Reduction of CpG-induced arthritis by suppressive oligodeoxynucleotides

Authors


  • The assertions expressed herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Food and Drug Administration.

Abstract

Objective

Bacterial DNA contains immunostimulatory CpG motifs that cause inflammation when injected into the knee joints of normal mice. We examined whether synthetic oligodeoxynucleotides (ODN) that suppress CpG-induced immune responses prevent CpG-induced arthritis.

Methods

CpG, suppressive, and/or control ODN were injected into the knees of BALB/c mice. Joint swelling and inflammation were evaluated by physical measurement, by histologic analysis of joint tissue, and by magnetic resonance imaging.

Results

Immunostimulatory CpG DNA induced local arthritis, characterized by swelling of the knee joints, the presence of inflammatory cell infiltrates, the perivascular accumulation of mononuclear cells, and hyperplasia of the synovial lining. Administering suppressive (but not control) ODN reduced the manifestations and severity of arthritis up to 80%.

Conclusion

Suppressive ODN may be useful for the prevention or treatment of arthritis induced by bacterial DNA.

Microbial infection of the gastrointestinal (GI) or genitourinary (GU) tracts is associated with the development of reactive arthritis in humans. Evidence suggests that bacterial DNA may contribute to this process, since 1) bacterial DNA can be detected in arthritic joints (1), and 2) bacterial DNA induces joint inflammation when injected into the knees of normal mice (2). Deng et al established that immunostimulatory CpG motifs were the cause of this inflammation, by showing that CpG-containing oligodeoxynucleotides (ODN) induced disease in a manner similar to that induced by purified bacterial DNA (2). This effect is consistent with the proinflammatory properties of CpG ODN, including their ability to stimulate immune cells to proliferate, differentiate, and secrete proinflammatory chemokines and cytokines (2, 3).

A novel class of neutralizing, also referred to as suppressive, ODN was identified by Krieg et al (4). These suppressive ODN were observed to specifically inhibit the immune activation elicited by CpG DNA (4, 5). Synthetic ODN expressing suppressive motifs can block CpG-induced cytokine production in vitro and adjuvant activity in vivo (4). We examined whether suppressive ODN could be used to prevent or treat CpG-induced arthritis.

MATERIALS AND METHODS

Animals

Female BALB/c mice were obtained from Jackson Laboratories (Bar Harbor, ME). Center for Biologics Evaluation and Research (CBER) Animal Care and Use Committee–approved studies were conducted using 8–20-week-old mice.

Oligodeoxynucleotides

ODN were synthesized at the CBER Core Facility. Sequences of the phosphorothioate ODN used were as follows: CpG ODN GCTAGACGTTAGCGT, suppressive ODN CCTCAAGCTTGAGGGG, and control (non-CpG) ODN GCTAGATGTTAGCGT. All ODN were free of detectable endotoxin contamination.

Experimental protocol

Twenty-five micrograms of ODN in 6 μl of phosphate buffered saline (PBS) was injected into the knee joint using a 30-gauge needle. In some studies, knees were reinjected with PBS alone or 25 μg of suppressive ODN 24–48 hours after the initial CpG-ODN administration. Joint swelling was measured in the coronal plane using a micrometer caliper. Histologic analysis was performed 4 days after treatment by a blinded investigator (DV) on fixed, decalcified, and paraffin-embedded sections that were stained with hematoxylin and eosin, and an inflammation score was assigned (scale 0–3).

Tumor necrosis factor α (TNFα) assays

Single spleen-cell suspensions were prepared in RPMI 1640 supplemented with 5% heat-inactivated fetal calf serum, 1.5 mML-glutamine, and 100 units/ml of penicillin/streptomycin. Cells (5 × 105 cells/well) were cultured in flat-bottomed microtiter plates (Costar, Corning, NY) with 1 μM of various ODN or PBS for 72 hours. TNFα levels in culture supernatants were measured by enzyme-linked immunosorbent assay (6). In brief, 96-well Immulon H2B plates were coated with anti-TNFα antibody (Genzyme, Cambridge, MA). Plates were blocked with PBS–1% bovine serum albumin and overlaid with culture supernatants. Bound cytokine was detected by the addition of biotin-labeled anti-TNFα antibody (Genzyme) followed by phosphatase-conjugate avidin.

Reverse transcription–polymerase chain reaction (PCR)

Total RNA was extracted from homogenized knees using TRIzol reagent (Gibco Life Technologies, Gaithersburg, MD) as recommended by the manufacturer. Five micrograms of total RNA was reverse transcribed into complementary DNA, which was assayed for TNFα (sense ATGAGCACAGAAAGCATGATC, antisense TACAGGCTTGTCACTCGAATT; 275 bp) and β-actin (sense GACATGGAGAAGATCTGGCAACCACA, antisense ATCTCCTGCTCGAAGTCTAGAGCAA; 440 bp) by PCR as previously described (7). Relative band intensity was determined by ethidium bromide staining of 1% agarose gels using National Institutes of Health Image software.

Quantification of arthritis by magnetic resonance imaging (MRI)

Images of the joints of anesthetized mice were acquired with a 3-dimensional (3D) gradient-echo sequence (4 averages, field of view 2 cm, 256 × 96 × 96, repetition time/echo time 50/5 msec) on a Bruker Avance 4.7T imager using a 2-cm diameter surface coil. Signal intensity, which reflects the accumulation of fluid in the joint, was measured over the joint cavity on corresponding sagittal slides reconstructed from the 3D data set (256 × 128 × 128).

