SEARCH

SEARCH BY CITATION

Keywords:

  • Bactrocera dorsalis;
  • fat body;
  • differential gene expression;
  • cytochrome P450 monooxygenases

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

The sexual difference in gene expression in fat body between 8- and 10-day-old male and female Bactrocera dorsalis was examined using suppression subtractive hybridization. A total of 952 clones were sequenced and searched using BLAST from the subtracted cDNA library. About 22% of these clones showed homology with detoxification enzymes including cytochrome P450 monooxygenases (CYPs) and glutathione S-transferase. NADH dehydrogenases, distributed to energy metabolism, constituted about 9% of these clones. About 10% of these clones were cecropin, an antimicrobial peptide. Real-time quantitative polymerase chain reaction (qPCR) analysis showed that four transcripts were expressed at a higher level in fat body of males, compared to females. Bactrocera dorsalis cyp6g2 (Bdcyp6g2) was cloned (accession number KF469179) and the temporal profile of transcriptional expression showed that Bdcyp6g2 mRNA increased with age in males from day 3 after eclosion, but only on days 0–3 in females. Compared to females, the susceptibility of 9-day-old males to three insecticides was significantly less. These results suggested the genes expressed at a higher level in male act in its survival.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

The insect fat body plays many roles, including synthesis of yolk protein precursors for oocyte maturation, storage and release of energy in response to changing physiological states, synthesis of detoxification enzymes, and synthesis of antimicrobial peptides (AMPs) in response to infection (Arrese and Soulages, 2010). In particular, the insect fat body is the major tissue of intermediary metabolism where most hemolymph proteins are synthesized. Increasing expression of metabolic detoxification enzymes in fat body may increase insect resistance to insecticides. Insects defend themselves against pesticides through an elaborate three-phase detoxification system (Xu et al., 2005). Phase I enzymes consist of cytochrome P450 monooxygenases (CYPs), which decrease the biological activity of a broad range of substrates. The phase II enzymes act on the toxic by-products of the phase I response and include glutathione S-transferases (GSTs), uridine 5′-diphospho (UDP)-glucuronosyltansferases, and N-acetyltransferases. The CYPs and GSTs are large families of multifunctional enzymes involved in the metabolism of insecticides (Feyereisen, 2005). CYPs act in the metabolic resistance to a range of insecticide classes including pyrethroids, organochlorides, neonicotinoids, organophosphates, carbamates, and insect growth regulators (Li et al., 2007). The activities of GSTs are associated with resistance to all major classes of insecticides including DDT (Ortelli et al., 2003), organophosphates (Huang et al., 1998; Wei et al., 2001), and pyrethroids (Vontas et al., 2001).

In addition to expression of insecticide detoxification enzymes, the fat body synthesizes AMPs in response to microbial infection. AMPs are rapidly and transiently synthesized mainly by the fat body and other epithelia (Tzou et al., 2002). Most AMPs are thought to disrupt the permeability of bacterial cytoplasmic membranes (Lemaitre and Hoffmann, 2007). The AMP, cecropin, was first isolated from the moth Hyalophora cecropia (Steiner et al., 1981). Cecropins have been identified in many insect species and in mammals; they are active against Gram-positive and Gram-negative bacteria by creating channels in their lipid bilayer (Lemaitre and Hoffmann, 2007).

The regional and developmental differences in structure and function of the fat body have been studied in Lepidoptera and Diptera (Haunerland and Shirk, 1995). Segregation of synthesis and storage functions is associated with the developmental stages and location within the fat body. However, sexual differences in gene expression within the fat body remain understudied. This may be a crucial issue because male and female animals are not merely reproductive partners, but separate genders, each with its individual evolutionary history. Their individual histories prompted us to pose the hypothesis that fat body gene expression differs in males and females. Here, we report the outcomes of experiments designed to test our hypothesis in the oriental fruit fly, Bactrocera dorsalis, one of the most destructive pests of fruit crops worldwide.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

Insects

The oriental fruit fly, B. dorsalis, colony was obtained from Bureau of Animal and Plant Health Inspection and Quarantine in Taichung, Taiwan, and has been raised for over 1 year in the laboratory. The flies were housed in cages (35 × 35 × 28 cm) and fed with a mixture of sucrose:yeast extract:peptone = 3:1:1 and water ad libitum. Larvae were reared on an artificial diet (Chiu, 1978). The rearing conditions were 28 ± 1°C, 50 ± 5% r.h., and a 12:12 h photoperiod.

