SEARCH

SEARCH BY CITATION

Keywords:

  • pyrethroids;
  • deltamethrin;
  • knockdown resistance (kdr);
  • voltage-gated sodium channel

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

We previously reported high deltamethrin resistance in bed bugs, Cimex lectularius, collected from multiple areas of the United States (Romero et al., 2007). Recently, two mutations, the Valine to Leucine mutation (V419L) and the Leucine to Isoleucine mutation (L925I) in voltage-gated sodium channel α-subunit gene, had been identified to be responsible for knockdown resistance (kdr) to deltamethrin in bed bugs collected from New York (Yoon et al., 2008). The current study was undertaken to investigate the distribution of these two kdr mutations in 110 bed bug populations collected in the United States. Out of the 17 bed bug populations that were assayed for deltamethrin susceptibility, two resistant populations collected in the Cincinnati area and three deltamethrin-susceptible lab colonies showed neither of the two reported mutations (haplotype A). The remaining 12 populations contained L925I or both V419L and L925I mutations in voltage-gated sodium channel α-subunit gene (haplotypes B&C). In 93 populations that were not assayed for deltamethrin susceptibility, 12 contained neither of the two mutations (haplotype A) and 81 contained L925I or V419L or both mutations (haplotypes B-D). Thus, 88% of the bed bug populations collected showed target-site mutations. These data suggest that deltamethrin resistance conferred by target-site insensitivity of sodium channel is widely spread in bed bug populations across the United States. © 2010 Wiley Periodicals, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

The bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), has rapidly become a challenging indoor pest during the last 10 years (Boase, 2001; Doggett et al., 2004; Potter, 2005). This nocturnal bloodsucking ectoparasite causes itching, anxiety, sleeplessness, and even iron deficiencies (Venkatachalam and Beldavady, 1962; Hwang et al., 2005; Pritchard and Hwang, 2009) and is a potential, though unproven, vector of human pathogens (Jupp and Lyon, 1987; Blow et al., 2001; Goddard and de Shazo, 2009). In addition, bed bugs also can cause social stigma and economic hardship due to cost of extermination and need to replace infested furniture (Potter, 2006). The primary approach to control bed bugs has mainly relied on the application of insecticides. After World War II, usage of dichloro-diphenyl-trichloroethane (DDT) and other synthetic insecticides greatly decreased bed bug infestations in the United States and Europe (Boase, 2001). However, during the past 10 years, bed bugs reappeared in large numbers and became hard to control, partly due to the development of resistance to currently used pyrethroids (Myamba et al., 2002; Gangloff-Kaufmann et al., 2006; Moore and Miller, 2006; Karunaratne et al., 2007; Romero et al., 2007).

To effectively manage populations of resurgent bed bugs that are resistant to pyrethroids, it is necessary to elucidate the mechanisms of pyrethroid resistance in this insect. The mechanisms involved in pyrethroid resistance are mainly divided into two groups, increased metabolic detoxification by P450s, glutathione transferases, and esterases (Feyereisen, 1999, 2005; Vontas et al., 2001; Young et al., 2005), and decreased target-site sensitivity of voltage-gated sodium channels (Liu et al., 2006; Dong, 2007). The voltage-gated sodium channel plays a vital role in the generation and propagation of action potentials in the neurons and is the primary target of pyrethroids and DDT (Elliott et al., 1978; Goldin, 2003; ffrench-Constant et al., 2004). Mutations to sodium channels confer pyrethroid resistance by reducing the binding of pyrethroids to the sodium channel. The most common sodium channel mutation, kdr mutation (L1014 to F/H/S), has been identified in many insects (Soderlund, 2005). In addition, nine other amino acid changes were also shown to cause kdr and kdr-type resistance (Dong, 2007). Recently, two point mutations (V419L and L925I) were identified from a highly deltamethrin-resistant population of the bed bug (NY-BB) (Yoon et al., 2008). V419L, a novel mutation, is located in the S6 transmembrane segment of domain I of the para-type sodium channel gene. The L925I mutation is located in the intracellular loop between S4 and S5 hydrophobic segments of domain II of this gene. Both mutations were considered as the major factors for resistance in NY-BB (Yoon et al., 2008). However, the distribution of these mutations in bed bug populations across the United States is not known. More than 100 bed bug populations were collected from 17 states across the United States between 2006 and 2009. Bioassays were conducted to determine deltamethrin toxicity in 17 populations. The distribution of two identified mutations in the para-type sodium channel gene was investigated in all populations using sequencing and allele specific PCR (ASPCR). The results showed that the target-site mutations are highly prevalent in the bed bug populations across the United States and are likely responsible for most cases of resistance reported for pyrethroids.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Bed Bug Populations

