies, the prospects for the treatment of patients with advanced gastric carcinoma are not optimistic (Xu et al., 2013). Surgery remains the primary method for the radical treatment of gastric cancer (Xu et al., 2013). Various agents that target specific molecules have been investigated to control the progression of gastric cancer (Cho, 2013). The molecular targets take part in several signaling pathways and play important roles in carcinogenesis and cancer progression.

MicroRNAs (miRNAs) are the class of small noncoding RNAs, and play an important role in the regulation of gene expression at the posttranscriptional level. At present, more than 2,500 mature human miRNAs have been described. MiRNAs are believed to play a variety of roles in different diseases, including carcinoma. There is accumulating data indicating abnormal miRNA expression patterns in various human malignancies (Li et al., 2013), suggesting that the role of different miRNAs may vary in carcinogenesis (Wang et al., 2011).

There are three members of the miR-129 family including miR-129-1-3p, miR-129-2-3p, and miR-129-5p. Most reports on the miR-129 family were focused on the role of miR-129-5p, but not the other two members. MiR-129-5p has been demonstrated to function as a tumor suppresser gene in gastric carcinoma (Yu et al., 2013a), colorectal carcinoma (Karaayvaz et al., 2013), breast carcinoma (Wang et al., 2012), hepatocellular carcinoma (Liu et al., 2012), and thyroid carcinoma (Brest et al., 2011). Also, it has been reported that miR-129-5p may target SOX4 (Huang et al., 2012; Chen et al., 2013; Shen et al., 2010) and CDK6 (Wu et al., 2010) to regulate the cell cycle in carcinoma.

The human programmed cell death-2 (PDCD2) gene is located on chromosome 6q27. It encodes a nuclear protein expressed in a variety of tissues. PDCD2 has been suggested to promote cell apoptosis and its function was regulated by BCL6, a transcriptional repressor required for lymph node germinal center development. It has been demonstrated that PDCD2 could function as a tumor suppressor gene and inhibit cell proliferation in lymphomas (Baron et al., 2010, 2007, 2002). In the present study, we focused on one member of the miR-129 family—miR-129-1-3p, and found that miR-129-1-3p may regulate BGC-823 cells proliferation by targeting PDCD2.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED

Cell Culture and Materials

Human gastric cancer cell lines (HEK293T and BGC-823) were obtained from the Ningbo Institute of Medical Sciences. The cells were maintained at 37°C in a 5% CO2 incubator in the complex mixture of 90% RPMI-1640 and 10% FBS. The mimic and inhibitor of miR-129-1-3p (miR-129-1 gene ID: 406917; miR-129-1-3p accession number: MIMAT0004548) were chemically synthesized by Shanghai GenePharma Company (China). The sequences were as follows: miR-129-1-3p mimic: AAGCCCUUACCCCAAAAAGUAU; miR-129-1-3p inhibitor: AUACUUUUUGGGGUAAGGGCUU; miRNA mimic single strand negative control with FAM tag (mimic NC-FAM): UUGUACUACACAAAAGUACUG and miRNA inhibitor single strand negative control with FAM tag (inhibitor NC-FAM): CAGUACUUUUGUGUACAA.

miRNA Mimic and Inhibitor Transfection

The final concentration of siRNA oligo was up to 1 μM. The confluence of BGC-823 cell line was up to 60%. Mimic, inhibitor, and lipo2000 (Invitrogen, Grand Island, NY) were separately added to serum free medium (RPMI-1640) and incubated for 5 min. Then the mimic complex (mimic and serum-free medium) or inhibitor complex (inhibitor and serum-free medium) was separately incubated with lipo2000 complex (lipo2000 and serum-free medium) for another 20 min. Added the final complexes into BGC-823 cell culture plate and incubated at 37°C and 5% CO2 for 5 hr. The transfection medium was replaced with complete medium and continued to incubate at 37°C and 5% CO2 for 24 hr.

Cell Cycle Analysis

The miR-129-1-3p mimic and inhibitor were transfected into the BGC-823 cell line, when the confluence of cells was 80%–90%. After 24 hr, the supernatant was abandoned and the cells were digested in 1 mL ice cold PBS (without calcium and magnesium), then centrifuged the cell suspension at 1,000 rpm for 8 min. Cells were fixed by adding 1 mL cold 70% ethanol for 24 hr at −20°C, then centrifuged the mixture at 1,200 rpm for another 8 min and abandoned the supernatant. Repeated washing the fixed cells with 2 mL cold PBS without calcium and magnesium. Light exposure was avoided and 400 μL propidium iodide (PI) was added into cells, and then the mixture was transferred into flow tube for 20 min to be tested with flow cytometry.