Suppression Subtractive Hybridization and Library Construction

The subtraction was performed using a PCR-Select™ cDNA Subtraction Kit (Clontech, Mountain View, CA) according to the manufacturer's instructions. The mRNA was isolated from total RNA using a Dynabeads® mRNA Purification Kit (Invitrogen, Carlsbad, CA) from fat bodies of 8- to 10-day-old adults. The mRNA (1 μg) was used to synthesize cDNA for the subtraction. The cDNA synthesized from males was used as the tester, and female cDNA as the driver. The cDNA samples were digested with RsaI and tester cDNA was separated into two groups and ligated with two different adapters, respectively, for further hybridization. In the first hybridization, two groups of tester cDNA were hybridized with an excess of driver cDNA at 68°C for 8 h to enrich the differentially expressed sequences. In the second hybridization, both of the previous reactions were hybridized together in the presence of fresh driver cDNA at 68°C for overnight. After the second hybridization, the subtracted products were amplified by PCR using primers complementary to adapters (applied by the kit). PCR parameters were 75°C for 5 min, 94°C for 25 s, 27 cycles of 94°C for 10 s, 66°C for 30 s, and 72 °C for 1.5 min. A nested PCR reaction of 12 cycles of 94°C for 10 s, 68°C for 30 s, and 72 °C for 1.5 min was carried out. The subtracted PCR products were cloned into the pGEM®-T Easy Vector System I (Promega, Madison, WI), and transformed into Escherichia coli HIT-DH5 α strain (Tri-I Biotech, Taipei, Taiwan). The white colonies were checked by PCR with vector specific primers and electrophoresed on 1% agarose gel. Nine hundred and fifty-two insert-included clones were sequenced using ABI PRISM Big Dye Terminator Cycle sequencing Core kit with AmpliTaq DNA polymerase (ABI, Foster City, CA), performed by Tri-I Biotech. The sequence results were compared with the protein database using BLAST (Altschul et al., 1997) at the National Center for Biotechnology Information (NCBI).

cDNA Cloning of Cytochrome P450 cyp6g2

The 5′ and 3′ ends of the cyp6g2 cDNA were synthesized using the GeneRacer™ kit (Invitrogen). The first-strand cDNA was synthesized from 1 μg of total RNA from the fat body of 8-day-old B. dorsalis male following the manufacturer's instructions. Specific primers were designed based on the sequence of 339-bp fragment from the subtracted cDNA library. The antisense primer for the 5′ RACE PCR was 5′-AACATTCTCATCGACCACTTAATCTC-3′, and sense primer for the 5′ RACE PCR was the GeneRacer™ 5′ Primer. The sense primer for the 3′ RACE PCR was 5′-GAATGCCTATATGCCCTTCGG-3′, and antisense primer for the 3′ RACE was the GeneRacer™ 3′ Primer. RACE PCR products were cloned and sequenced and encompassed the full-length of cyp6g2 cDNA.