Two insecticide-susceptible colonies, one collected from Fort Dix, NJ, >30 years ago (Bartley and Harlan, 1974) and the other collected from Gainesville, FL, >20 years ago (Romero et al., 2007) were maintained in the laboratory without any insecticide exposure. Fifteen populations of bed bugs (third- to fifth-instar nymphs) were collected from human dwellings across the United States (see Table 2). In order to have enough individuals to perform residual bioassays, some of these populations of bed bugs were maintained initially in the laboratory by using a parafilm-membrane feeder. Bed bugs were kept in screened containers and fed with 39°C heparinized chicken blood through a thinly stretched parafilm membrane (Montes et al., 2002). Bed bugs were reared at 27°C, 65±5% RH, and a photoperiod of 14:10 (L:D) h. Additional bed bugs (93 locations) were collected from 17 states across the United States (see Tables 2 and 3, which show the sampling sites and collection dates for all populations). Locations were separated by at least 6.1 km. Samples were frozen with liquid nitrogen and kept in −80°C freezer until use.

Table 2. Causal Link Between Haplotypes Representing Mutations in Sodium Channel Gene and Deltamethrin Resistance in 17 Bed Bug Populations
     Mutations 
Sample no.Sample nameResistant statusLocationDate frozen419 aa925 aaHaplotype
  • a

    aResistance status of these populations was reported by Romero et al. (2007). The resistance status of the rest of the populations was determined following methods described by Romero et al. (2007).

1FD-1aSusceptibleFort Dix, NJ8/14/2006VLA
2GA-1aSusceptibleGainesville, FL8/14/2006VLA
3LA-1aSusceptibleLos Angeles, CA8/14/2006VLA
4CIN-1aResistantCincinnati, OH8/14/2006VLA
5CIN-3aResistantCincinnati, OH8/14/2006VLA
6LEX-1aResistantLexington, KY8/14/2006VIB
7TRO-1ResistantTroy, MI9/19/2006VIB
8DOV-1ResistantDover, NJ10/20/2006VIB
9CIN-2aResistantCincinnati, OH8/14/2006LIC
10FRA-1ResistantFrankfort, KY8/17/2006LIC
11TRO-2ResistantTroy, MI8/23/2006LIC
12KAL-1ResistantKalamazoo, MI10/17/2006LIC
13WOR-1ResistantWorcester, MA3/1/2007LIC
14SMI-1ResistantSmithtown, NY5/17/2007LIC
15NY-1ResistantPlainview, NYEarly 2008LIC
16CIN-5ResistantCincinnati, OH10/17/2008LIC
17NY-2ResistantNew York, NY4/30/2009LIC
Table 3. The Distribution of Haplotypes Representing Mutations in Sodium Channel Gene of 93 Bed Bug Populations*
Sample no.LocationDate frozenHaplotypeSample no.LocationDate frozenHaplotype
  • *

    *Haplotype A: No mutation at both 419 and 925 aa; B: mutation at 925 aa but no mutation at 419 aa; C: mutations at both 419 and 925 aa; D: mutation at 419 aa but no mutation at 925 aa.