Real-Time Cell Analyzer

BGC-823 cells were transiently transfected with the siRNA oligos and analyzed after 24 hr using real-time cell analyzer (RTCA; Roche Applied Science, Mannheim, Germany). The data acquisition interval was 15 min and the total observation time was 72 hr.

Bioinformatics Analysis of Target Genes and Expression Level Analysis

The target genes for miR-129-1-3p were mined using the miRDB and miRNA.org, an online database for miRNA target prediction. Candidate genes were selected based on cell proliferation reported in the National Center for Biotechnology Information (NCBI).

RNA Extraction and QRT-PCR

The RNAs were extracted from transfected BGC-823 cells. For amplification of miR-129-1-3p: 1 μg RNA was reverse transcribed by Qiagen miScript IIRT Kit (cat. nos. 218160). The products of the reverse transcriptase were 3 times diluted in RNase-free water and stored at −20°C. The RT step was 37°C for 60 min [RIGHTWARDS ARROW] 95°C for 5 min [RIGHTWARDS ARROW] 4°C. The PCR primers for miR-129-1-3p were designed and synthesized by Qiagen miScript Primer Assay (lot number. 111244132). The primers for U6 endogenous reference were as follows: U6 PF: 5′-CGCTTCGGCAGCACATATAC; U6 PR: 5′-TTCACGAATTTGCGTGTCAT. The miScript ® SYBR® Green PCR Kit, in combination with miScript miRNA PCR Array, was used to profile miRNA expression by real time-PCR. Reaction conditions for U6 and miR-129-1-3p were 95°C for 15 min, followed by 40 cycles of 94°C for 30 s, 60°C for 30 s.

For amplification of PDCD2: 1 μg RNA was reverse transcribed by GOTaq® 2-step RT-qPCR system (REF: A6010; Promega, Biosciences, USA). Reaction conditions was 25°C for 5 min, followed by 42°C for 1 hr, 70°C for 5 min. cDNA were stored at −20°C. The PCR primers of PDCD2 and the reference control of GAPGH were as follows: PDCD2 PF: 5′-CAGGGTTTGTGGCTGTTTAG; PDCD2 PR: 5′-GGAAGTTGTGGTCTGGAATTAT; GAPDH PF: 5′-CTGGGCTACACTGAGCACCAG; GAPDH PR: 5′-CCAGCGTCAAAGGTGGAG. Reaction conditions for PDCD2 were 95°C for 15 min, followed by 40 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 40 s.

Western Blotting Assay

Total proteins were extracted from transfected BGC823 cells by radioimmunoprecipitation assay lysis buffer. Lysates were clarified by centrifugation at 16,000 rpm for 20 min at 4°C. The cell lysates were separated by 12% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (Millipore Corporation, Bedford, MA, USA). The membranes were blocked with 5% skim milk in TBST for 1 hr. The membranes were then incubated overnight at 4°C with rabbit anti-PDCD2 antibody (Abcam, Cambridge, UK) followed by incubation with IRDye 680-conjugated goat-anti-rabbit secondary antibody (Li-COR, Ireland) at room temperature for 1 hr. The targeted proteins were then analyzed by using the Odyssey Infrared Imaging System (Li-COR, Ireland). β-Actin (Sigma-Aldrich, Saint Louis, MO, USA) was used as a control for protein loading.

Molecular Clone and Luciferase Reporter Assay

The miR-129-1-3p was cloned into pLMP plasmid (Fig. 5). The empty vector of miRNA was used as a control. The 3′-UTR of PDCD2 containing the predicted miR-129-1-3p binding sites and their mutants were cloned onto pLUC vectors (Fig. 5). Twenty-four hours before transfection, HEK293T cells were seeded in 96 well plates with the cell seeding density of 2 × 104 per well. Cells were co-transfected with 150 ng of pLUC-3′-UTR-PDCD2 and 450 ng of pLMC-miR-129-1-3p, along with 30 μL of Opti-MEM and 0.9 μL of FugeneHD. Luciferase activity was measured 24–72 hr after transfection using the Dual-Glo luciferase assay system (E2940; Promega, Biosciences, USA).