Real-Time Quantitative RT-PCR (qPCR)

We used qPCR to record the transcript levels of cyp6g2, GST, NADH dehydrogenase, and cecropin of 8- to 10-day-old B. dorsalis male and female fat bodies; and the temporal regulation of cyp6g2 in B. dorsalis male and female adults. The first-strand cDNA was synthesized from 1 μg of total RNA with SuperScript™ III First-Strand Synthesis SuperMix for qRT-PCR kit (Invitrogen). qPCR reactions were performed using the iCycler® iQ5 system (Bio-Rad, Hercules, CA) with SYBR® GreenER™ qPCR SuperMix for iCycler® (Ivitrogen). The specific primers are listed in Table 1. The PCR parameters were 50°C for 2 min; 95°C for 8 min, 30 s; 40 cycles of 95°C for 10 s, and 56°C for 30 s. A melting curve analysis was carried out for each test to check the specificity of the amplification. Three independent biological replicates of each treatment were performed and normalized to the internal control of β-actin expression. The qPCR data were collected using the Bio-Rad iQ5 2.0 Standard Edition Optical System Software V2.0. Statistical analyses were performed using Prism 5.0 (GraphPad Software, San Diego, CA). The data of cyp6g2, GST, NADH dehydrogenase, and cecropin transcript levels were analyzed by Student's t-test. The data of temporal expression were analyzed by ANOVA followed by a Tukey multiple comparison test. A value of P < 0.05 was considered statistically significant.

Table 1. Sequences of Primers Used in qPCR
GeneForward primerReverse primer
Actinccccaccagagcgtaaatactccggcctgggccggattcatcg
Cyp6g2gaatgcctatatgcccttcggcggagtcttttcacatggcgt
Gstaggtgttgatgaactgaagaaagtcagcgacataattccaaagccg
Cecropincttcatcttcttggccgtggtgattgaatggcggcatctctggtatg
NADH dehydrogenaseccactgggttgactgtctgttattctcctcgcaatataactcaaccttcatc

Insecticides

Deltamethrin (980 g/kg), technical grade, was provided by Polymax Chemical Mfg. Co., Ltd. (Taipei, Taiwan). Technical permethrin (920 g/kg) was provided by Sinon Corporation (Taichung, Taiwan). Bendiocarb (970 g/kg), technical grade, was given by Kuo Ching Chemical Co., Ltd. (Taichung, Taiwan). Spinosad (800 g/kg, Entrust®) was provided by Dow AgroSciences LLC (Indianapolis, IN).

Bioassays

The susceptibility of male and female 9-day-old adults to insecticides was determined with topical application. Permethrin, deltamathrin, and bendiocard were diluted in acetone and spinosad was diluted in water at the selected concentrations. The flies were anesthetized on ice. One microliter of working insecticide solutions was dropped on the ventral side of abdomens. After the solvent was evaporated, the flies were transferred to a plastic cup (250 ml capacity). Twenty flies were treated for each concentration. Flies treated with each concentration in three independent biological replicates were held at 28 ± 1°C, 50 ± 5% r.h., and a 12:12 h photoperiod for 24 h before assessment.

Data Analysis

After 24 h of insecticide treatments, fly mortality, as shown by no response to touching, was recorded. Mortality data were analyzed using probit analysis (Finney, 1971), which was developed into a computer program by the Department of Entomology, National Chung Hsing University (Chi, 2009). The program provides the linearity of dose–mortality and determines slope, lethal dose (LD), 95% fiducial limits of LD50, and chi-square of each line tested. Student's t-test was applied to compare the LD50 of males and females.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

Subtracted cDNA Library from Male Fat Body

A total of 952 clones were sequenced from the subtracted cDNA library. The BLAST results of the 952 sequenced clones showing similarity with other genes in GenBank database are summarized in Table 2. The most frequently found expressed sequence tag (EST) was cytochrome P450–6g2 (cyp6g2) as 202 clones (21.2%). One and five clones correspond to the other two detoxifying enzymes, cyp4g1 and GST. In the enzyme category, there were 80 clones (8.4%) of NADH dehydrogenase subunit 5 and four clones of NADH dehydrogenase subunit 4 (0.4%). The other frequently found gene was cecropin as 93 clones (9.8%). There were 53 clones (5.6%) of a serine protease inhibitor, serpin, placed in the immunity category. Sixty-four (6.7%) and two (0.2%) clones corresponded to anterior fat body protein and arylphorin receptor. Both of them are arylphorin receptors. A total of 422 clones (44.4%) were others, hypothetical proteins, and of nonhomology.