18Rockville, MD3/7/2006A65Southfield, MI1/25/2007B
19Washington, DC3/7/2006A66Southfield, MI1/25/2007B
20Washington, DC3/7/2006A67Southfield, MI1/25/2007B
21Washington, DC3/7/2006A68Troy, MI1/25/2007B
22Fairfield, OH6/1/2006A69Troy, MI1/25/2007B
23Louisville, KY6/1/2006D70Cincinnati, OH2/1/2007C
24Fairfax, VA6/1/2006A71Kalamazoo, MI3/1/2007C
25Los Angeles, CA6/1/2006D72Kalamazoo, MI3/1/2007C
26Lexington, KY8/3/2006A73Lexington, KY3/1/2007B
27Pennis, CA8/4/2006A74Lexington, KY3/1/2007B
28Lexington, KY8/8/2006B75Lexington, KY3/1/2007C
29Lexington, KY8/8/2006B76Laurel, MD3/1/2007B
30Dayton, OH8/15/2006C77Laurel, MD3/1/2007B
31Dayton, OH8/15/2006C78Southfield, MI3/1/2007B
32Louisville, KY8/17/2006C79Southfield, MI3/1/2007B
33Louisville, KY8/17/2006B80Southfield, MI3/1/2007B
34Louisville, KY8/17/2006C81Southfield, MI3/1/2007B
35Lexington, KY8/17/2006C82Baltimore, MD3/1/2007C
36Beaumont, TX8/23/2006B83Cincinnati, OH3/19/2007A
37Lexington, KY8/23/2006B84Cincinnati, OH3/19/2007C
38Dayton, OH8/30/2006C85Lexington, KY3/19/2007C
39Dayton, OH8/30/2006C86Lynchburg, VA3/19/2007B
40Dayton, OH8/30/2006C87Cincinnati, OH3/19/2007C
41Savannah, GA8/31/2006B88Herndon, VA3/19/2007B
42Scarborough, ME8/31/2006B89Cincinnati, OH3/19/2007C
43Hampton, VA9/5/2006B90Cincinnati, OH3/19/2007C
44Indianapolis, IN9/7/2006C91Cincinnati, OH3/19/2007C
45Lexington, KY9/19/2006B92Cincinnati, OH3/19/2007C
46Little Falls, NJ10/17/2006B93Philadelphia, PA4/1/2007C
47Chicago, IL10/19/2006A94Plainview, NY4/1/2007C
48Louisville, KY10/20/2006C95Troy, MI4/1/2007B
49Bayonne, NJ10/20/2006C96Troy, MI4/1/2007B
50Lake Hiwatha, NJ10/31/2006C97Troy, MI4/1/2007B
51Kalamazoo, MI10/31/2006C98Burn Hills, MI4/1/2007C
52Morristown, NJ11/13/2006D99Lynbrook, NY4/1/2007C
53Brunswick, ME11/14/2006B100Upper, NY4/27/2007B
54Morristown, NJ11/14/2006A101Hempstead, NY4/30/2007C
55Rockland, ME11/22/2006B102Farmingdale, NY5/4/2007C
56Richmond, VA11/22/2006B103Herndon, VA5/8/2007B
57Williamsburg, VA11/22/2006B104Hempstead, NY5/14/2007C
58Crownsville, MD11/22/2006A105Rocketway, NY5/17/2007C
59Jersey City, NJ11/22/2006C106Lexington, KY5/21/2007B
60Duluth, MN11/22/2006B107Lynbrook, NY6/6/2007C
61Southfield, MI1/25/2007B108Woodsburgh, NY6/6/2007C
62Southfield, MI1/25/2007B109Hauppauge, NY6/18/2007B
63Southfield, MI1/25/2007B110Smithtown, NY6/18/2007B
64Southfield, MI1/25/2007B    

Residual Bioassays

The resistant status of each of the 17 population was evaluated by confining 20 third- to fifth-instar nymphs on deltamethrin-treated filter paper. Nymphs were exposed to a discriminating dose (0.13 mg/cm2) of technical grade (99% active ingredient, Bayer Environmental Science) deltamethrin. This dose is approximately 30 times the dose required to kill 100% of a susceptible strain (Romero et al., 2007). Acetone-treated filter paper that was allowed to dry was used as a control. The mortality was determined after 24 h of exposure. Each experiment was repeated at least three times.

Gene Cloning and Sequencing

DNA was isolated from three individuals pooled for each population using DNasy kit (Qiagen, Valencia, CA). Voltage-gated sodium channel α-subunit gene regions that cover all 12 mutations (Fig. 1) were amplified using genomic DNA of CIN-1 and primers shown in Table 1. These 12 mutations include 10 mutations that have been reported causing kdr and kdr-type resistance and two new mutations from the bed bug [actually V419 (C. lectularius) and V421 (Heliothis virescens) are the same residue]. Fragments that included mutations V419L and L925I were amplified using genomic DNA of 15 other bed bug populations with known resistant status. The PCR products were purified using QIAquick PCR Purification Kit (Qiagen) and sequenced at the Advanced Genomics Technology Center of the University of Kentucky. The sequences of gene fragments were aligned and compared using Vector NTI Advance 9 software (Invitrogen, Carlsbad, CA).