Statistical Analysis

All data were analyzed by SPSS 16.0. The student t test was used to analyze the cell cycle results. The paired t test was used to analyze the cell growth. P < 0.05 was considered statistically significant.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED

miR-129-1-3p Promote Proliferation of BGC-823 Cells

In order to explore the effect of miR-129-1-3p on cell proliferation, the mimics and inhibitors of miR-129-1-3p were transfected into BGC-823 cells. QRT-PCR verified that the mimics and inhibitors were successfully transfected into the BGC-823 cell line (Fig. 1A,B). Then we observed the cell cycle by flow cytometry in the transfected BGC-823 cell line. The results showed that although there was no significant difference between inhibitor NC-FAM and miR-129-1-3p inhibitor compared with the mimic NC-FAM, more S stage cells existed in the miR-129-1-3p mimic group (Fig. 2E, P = 0.02). At the same time, the G1 stage cells were reduced in the miR-129-1-3p mimic group (Fig. 2E, P = 0.04). It indicated that more cells were in a state of replication after being transfected with the miR-129-1-3p mimic. Furthermore, the results of cell growth by RTCA showed that up-regulation of miR-129-1-3p promote cell growth in the BGC-823 cell line (Fig. 3A). Although the whole growth curve of miR-129-1-3p inhibitor was above the inhibitor NC-FAM, the two growth curves have the intersection tendency at 72 hr. There was no statistically significant difference at the end point of observation (Fig. 3B). This suggests that miR-129-1-3p promote BGC-823 cells proliferation.

image

Figure 1. QRT-PCR to test the expression of miR-129-1-3p and PDCD2. (A) The expression of miR-129-1-3p after transfection with miR-129-1-3p mimic, controlled by mimic NC-FAM. (B) The expression of miR-129-1-3p after transfection with miR-129-1-3p inhibitor, controlled by inhibitor NC-FAM. (C) The expression of PDCD2 after transfection with miR-129-1-3p mimic in the BGC-823 cell line, controlled by mimic NC-FAM. (D) The expression of PDCD2 after transfection with miR-129-1-3p inhibitor in the BGC-823 cell line, controlled by inhibitor NC-FAM.

Download figure to PowerPoint

image

Figure 2. Cell cycle analysis by flow cytometry in the BGC-823 cell line. (A) The cell cycle analysis for 3 times (a, b, and c) after transfection with mimic NC-FAM. (B) The cell cycle analysis for 3 times (a, b, and c) after transfection with miR-129-1-3p mimic. (C) The cell cycle analysis for 3 times (a, b, and c) after transfection with inhibitor NC-FAM. (D) The cell cycle analysis for 3 times (a, b, and c) after transfection with miR-129-1-3p inhibitor. (E) Comparison of the ratio of each cell cycle components (G1: blue, S: red, and G2/M: yellow) after transfection with miR-129-1-3p mimic. (F) Comparison of the ratio of each cell cycle components (G1: blue, S: red, and G2/M: yellow) after transfection with miR-129-1-3p inhibitor.

Download figure to PowerPoint

image

Figure 3. RTCA to analysis the cell growth after transfection with miR-129-1-3p mimic and inhibitor in the BGC-823 cell line. (A) BGC-823 was transfected with miR-129-1-3p mimic, controlled by mimic NC-FAM. (B) BGC-823 was transfected with miR-129-1-3p inhibitor, controlled by inhibitor NC-FAM. *paired t test for data from the two cell growth curve at the same time point: P < 0.05.

Download figure to PowerPoint

image

Figure 4. Western blotting assay for PDCD2. The protein expression levels of PDCD2 were compared among the mimic control, miR-129-1-3p mimic, inhibitor control, and miR-129-1-3p inhibitor. β-actin was used as the normalization control.

Download figure to PowerPoint

miR-129-1-3p Target PDCD2 in the BGC-823 Cell Line

PDCD2 is known as one of the predicting targets of miR-129-1-3p, and has been reported to be related to the cell cycle (Baron et al., 2010, 2007). In order to investigate whether PDCD2 is the target for miR-129-1-3p, we first tested the mRNA expression levels of PDCD2 and miR-129-1-3p, and found that miR-129-1-3p was negatively related to PDCD2 (Fig. 1C,D). However, the protein expression level of PDCD2 was not changed with the miR-129-1-3p (Fig. 4). The results of luciferase reporter assay showed that miR-129-1-3p could inhibit PDCD2. These results suggested that PDCD2 is the target for miR-129-1-3p (Fig. 5).

image

Figure 5. Molecular clones and luciferase reporter assay. (A) The vector of pLMP for construction of pri-miR-129-1-3p. (B) The vector of pLUC for construction of 3′-UTR of PDCD2 and its mutant. (C) Two sites (26 and 153) of the 3′-UTR of PDCD2 sequence for pairing with miR-129-1-3p, predicted by TargetScan data base. (D) The site (475) of the 3'-UTR of PDCD2 sequence for pairing with miR-129-1-3p, predicted by TargetScan data base. (E) Luciferase reporter assay after co-transfection of pLUC-3′-UTR-PDCD2 and pLMP-miR-129-1-3p into the 293T cell line, controlled by the empty vector group. (F) Luciferase reporter assay after co-transfection of pLUC-mumtant-3′-UTR-PDCD2 and pLMP-miR-129-1-3p into the 293T cell line, controlled by the empty vector group.