Table 2. List of Subtracted cDNA Clones Showing Similarity with NCBI Database
CategoryAccession no.Size (bp)HomologyE valueNumber (%)
  1. a

    The mitochondrial sequence <200 bp in length can be accepted only if it is from completed exon, noncoding RNA, microsatellite, or ancient DNA.

Enzyme    318 (33.3)
 JZ477751339Cyp6g21 × 1025202 (21.2)
 JZ477752572Cyp4g14 × 1061 (0.1)
 JZ477756304Glutathione S-transferase2 × 10225 (0.5)
 KF514115958NADH dehydrogenase subunit 58 × 1015280 (8.4)
 a170NADH dehydrogenase subunit 44 × 1074 (0.4)
 JZ477759321Aldo-keto reductase1 × 101626 (2.7)
Immunity    146 (15.4)
 JZ477753417Cecropin2 × 101693 (9.8)
 JZ477757534Serpin 27A isoform A8 × 10949 (5.2)
 JZ477762289Serine protease inhibitor 43Ab3 × 1084 (0.4)
Storage protein receptor    66 (6.9)
 JZ477754222Anterior fat body protein7 × 103064 (6.7)
 JZ477755504Arylphorin receptor5 × 10332 (0.2)
Others    50 (5.2)
 JZ477758696Translation elongation factor 1 γ1 × 1010327 (2.8)
 JZ477760168Translation initiation factor 2γ2 × 102813 (1.4)
 JZ477761519Odorant-binding protein 19d7 × 10176 (0.6)
 JZ477763688Bruchpilot2 × 10502 (0.2)
 JZ477764246Cytochrome c1 × 1071 (0.1)
 JZ477765323Cuticular protein 100A3 × 10271 (0.1)
Hypothetical protein    49 (5.2)
Unknown    323 (34.0)

qPCR

qPCR was carried out for four genes, cyp6g2, GST, NADH dehydrogenase, and cecropin (Fig. 1A–D). Overall, the results reflected the subtracted cDNA library. The transcript levels of the four genes were higher in males than in females. The GST, NADH dehydrogenase, and cecropin were expressed 2.0-, 2.4-, and 2.9-fold higher in males than in females, respectively. The result of cyp6g2 expression suggested it is male specific in 8- to 10-day-old adults. The DNA amplification of cyp6g2 was not detected even after 40 cycles of PCR amplification in females (Fig. 1E).

image

Figure 1. qPCR analysis of (A) cyp6g2, (B) gst, (C) NADH dehydragenase, and (D) cecropin in 8- to 10-day-old males and females. (E) Agarose electrophoresis of PCR-amplified cyp6g2 products in 8- to 10-day-old males and females. β-actin was used as reference gene. Standard deviation of three independent biological replicates is indicated by the error bars. *Significant difference (P < 0.05).

Download figure to PowerPoint

cDNA Cloning and Temporal Expression of the B. dorsalis cyp6g2

The full-length cDNA of the oriental fruit fly cyp6g2 was cloned from the abdomen of 8-day-old males using RACE. The 1,859 bp cDNA sequence (Fig. 2, GenBank accession number KF469179) contains an open-reading frame of 1,608 bp encoding a protein of 535 amino acid residues with a predicted molecular mass of 62 kDa. The deduced amino acid sequence shares high identity (81 and 51%, respectively) to Ceratitis capitata cyp6g2-like protein and D. melanogaster cyp6g2 (accession number XP_004522877.1 and AAR88134.1, respectively). According to the P450 nomenclature of Nelson (2006), the sequence was named Bdcyp6g2.

image

Figure 2. Nucleotide and deduced amino acid sequences of the putative cytochrome P450 monooxygenase cDNA from the B. dorsalis (GenBank accession number KF469179). Helix I motif, AGFET, is underlined. Helix K motif, EVLR, is indicated by gray background. Heme-binding motif is boxed.