thumbnail image

Figure 1. kdr mutations in insect sodium channels. The open circles represent mutations observed in the bed bug (C. lectularius). The solid circles represent mutations that have been confirmed to reduce the sodium channel sensitivity to pyrethroids. The Valine to Methionine mutation (V421M) was identified in Heliothis virescens; the Glutamic acid to Lysine mutation (E434K) and the Cysteine to Arginine mutation (C764R) were identified in Blattella germanica; the Methionine to Isoleucine mutation (M827I) is from Pediculus capitis; the Methionine to Threonine mutation (M918T) is from Musca domestica and Hydrotaea irritans; the Threonine to Isoleucine/Cysteine/Valine mutation (T929I/C/V) is from Plutella xyllostella, P. capitis, Frankliniella occidentalis, and Ctenocephalides felis; the Leucine to Phenylalanine mutation (L932F) is from Pediculus capitis; the Leucine to Phenylalanine/Histidine/Serine mutation (L1014F/H/S) exists in many insects; the Phenylalanine to Isoleucine mutation (F1519I) is from Boophilus microplus; and the Leucine to Proline mutation (L1770P) is from Varroa destructor. Please see Dong (2007) for references that report these mutations. *Represents mutations detected from the bed bug. V419 (C. lectularius) and V421 (Heliothis virescens) are the same residue. Modified from Dong (2007).

Download figure to PowerPoint

Table 1. Primers Used for Cloning, Sequencing, and ASPCR
NameFunctionSequenceFragmentMutations checked
BBParaF1Cloning, sequencing, ASPCR5′ AACCTGGATATACATGCCTTCAAGG 3′I (366-523aa)V419L, V421M, E434K
BBParaR1Cloning, ASPCR5′ TGATGGAGATTTTGCCACTGATG 3′  
BBParaF2Cloning, sequencing5′ TGCTCAATGATATCATCGAGCAGG 3′II (729-867aa)C764R, M827I
BBParaR2Cloning5′ AACTTCATGGCAGCTTCAATTCCG 3′  
BBParaF2-1Cloning, sequencing5′ GCTAGTTGCATTTATAGTATTTG 3′  
BBParaR2-1Cloning, sequencing5′ ACTCATTGCTATCAACTTCATG 3′  
BBParaF3Cloning, sequencing, ASPCR5′ GGAATTGAAGCTGCCATGAAGTTG 3′III (870-1117aa)M918T, L925I, T929I, L932F, L1014F/H/S
BBParaR3Cloning, ASPCR5′ TGCCTATTCTGTCGAAAGCCTCAG 3′  
BBParaF4Cloning, sequencing5′ GGTATTCAGGCGTTCAAAACTATGAG 3′IV (1369-1818aa)F1519I
BBParaR4Cloning, sequencing5′ GAGGAATGTGATTCCTATAGTCG 3′  
BBParaR4-1Sequencing5′ ACTATTTCAAACACAATTGCTTGTGG 3′  
BBParaF5Cloning, sequencing5′ ATGCATGTCAAGGACAAAAGTGG 3′V (1749-1881aa)L1770P
BBParaR5Cloning, sequencing5′ TCTGATAGCTGGTCGTAACGG 3′  
BBParaR5-1Sequencing5′ ATCCCAACCAGCAGAAGTAGAC 3′  
BBParaF1-ASASPCR5′ ATTCCTGGGATCATTCTACCTCG 3′
BBParaF3-ASASPCR5′ ATTATGGGCAGAACAGTGGGTGCCC 3′  

Allele-Specific PCR (ASPCR)