Download figure to PowerPoint

DISCUSSIONS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED

The miR-129 family contains three mature members, including miR-129-5p, miR-129-1-3p, and miR-129-2-3p. The function of miR-129-5p has been reported in several studies (Liu et al., 2012; Wu et al., 2010). However, little is known about the function of 3' product of the miR-129 family. In the present study, we focused on the role of miR-129-1-3p in the gastric cancer cell line BGC-823, and found that miR-129-1-3p promotes cell proliferation in the BGC-823 gastric carcinoma cell line. Although miR-129-1-3p has been suggested to act as a tumor suppressor gene and was down-regulated in gastric carcinoma (Yu et al., 2013b, 2013a) and hepatocellular carcinoma (Maurel et al., 2013), it could not explain the specific results under certain conditions, even in different cell lines from the same kind of carcinoma because of their different resources. For different resources of cell lines, because the expression of miRNA has the biological specificity, its expression to regulate cell biology may take part through different pathways. As for the phenomenon which seems to be contradicted with other reports, we focused on the specific results obtained from the BGC-823 cell line and the underlying mechanism. Yu and colleagues (Yu et al., 2013b) suggested that the target for miR-129-1-3p may be different from the other two members, and was not related to the expression of SOX4, indicating different role of miR-129-1-3p in cell biology.

By investigating the function, database scores and the target sites, we selected PDCD2 from 187 predicted targets for further testing. PDCD2 has been reported to induce cell apoptosis in lymphomas (Baron et al., 2010, 2007), which was regulated by BCL6. It has been demonstrated that short hairpin RNA targeting beta-catenin could suppress cell proliferation by up-regulating the expression of PDCD2 in gastric carcinoma (Jiang et al., 2009). Also, PDCD2 was expressed with decreased levels in a multidrug-resistant human colon carcinoma cell line (Fan et al., 2004). All these reports suggested that PDCD2 act as a tumor suppresser gene in human carcinoma. Our study suggested that miR-129-1-3p may promote BGC-823 cells proliferation by targeting PDCD2. Although the mRNA level of PDCD2 was negatively related with miR-129-1-3p, and the luciferase assay also showed the direct interaction between PDCD2 and miR-129-1-3p, the protein level of PDCD2 was not changed with the miR-129-1-3p. According to the report by Guo et al. (2010), the main regulatory way of miRNAs to reduce target genes expression is by targeting mRNA level in mammalian, indicating that the target protein level change was not the direct result of miRNAs regulation (Guo et al., 2010). Change at the mRNA level may not be timely reflected at the protein level. For the same reason we only observed the change in PDCD2 mRNA level.

In summary, our results showed that miR-129-1-3p may promote the BGC-823 cell line proliferation by targeting PDCD2. Although it is not the only signaling pathway during carcinogenesis and cancer progression to impact the cell growth, our studies provided clues to its mechanism.