Download figure to PowerPoint

Figure 3 shows that Bdcyp6g2 transcripts were mainly present in day 0 and day 1 females, and then the level decreased significantly on day 2. Transcripts could not be detected on day 4. Transcriptional expression of Bdcyp6g2 in males gradually increased from day 3 and reached the peak on days 9 and 10.

image

Figure 3. Temporal profiles of Bdcyp6g2 transcription in fat body of (A) male and (B) female of B. dorsalis 0–10 days after eclosion. qPCR shows the relative amount of amplified Bdcyp6g2 transcripts in comparison with amplified β-actin transcripts. Standard deviation of three independent biological replicates is indicated by the error bars. Same letters indicate no significant difference (P < 0.05).

Download figure to PowerPoint

Susceptibility of B. dorsalis Male and Female to Four Insecticides

As shown in Table 3, males were significantly more resistant than females to deltamethrin, bendiocarb, and spinosad (Student's t-test, P < 0.05). The relative resistance ratio was ca. 2.29, to deltamethrin. The bioassay with bendiocarb revealed that males were more resistant than females with a ratio of ca. 5.75. Males were most resistant to spinosad, its relative resistance ratio being ca. 9.21. However, the relative resistance ratio was only ca. 1.42 to permethrin.

Table 3. Susceptibility of 9-Day-Old B. dorsalis Males and Females to Four Insecticides
 LD50 (95% fiducial limits (FL)) μg/insect 
InsecticidesMale (♂)Female (♀)Ratio (♂/♀)
  1. a

    Males are significantly more resistant than females to these three insecticides (Student's t-test, P < 0.05).

Permethrin0.61 (0.48–0.87)0.43 (0.33–0.55)1.42
Deltamethrina19.28 (16.84–22.14)8.42 (5.70–11.46)2.29
Bendiocarba0.46 (0.39–0.56)0.08 (0.06–0.12)5.75
Spinosada5.62 (4.91–6.52)0.61 (0.31–0.94)9.21

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

The data reported in this article support our hypothesis that fat body gene expression differs in male and female oriental fruit flies. The most abundant clones from the subtracted cDNA library were Bdcyp6g2. The deduced amino acid sequence of the Bdcyp6g2 shares a number of common characteristics with other members of the P450 superfamily. The sequence FGIGPHNCIG (residues 470–479) matches the signature motif FxxGxxxCxG, which is the heme-binding region and is highly conserved among P450s. The EVLR at positions 388–391 is highly conserved (consensus ExxR) within the K helix which is a region N-terminus to the heme-binding region (Peterson and Graham-Lorence, 1995). AGFET at positions 330–334 is highly conserved (consensus (A/G)GxxT) within the I helix where T334 may function as a proton donor and/or an acid–base catalyst in oxygen scission (Wachenfeldt and Johnson, 1995).