ASPCR was conducted to identify the mutations V419L and L925I in all 110 bed bug populations. Two rounds of PCR reactions were performed. For the first PCR reaction, the allele-independent primer pairs, BBParaF1/BBParaR1 and BBParaF3/BBParaR3 (Table 1), were used to generate fragment I and fragment III containing amino acid V419 and L925, respectively. For fragment I, the first PCR was conducted with 100 ng DNA template and 0.3 µM of BBParaF1/BBParaR1 primer pair in a 20-µl reaction. The PCR conditions were 94°C for 3 min 50 s, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, finishing with an extension step at 72°C for 10 min. For fragment III, the first PCR was conducted under the same reaction conditions described for fragment I except that the annealing temperature was 55°C and BBParaF3/BBParaR3 primer pair was used. The second PCRs for fragments I and III were conducted using 1 µl of a 1,000- and 10,000-fold dilution, respectively, of the first-round PCR reaction solution, and allele-specific primer pairs, BBParaF1-AS/BBParaR1 and BBParaF3-AS/BBParaR3 (Table 1). The allele-specific forward primer was designed based on the specific sequence of voltage-gated sodium channel α-subunit gene in LA-1 (susceptible strain without mutation) by placing a specific nucleotide polymorphism at the 3′ end of each primer to permit preferential amplification of the gene allele without mutation. For fragment I, the second PCR was conducted under the same reaction conditions described for the first PCR except that 25 cycles were used. For fragment III, the second PCR solution was heated to 94°C for 3 min 50 s, followed by 35 cycles of 94°C for 30 s, 68°C for 2 min, finishing with an extension step at 68°C for 10 min. Each experiment was repeated three times with independent preparations of DNA (three bed bug individuals for each DNA preparation). To avoid the situation that any failed reactions will be scored as resistant, we chose the templates with no PCR product to sequence.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

Sequencing of Voltage Gated Sodium Channel α-Subunit Gene Fragments From CIN-1

In previous studies, we reported that bed bugs collected from the Cincinnati, OH, area (CIN-1) showed very high resistance (>12,765-fold) to deltamethrin relative to the susceptible strain, Fort Dix (FD-1) (Romero et al., 2007). To determine if the mutations in the voltage-gated sodium channel α-subunit gene are responsible for observed deltamethrin resistance in CIN-1 population, 14 primers were designed to clone the fragments I to V that include 12 reported mutations including V419L and L925I, which had been confirmed to be responsible for sodium channel insensitivity to pyrethroids in insects (Dong, 2007; Fig. 1; Table 1). No mutations were detected in the five fragments of CIN-1 voltage-gated sodium channel α-subunit gene, suggesting mutations in this gene are not responsible for the deltamethrin resistance observed in the CIN-1 population.

Determining a Causal Link Between Haplotypes and Deltamethrin Resistance

To identify if there is a causal link between two identified mutations, V419L and L925I in sodium channel α-subunit gene and deltamethrin resistance in bed bug populations, residual bioassays and sequencing of sodium channel α-subunit gene fragments containing amino acids of two identified mutations were performed for 17 bed bug populations. A discriminating dose (0.13 mg/cm2) of deltamethrin (Romero et al., 2007) was used to evaluate the resistant status of 17 bed bug populations. Bioassay results showed that three populations, FD-1, GA-1, and LA-1 (two of which were long-maintained laboratory colonies), are susceptible to deltamethrin. The other 14 populations showed moderate to high resistance to deltamethrin (Table 1). Sequencing of para gene fragments containing two amino acids for identified mutations showed that neither of the two mutations is present in the para gene fragments amplified using the DNA of bed bugs from FD-1, GA-1, and LA-1 populations susceptible to deltamethrin. In addition, two populations resistant to deltamethrin (CIN-1 and CIN-3) also showed neither of these two mutations; this group is designated as Haplotype A. Only L925I mutation but not V419L mutation, is present in three resistant populations (LEX-1, TRO-1, and DOV-1; designated as Haplotype B). Both V419L and L925I mutations are identified in nine other resistant populations (Haplotype C).

These results suggest a potential causal link. Haplotypes B (with mutation L925I) and C (with mutations L925I and V419L) are resistant to deltamethrin. We have not characterized any populations with only the V419L mutation (Haplotype D). Although Haplotype A is likely pyrethroid-sensitive, bed bugs possessing this haplotype could also be resistant by a mechanism that does not involve target site insensitivity. For example, two populations from the Cincinnati area (CIN-1 and CIN-3) are HaplotypeA, but are nonetheless resistant to deltamethrin. These two populations showed neither V419L nor L925I mutation in the voltage-gated sodium channel α-subunit gene. Additionally, CIN-1 contained none of the 12 voltage-gated sodium channel α-subunit gene mutations shown to be involved in pyrethroid resistance. Recent studies showed that the inhibitors of P450 reduce deltamethrin resistance in CIN-1 (Romero et al., 2009). Therefore, we hypothesized that P450-mediated metabolic detoxification may be a mechanism responsible for deltamethrin resistance observed in this population. Studies are underway in our laboratory to determine the mechanism of resistance in CIN-1.