LITERATURE CITED

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSIONS
  7. LITERATURE CITED
  • Baron BW, Anastasi J, Thirman MJ, Furukawa Y, Fears S, Kim DC, Simone F, Birkenbach M, Montag A, Sadhu A, Zeleznik-Le N, McKeithan TW. 2002. The human programmed cell death-2 (PDCD2) gene is a target of BCL6 repression: implications for a role of BCL6 in the down-regulation of apoptosis. Proc Natl Acad Sci USA 99(5):28602865.
  • Baron BW, Zeleznik-Le N, Baron MJ, Theisler C, Huo D, Krasowski MD, Thirman MJ, Baron RM, Baron JM. 2007. Repression of the PDCD2 gene by BCL6 and the implications for the pathogenesis of human B and T cell lymphomas. Proc Natl Acad Sci USA 104(18):74497454.
  • Baron BW, Hyjek E, Gladstone B, Thirman MJ, Baron JM. 2010. PDCD2, a protein whose expression is repressed by BCL6, induces apoptosis in human cells by activation of the caspase cascade. Blood Cells Mol Dis. 45(2):169175.
  • Brest P, Lassalle S, Hofman V, Bordone O, Gavric Tanga V, Bonnetaud C, Moreilhon C, Rios G, Santini J, Barbry P, Svanborg C, Mograbi B, Mari B, Hofman P. 2011. MiR-129-5p is required for histone deacetylase inhibitor-induced cell death in thyroid cancer cells. Endocr Relat Cancer. 18(6):711719.
  • Chen X, Zhang L, Zhang T, Hao M, Zhang X, Zhang J, Xie Q, Wang Y, Guo M, Zhuang H, Lu F. 2013. Methylation-mediated repression of microRNA 129-2 enhances oncogenic SOX4 expression in HCC. Liver Int. 33(3):476486.
  • Cho JY. 2013. Molecular diagnosis for personalized target therapy in gastric cancer. J Gastric Cancer 13(3):129135.
  • Fan CW, Chan CC, Chao CC, Fan HA, Sheu DL, Chan EC. 2004. Expression patterns of cell cycle and apoptosis-related genes in a multidrug-resistant human colon carcinoma cell line. Scand J Gastroenterol 39(5):464469.
  • Guo H, Ingolia NT, Weissman JS, Bartel DP. 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466(7308): 835840.
  • Huang HY, Cheng YY, Liao WC, Tien YW, Yang CH, Hsu SM, Huang PH. 2012. SOX4 transcriptionally regulates multiple SEMA3/plexin family members and promotes tumor growth in pancreatic cancer. PLoS One. 7(12):e48637.
  • Jiang H, Xia J, Kang J, Ding Y, Wu W. 2009. Short hairpin RNA targeting beta-catenin suppresses cell proliferation and induces apoptosis in human gastric carcinoma cells. Scand J Gastroenterol 44(12):14521462.
  • Karaayvaz M, Zhai H, Ju J. 2013. miR-129 promotes apoptosis and enhances chemosensitivity to 5-fluorouracil in colorectal cancer. Cell Death Dis.4:e659.
  • Li X, Ling N, Bai Y, Dong W, Hui GZ, Liu D, Zhao J, Hu J. 2013. MiR-16-1 plays a role in reducing migration and invasion of glioma cells. Anat Rec (Hoboken). 296(3):427432.
  • Liu Y, Hei Y, Shu Q, Dong J, Gao Y, Fu H, Zheng X, Yang G. 2012. VCP/p97, down-regulated by microRNA-129-5p, could regulate the progression of hepatocellular carcinoma. PLoS One. 7(4):e35800.
  • Maurel M, Jalvy S, Ladeiro Y, Combe C, Vachet L, Sagliocco F, Bioulac-Sage P, Pitard V, Jacquemin-Sablon H, Zucman-Rossi J, Laloo B, Grosset CF. 2013. A functional screening identifies five microRNAs controlling glypican-3: role of miR-1271 down-regulation in hepatocellular carcinoma. Hepatology 57(1):195204.
  • Shen R, Pan S, Qi S, Lin X, Cheng S. 2010. Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 in gastric cancer. Biochem Biophys Res Commun 394(4):10471052.
  • Wang X, Ling C, Bai Y, Zhao J. 2011. MicroRNA-206 is associated with invasion and metastasis of lung cancer. Anat Rec (Hoboken).294(1):8892.
  • Wang QY, Tang J, Zhou CX, Zhao Q. 2012. The down-regulation of miR-129 in breast cancer and its effect on breast cancer migration and motility. Sheng Li Xue Bao 64(4):403411.
  • Wu J, Qian J, Li C, Kwok L, Cheng F, Liu P, Perdomo C, Kotton D, Vaziri C, Anderlind C, Spira A, Cardoso WV, Lü J. 2010. miR-129 regulates cell proliferation by downregulating Cdk6 expression. Cell Cycle 9(9):18091818.
  • Xu X, Yang X, Xing C, Zhang S, Cao J. 2013. miRNA: The nemesis of gastric cancer (Review). Oncol Lett 6(3):631641.
  • Yu X, Luo L, Wu Y, Yu X, Liu Y, Yu X, Zhao X, Zhang X, Cui L, Ye G, Le Y, Guo J. 2013a. Gastric juice miR-129 as a potential biomarker for screening gastric cancer. Med Oncol. 30(1):365.
  • Yu X, Song H, Xia T, Han S, Xiao B, Luo L, Xi Y, Guo J. 2013b. Growth inhibitory effects of three miR-129 family members on gastric cancer. Gene 532(1):8793.