Male-specific expression of cytochrome P450s has been reported in at least four other insect species, viz., the German cockroach, Blattella germanica (L.) (Wen and Scott, 2001); the fruit fly, Drosophila melanogaster (Le Goff et al., 2006); and two bark beetles, Ips pini and I. paraconfusus (Sandstrom et al., 2006; Huber et al., 2007). The functions of CYP6L1 and CYP312A1 in B. germanica and D. melanogaster, respectively, are not clear (Wen and Scott, 2001; Kasai and Tomita, 2003). The differential expression of Cyp9T2 and Cyp9T1 in the sexes of I. pini and I. paraconfusus, respectively, after feeding on host phloem suggests that these two genes are involved in male-specific aggregation pheromone production (Huber et al., 2007). The expression of Bdcyp6g2 was male-specific from day 4 to day 10 after eclosion in this study. In females, the expression of Bdcyp6g2 could not be detected after day 4. This finding is consistent with the change of fat body forms of B. dorsalis, from larval to adult (Zuo et al., 2013). Newly eclosed adults usually contain larval fat bodies that undergo cell death and are then replaced by adult fat bodies as they age. At 3 days posteclosion, they have both larval and adult fat body cells. By approximately 6 days posteclosion, their fat bodies are mostly in adult form. The function of the larval form is mostly for energy storage and mostly for protein synthesis in the adult form, particularly for protein synthesis to support ovarian development (Zuo et al., 2013). The expression of yolk protein increases from day 2 to a maximum on day 4 (Chen et al., 2012). The high level of yolk protein transcript expression matches the decrease of Bdcpy6g2 expression. We infer that females undergo a physiological trade-off, trading host defense functions for reproduction.

Bdcyp6g2 amino acid sequence shares high identity with D. melanogaster CYP6G2, which is involved in insecticide resistance (Daborn et al., 2007). Members of the CYP6 family may be involved in most cases of resistance mechanisms (Le Goff et al., 2003; Djouaka et al., 2008). In addition to Bdcyp6g2, another detoxification enzyme, GST, was expressed at a higher level in males, compared to females. The production of more GSTs and CYPs has been documented as a mechanism of resistance to organochlorines, organophosphates, carbamate, and pyrethroids (Li et al., 2007). The occurrence of higher LD50 values to bendiocarb and deltamethrin in males suggests to us that the possible function of Bdcyp6g2 is related to insecticide resistance. The putative molecular target of spinosad is the nicotinic acetylcholine receptor alpha 6 (Bdα6) (Hsu et al., 2012). However, we did not record the sequence of Bdα6 in this study. Nonetheless, we found that males were significantly more resistant to spinosad than females, with a resistance ratio approximately 9.21.

Transcripts of cecropin, a potent broad-spectrum AMP, were specifically enriched in the male fat body. Cecropins are a highly homologous group with more than 70% identity in their amino acid composition (Hetru et al., 2002). In Drosophila, the male reproductive tract expresses a number of AMP genes including cecropin, CecA1, and the male-specific andropin gene. These proteins reduce microbe transmission during copulation (Samakovlis et al., 1991). The relative expression of CecA1 is 100-fold higher and those of the DptA, AttA, AttB, and Drs genes are five- to 10-fold higher in males than in females (Junell et al., 2010). This may indicate a generally higher rate of cecropin gene expression in males and, again, a physiological trade-off in females. Serine protease inhibitors, or serpins, were expressed in males. These may serve to prevent the prophenoloxidase from becoming activated in the absence of infection.

Of the 952 transcripts up-regulated in male fat body, there were 84 (8.8%) clones of NADH dehydrogenase. NADH dehydrogenase can bypass or replace the proton-translocating complexes of the mitochondrial respiratory chain. It can provide an alternative respiratory chain when the normal one is limited by the action of toxins or other physiological restraints (Park et al., 2007). Expression of the yeast NADH dehydrogenase in Drosophila increases median, mean, and maximum lifespan independently of dietary restriction (Sanz et al., 2010). The longevity of B. dorsalis male adults is longer than females reared on different host fruits (Liu and Huang, 1990). The higher expression of NADH dehydrogenase may be attributed to the longer longevity of male flies, although this idea needs more research.

The higher levels of transcriptional expression of detoxification enzymes, NADH dehydrogenase, and cecropin in adult fat bodies of males suggest to us that these gene products act in survival of male adults. We also suggest that the sexual differential in gene expression documents a physiological trade-off between reproduction and host defense in females at the molecular level. This is consistent with expression of Bdcyp6g2 in female larval fat bodies but not in male ones.

ACKNOWLEDGMENTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED

We thank Dr. Roger F. Hou for critical reading of our manuscript.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. LITERATURE CITED
  • Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:33893402.
  • Arrese EL, Soulages JL. 2010. Insect fat body: energy, metabolism, and regulation. Annu Rev Entomol 55:207225.
  • Chen S-L, Lin C-P, Lu K-H. 2012. cDNA isolation, expression, and hormonal regulation of yolk protein genes in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). J Insect Physiol 58:763770.
  • Chi H. 2009. Computer program for Probit Analysis. http://140.120.197.173/Ecology/prod02.htm.
  • Chiu HT. 1978. Studies on the improvement of mass rearing for oriental fruit flies. Plant Prot Bull 20:8792. (in Chinese)
  • Daborn PJ, Lumb C, Boey A, Wong W, ffrench-Constant RH, Batterham P. 2007. Evaluating the insecticide resistance potential of eight Drosophila melanogaster cytochrome P450 genes by transgenic over-expression. Insect Biochem Mol Biol 37:512519.
  • Djouaka RF, Bakare AA, Coulibaly ON, Akogbeto MC, Ranson H, Hemingway J, Strode C. 2008. Expression of the cytochrome P450s, CYP6P3 and CYP6M2 are significantly elevated in multiple pyrethroid resistant populations of Anopheles gambiae s.s. from Southern Benin and Nigeria. BMC Genomics 9:538.
  • Feyereisen R. 2005. Insect cytochrome P.450. In: Gilbert L, Iatrou K, Gill SS, editors. Comprehensive molecular insect science. Oxford: Elsevier. p 177.
  • Finney DJ. 1971. Probit analysis. Cambridge: Cambridge University Press. 333 p.
  • Haunerland NH, Shirk PD. 1995. Regional and functional differentiation in the insect fat body. Annu Rev Entomol 40:121145.
  • Hetru C, Hoffmann JA, Hancock REW. 2002. In: Dutton DJ, Haxell MA, McArthur HII, Wax RG, editors. Peptide antibiotics. New York and Basel: Marcel Dekker Inc. p 117144.
  • Hsu J-C, Feng H-T, Wu W-J, Geib SM, Mao C-h, Vontas J. 2012. Truncated transcripts of nicotinic acetylcholine subunit gene Bdα6 are associated with spinosad resistance in Bactrocera dorsalis. Insect Biochem Mol Biol 42:806818.
  • Huang HS, Hu NT, Yao YE, Wu CY, Chiang SW, Sun CN. 1998. Molecular cloning and heterologous expression of a glutathione S-transferase involved in insecticide resistance from the diamondback moth, Plutella xylostella. Insect Biochem Mol Biol 28:651658.
  • Huber DPW, Erickson ML, Leutenegger CM, Bohlmann J, Seybold SJ. 2007. Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa. Insect Mol Biol 16:335349.
  • Junell A, Uvell H, Davis MM, Edlundh-Rose E, Antonsson Å, Pick L, Engström Y. 2010. The POU transcription factor Drifter/Ventral veinless regulates expression of Drosophila immune defense genes. Mol Cell Biol 30:36723684.
  • Kasai S, Tomita T. 2003. Male specific expression of a cytochrome P450 (Cyp312a1) in Drosophila melanogaster. Biochem Biophys Res Commun 300:894900.
  • Le Goff G, Boundy S, Daborn PJ, Yen JL, Sofer L, Lind R, Sabourault C, Madi-Ravazzi L, ffrench-Constant RH. 2003. Microarray analysis of cytochrome P450 mediated insecticide resistance in Drosophila. Insect Biochem Mol Biol 33:701708.
  • Le Goff G, Hilliou F, Siegfried BD, Boundy S, Wajnberg E, Sofer L, Audant P, ffrench-Constant RH, Feyereisen R. 2006. Xenobiotic response in Drosophila melanogaster: sex dependence of P450 and GST gene induction. Insect Biochem Mol Biol 36:674682.