Examining Geographic Distribution of Knockdown Resistance in Bed Bug Populations

We developed ASPCR primers for two mutations, V419L and L925I, identified as responsible for deltamethrin resistance in the NY-BB population. To determine if the ASPCR primers developed for these two mutations are reliable to detect mutations in bed bug populations, we performed ASPCR using the genomic DNA isolated from 17 bed bug populations. Similar to the results observed by sequencing, ASPCR also detected neither mutation in five populations (Haplotype A; FD-1, GA-1, LA-1, CIN-1 and CIN-3), only L925I but not V419L in three resistant populations (Haplotype B; LEX-1, TRO-1, and DOV-1), and both V419L and L925I mutations in the other nine resistant populations (Haplotype C) (Fig. 2). Thus, ASPCR consistently confirmed results observed by sequencing, suggesting that ASPCR could be used to monitor resistance in bed bug populations.

thumbnail image

Figure 2. 1st PCR and ASPCR results for fragments I (A) and III (B) amplified using DNA isolated from 17 bed bug populations. The 1st PCR fragments were amplified using allele-independent primer pairs, BBParaF1/BBParaR1 (A) and BBParaF3/BBParaR3 (B). The ASPCR fragments were amplified using allele-specific primer pairs, BBParaF1-AS/BBParaR1 (A) and BBParaF3-AS/BBParaR3 (B). The Arabic numbers on the top of the gel pictures are the sample numbers as shown in Table 2. The same DNA template was used for both A and B. S, Susceptible; R, Resistant.

Download figure to PowerPoint

The distribution of V419L and L925I mutations in 93 additional bed bug populations collected from dwellings across the United States was examined by ASPCR. Out of the 93 populations screened by ASPCR, 12 showed neither mutation (Haplotype A), 42 showed L925I but not V419L mutation (Haplotype B), and 36 showed both mutations (Haplotype C) (Table 3). In addition, in three populations only V419L but not L925I mutation was detected and designated as Haplotype D. Since mutation V419L was shown as one of the two mutations present in the deltamethrin-resistant NY-BB colony (Yoon et al., 2008), the populations with V419L mutation (Haplotype D) may be resistant to deltamethrin but we have no bioassay data to support this hypothesis. Mapping the geographical distribution of two identified mutations in sodium channel α-subunit gene showed that populations collected from 9 of the 17 states showed 100% resistant bed bug populations (with haplotypes B, C, or both B and C; Fig. 3). Five other states showed more than 50% populations with resistance to deltamethrin (haplotypes B, C, and/or D; Fig. 3).

thumbnail image

Figure 3. The geographic distribution of kdr mutations in the bed bug populations collected from the United States. The pies show the haplotype composition of all population samples in each state. The number under each pie is the number of populations collected from each state.

Download figure to PowerPoint

It is interesting that the presence of even a single mutation, L925I, could confer significant deltamethrin resistance (Table 2). The frequency of a single mutation L925I (Haplotype B) is 0.43 in 110 populations tested. This is even higher than the frequency (0.41) of Haplotype C containing both mutations. The frequency of occurrence of a single mutation V419L (haplotype D) is very low (around 0.027). These data support the important role of L925I mutation in deltamethrin resistance. Even though L925I mutation is present in two haplotypes (B and C), these two haplotypes have a somewhat different geographic distribution (Fig. 3). Haplotype C is predominantly present in the northeastern part of the United States and occurs very infrequently in the south. In contrast, haplotype B is present in both northern and southern states. Interestingly, haplotype D is present in very limited regions and co-occurrs with haplotype A.

Among the 17 states represented, samples collected from only one state (IL) and District of Columbia showed no mutations in the kdr gene (only single sample per region was collected). More than half of the states (9 out of 17) showed haplotypes B or C or both B and C that confer resistance to deltamethrin. These data indicate that deltamethrin resistance conferred by target-site insensitivity of sodium channel is widely distributed in the bed bug populations across the United States. It is also interesting that the predominance of resistance-conferring haplotypes B and C is higher in the northeastern states than in the southern states.

In the 1940s and 1950s, DDT was commonly used to control bed bug infestations (Boase, 2001). Subsequently, a high degree of resistance to DDT was reported in many strains (Johnson and Hill, 1948; Gratz, 1959; Mallis and Miller, 1964; Nagem and Williams, 1992). Since pyrethroids and chlorinated hydrocarbons share a similar mode of action, cross-resistance may occur between these two classes of insecticides, and, therefore, could explain why bed bugs have developed resistance to pyrethroids so quickly. As the primary target of pyrethroids and DDT, the voltage-gated sodium channel was subjected to selection since the 1940s when DDT was first introduced (ffrench-Constant et al., 2004). Therefore, the kdr-mediated resistance mechanism is well suited for studying the origins of pyrethroid resistance (Anstead et al., 2005). Use of pyrethroids and pyrethroid-treated bed nets in different parts of the world for controlling mosquitoes may have also contributed to pyrethroid resistance in bed bugs (Myamba et al., 2002). Our study was not designed to look for the point of origin or introduction of pyrethroid resistance into bed bug populations. However, because at least three factors (two kdr mutations and one likely P450) are implicated and these are found in independent samples, it is likely that resistance will have multiple geographic origins. Further studies with more populations and additional markers are required to reach a final conclusion on the origins of bed bug resistance in the United States.

In conclusion, the current study is the first effort to investigate the distribution and extent of kdr mutations in bed bug populations across the United States. In addition, we established a causal link between haplotypes and deltamethrin resistance in bed bug populations and analyzed the geographic distribution of these mutations. The major finding of this report is the discovery that target site–based mutations are the main reason for reported pyrethroid resistance in bed bug populations from across the United States. About 88% of the bed bug populations tested showed target-site mutation(s) and most likely are resistant to deltamethrin. The remaining 12% of populations may be susceptible to pyrethroids or resistant to them through some other mechanism such as increased activity of detoxifying enzymes such as P450. Our study will serve as baseline data to study the origin of pyrethroid-resistant bed bug populations. In addition, this study has some important practical applications. ASPCR primers developed in this study can be used for monitoring the target-site mutations in bed bug populations. This type of monitoring will help in the development of improved bed bug population management strategies. For example, currently, several pest-management companies add additives such as piperonyl butoxide to synthetic pyrethroid formulations to treat resistant populations of bed bugs. If the monitoring program determines that the population being treated contains target-site mutations (as we predict based upon data included in this report), then the treatment strategy should include an insecticide that functions through a target site other than the sodium channel protein. Thus, the studies reported here will help to conduct resistance monitoring in bed bug populations leading to improvement in bed bug management strategies.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED

We thank Shelby Stamper, for technical support. We thank pest control firms from across the nation for collecting bed bug samples. Drs. Harold Harlan and Robin Todd provided us with bed bugs from their long-maintained susceptible strains. This is contribution number 10-08-012 from the Kentucky Agricultural Experimental Station.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS AND DISCUSSION
  6. Acknowledgements
  7. LITERATURE CITED
  • Anstead JA, Williamson MS, Denholm I. 2005. Evidence for multiple origins of identical insecticide resistance mutations in the aphid Myzus persicae. Insect Biochem Mol Biol 35:249256.
  • Bartley JD, Harlan HJ. 1974. Bed bug infestation: its control and management. p 884886. Military Medic November.
  • Blow JA, Turell MJ, Silverman AL, Walker ED. 2001. Stercorarial shedding and transtadial transmission of hepatitis B virus by common bed bugs (Hemiptera: Cimicidae). J Med Entomol 38:94700.
  • Boase CJ. 2001. Bedbugs-back from the brink. Pestic Outlook 12:159162.
  • Doggett SL, Geary MJ, Russell RC. 2004. The resurgence of bed bugs in Australia: with notes on their ecology and control. Environ Health 4:3038.
  • Dong K. 2007. Insect sodium channels and insecticide resistance. Invert Neurosci 7:1730.
  • Elliott M, Janes NF, Potter C. 1978. The future of pyrethroids in insect control. Annu Rev Entomol 23:443469.
  • Feyereisen R. 1999. Insect P450 enzymes. Annu Rev Entomol 44:507533.
  • Feyereisen R. 2005. Insect Cytochrome P450. In: GilbertLI, IatrouK, GillSS, editors. Comprehensive molecular insect science. Oxford: Elsevier. p 177.
  • ffrench-Constant RH, Daborn PJ, Le Goff G. 2004. The genetics and genomics of insecticide resistance. Trends Genet 20:163170.
  • Gangloff-Kaufmann J, Hollingworth C, Hahn J, Hansen L, Kard B, Waldvogel M. 2006. Bed bugs in America: a pest management industry survey. Am Entomol 52:105106.
  • Goddard J, de Shazo R. 2009. Bed bugs (Cimex lectularius) and clinical consequences of their bites. J Am Med Assoc 301:13581366.
  • Goldin AL. 2003. Mechanisms of sodium channel inactivation. Curr Opin Neurobiol 13:284290.
  • Gratz NG. 1959. A survey of bed-bug resistance to insecticide in Israel. Bull WHO 20:835840.
  • Hwang SW, Svoboda TJ, De Jong IJ, Kabasele KJ, Gogosis E. 2005. Bed bug infestations in an urban environment. Emerg Infect Dis 11:533538.
  • Johnson MS, Hill AJ. 1948. Partial resistance of a strain of bed bugs to DDT residual. Med Newslett 12:2628.
  • Jupp PG, Lyon SF. 1987. Experimental assessment of bedbugs (Cimex lectularius and Cimex hemipterus) and mosquitoes (Aedes aegypti Formosus) as vectors of human immunodeficiency virus. AIDS 1:171174.
  • Karunaratne SHPP, Damayanthi BT, Fareena MHJ, Imbuldeniya V, Hemingway J. 2007. Insecticide resistance in the tropical bedbug Cimex hemipterus. Pest Biochem Physiol 88:102107.
  • Liu N, Xu Q, Zhu F, Zhang L. 2006. Pyrethroid resistance in mosquitoes. Insect Sci 13:159166.
  • Mallis A, Miller AC. 1964. Prolonged resistance in the house fly and bed bug. J Econ Entomol 57:608609.
  • Montes C, Cuadrillero C, Vilella D. 2002. Maintenance of a laboratory colony of Cimex lectularius (Hemiptera: Cimicidae) using an artificial feeding technique. J Med Entomol 39:675679.
  • Moore DJ, Miller DM. 2006. Laboratory evaluations of insecticide product efficacy for control of Cimex lectularius. J Econ Entomol 99:20802086.
  • Myamba J, Maxwell CA, Asidi A, Curtis CF. 2002. Pyrethroid resistance in tropical bedbugs, Cimex hemipterus, associated with use of treated bednets. Med Vet Entomol 16:448451.
  • Nagem RL, Williams P. 1992. Susceptibility tests of the bedbug, Cimex lectularius L. (Hemiptera: Cimicidae) to DDT in Belo Horizonte, MG (Brazil). Rev Saude Publica 26:125128.
  • Potter MF. 2005. A bed bug state of mind: emerging issues in bed bug management. Pest Control Technol 33:8285, 88, 90, 92–93, 96–97.
  • Potter MF. 2006. The perfect storm: an extension view on bed bugs. Am Entomol 52:102104.
  • Pritchard MJ, Hwang SW. 2009. Severe anemia from bedbugs. Can Med Assoc J 181:287288.
  • Romero A, Potter MF, Potter DA, Haynes KF. 2007. Insecticide resistance in the bed bug: a factor in the pest's sudden resurgence? J Med Entomol 44:175178.
  • Romero A, Potter MF, Haynes KF. 2009. Evaluations of piperonyl butoxide as a deltamethrin synergist for pyrethroid–resistant bed bugs. J Econ Entomol 102:23102315.
  • Soderlund D. 2005. Sodium channels. In: GilbertLI, IatrouK, GillSS, editors. Comprehensive molecular insect science. Amsterdam: Elsevier B.V. p 124.
  • Venkatachalam PS, Beldavady B. 1962. Loss of haemoglobin iron due to excessive biting by bedbugs. Trans R Soc Trop Med Hyg 56:218221.
  • Vontas JG, Small GJ, Hemingway J. 2001. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens. Biochem J 357:6572.
  • Yoon KS, Kwon DH, Strycharz JP, Hollingsworth CS, Lee SH, Clark JM. 2008. Biochemical and molecular analysis of deltamethrin resistance in the common bed bug (Hemiptera: Cimicidae). J Med Entomol 45:10921101.
  • Young SJ, Gunning RV, Moores GD. 2005. The effect of piperonyl butoxide on pyrethroid-resistance-associated esterases in Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). Pest Manag Sci 61:397401.