  • Lemaitre B, Hoffmann J. 2007. The host defense of Drosophila melanogaster. Annu Rev Immunol 25:697743.
  • Li XC, Schuler MA, Berenbaum MR. 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu Rev Entomol 52:231253.
  • Liu Y-C, Huang L-H. 1990. The demographic parameters of Dacus doraslis Hendel based on the hostfoods factor effects. Chinese Entomol 10:279299. (in Chinese with English abstract).
  • Nelson DR. 2006. Cytochrome P450 Nomenclature, 2004. In: Phillips IR, Shephard EA, editors. Cytochrome p450 protocols. NJ: Human Press. p 110.
  • Ortelli F, Rossiter LC, Vontas J, Ranson H, Hemingway J. 2003. Heterologous expression of four glutathione transferase genes genetically linked to a major insecticide-resistance locus from the malaria vector Anopheles gambiae. Biochem J 373:957963.
  • Park JS, Li YF, Bai Y. 2007. Yeast NDI1 improves oxidative phosphorylation capacity and increases protection against oxidative stress and cell death in cells carrying a Leber's hereditary optic neuropathy mutation. Biochim Biophys Acta 1772:533542.
  • Peterson JA, Graham-Lorence S. 1995. Bacterial P450s: structural similarities and functional differencies. In: Ortiz de Montellano PR, editor. Cytochrome P450: structure, mechanism, and biochemistry. New York: Plenum Press. p 151180.
  • Samakovlis C, Kylsten P, Kimbrell DA, Engström A, Hultmark D. 1991. The andropin gene and its product, a male-specific antibacterial peptide in Drosophila melanogaster. EMBO J 9:29692976.
  • Sandstrom P, Welch WH, Blomquist GJ, Tittiger C. 2006. Functional expression of a bark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol. Insect Biochem Mol Biol 36:835845.
  • Sanz A, Soikkeli M, Portero-Otin M, Wilson A, Kemppainen E, Mcllroy G, Ellilä S, Kemppainen KK, Tuomela T, Lakanmaa M, Kiviranta E, Stefanatos R, Dufour E, Hutz B, Naudi A, Jové M, Zeb A, Vartiainen S, Matsuno-Yagi A, Yagi T, Rustin P, Pamplona R, Jacobs HT. 2010. Expression of the yeast NADH dehydrogenase Ndi1 in Drosophila confers increased lifespan independently of dietary restriction. Proc Natl Acad Sci USA 107:91059110.
  • Steiner H, Hultmark D, Engström A, Bennich H, Boman HG. 1981. Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature 292:246248.
  • Tzou P, De Gregorio E, Lemaitre B. 2002. How Drosophila combats microbial infection: a model to study innate immunity and host:pathogen interactions. Curr Opin Microbiol 5:102110.
  • Vontas JG, Small GJ, Hemingwas J. 2001. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens. Biochem J 357:6572.
  • Wachenfeldt CV, Johnson EF. 1995. Structure of eukaryotic cytochrome P450 enzymes. In: Ortiz de Montellano PR, editor. Cytochrome P450: structure, mechanism, and biochemistry. New York: Plenum Press. p 182223.
  • Wei SH, Clark AG, Syvanen M. 2001. Identification and cloning of a key insecticide-metabolizing glutathione S-transferase (MdGST-6A) from a hyper insecticide-resistant strain of the housefly Musca domestica. Insect Biochem Mol Biol 31:11451153.
  • Wen Z, Scott, JG. 2001. Cytochrome P450 CYP6L1 is specifically expressed in the reproductive tissues of adult male German cockroaches, Blattella germanica (L.). Insect Biochem Mol Biol 31:179187.
  • Xu C, Li CY, Kong AN. 2005. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch Pharm Res 28:249268.
  • Zuo Y-H, Lu K-H, Chen M-E. 2013. Characteristics and gene expression of fat body in adult oriental fruit fly, Bactrocera dorsalis. Formosan Entomol 33:91106 (in Chinese with English abstract).