Statistical analysis

Statistically significant differences between 2 groups were determined using Wilcoxon's rank sum test. When comparing >2 groups, a nonparametric 2-tailed analysis of variance (ANOVA) with Dunn's posttest analysis was used. Differences in joint diameters were analyzed by repeated-measures ANOVA using the SAS Proc Mixed procedure (SAS, Cary, NC). P values less than 0.05 were considered significant.

RESULTS

Induction of arthritis by CpG ODN.

Consistent with the findings of Deng and Tarkowski (8), BALB/c knees injected with CpG ODN developed inflammatory arthritis within 24 hours, which peaked after 3–7 days (Figure 1). CpG-induced arthritis was characterized by knee swelling (mean ± SEM diameter 0.14 ± 0.04 mm versus 0.01 ± 0.02 mm in knees injected with control ODN; P = 0.005) and histologic changes that included perivascular infiltration by mononuclear cells and hyperplasia of the synovial lining (Figures 1 and 2). These inflammatory effects were CpG specific and localized, since no disease was observed in the contralateral knees injected with PBS or control ODN. Similar swelling and histologic changes were observed in knees injected with bacterial DNA (data not shown).

Figure 1.

Twenty-five micrograms of various oligodeoxynucleotides (ODN) (alone or in combination) was injected into the knee joint of BALB/c mice. A, Joint swelling was evaluated in mice (n = 8–11 mice/group) treated with CpG ODN (•), CpG plus control (non-CpG) ODN (▪), CpG plus suppressive (Sup), ODN (◊), control ODN (▵), suppressive ODN (▿), or phosphate buffered saline (PBS) (□). B, Histologic changes were evaluated 4 days after treatment by a blinded investigator using a scale of 0 = no inflammation, 1 = sparse, localized perivascular infiltrate, 2 = moderate infiltrate, 3 = moderate–dense infiltrate with synovial hyperplasia. C, Both knees were injected at T = 0 with 25 μg of CpG ODN. From 0 to 48 hours later, the left knee was injected with PBS and the right knee with 25 μg of suppressive ODN. Results show the mean difference in swelling between the 2 knees following reinjection at T = 0 (•; n = 3), T = 24 hours (▪; n = 6), or T = 48 hours (▴; n = 6). Statistical significance was assessed by repeated-measures analysis of variance using the Proc Mixed procedure (A and C) and Wilcoxon's rank sum test (B). Bars show the mean ± SEM. ∗ = P < 0.05 versus CpG ODN plus suppressive ODN–treated knees.

Figure 2.

BALB/c knees were injected with PBS (A and B), CpG ODN (C and D), CpG plus control ODN (E and F), or CpG plus suppressive ODN (G and H). The typical histologic findings at 4 days after injection of 25 μg of each ODN are shown. Note the cellular infiltrates, perivascular accumulation of mononuclear cells, and hyperplasia of the synovial lining in the knees of mice injected with CpG ODN. Original magnification × 100 in A, C, E, and G; × 400 (magnification of inset area) in B, D, F, and H. See Figure 1 for definitions.

Effects of suppressive ODN on the development of CpG-induced arthritis.

To determine whether suppressive ODN prevent CpG-mediated inflammatory arthritis, knees were coinjected with 25 μg of suppressive ODN plus 25 μg of CpG ODN. The inclusion of suppressive ODN reduced swelling from 0.14 ± 0.04 mm to 0.02 ± 0.02 mm (P = 0.004) and the inflammatory score from a mean ± SEM of 1.94 ± 0.32 to 0.67 ± 0.12 (P = 0.018) (Figure 1). When joint inflammation was assessed by MRI, CpG ODN increased fluid accumulation from a mean ± SEM of 48.3 ± 7.6 MR-signal intensity units in PBS-injected knees to 95.4 ± 8.2 units in the CpG ODN–injected knees; coadministration of suppressive ODN reduced CpG ODN–induced fluid accumulation to 52.3 ± 6.8 units (n = 4; P < 0.01). These effects were specific to CpG, since coadministering PBS or control ODN had no impact on CpG-induced arthritis (Figures 1 and 2). In parallel studies, suppressive ODN prevented the arthritis induced by bacterial DNA, but not that induced by lipopolysaccharide (data not shown).

To examine the kinetics of this antiinflammatory effect, suppressive ODN were administered 0, 24, and 48 hours after CpG-ODN injection. To control for the effect of multiple injections, the contralateral knee was injected with PBS, and the difference in swelling between the 2 joints was evaluated daily. There was a significant reduction in the swelling of joints treated with suppressive ODN up to 48 hours after CpG-ODN administration (P = 0.012) (Figure 1C). However, maximal control of arthritis required early intervention (P = 0.011, 0 hours versus 48 hours postinjection).

Reduction of intraarticular TNFα production by suppressive ODN.

Previous studies established that the magnitude of CpG-induced arthritis correlated with intraarticular TNFα levels (9). Consistent with the possibility of TNFα playing a critical role in the disease process, it has been shown that TNFα-knockout mice fail to develop CpG-induced arthritis (8). To evaluate whether suppressive ODN had an effect on TNFα production, BALB/c spleen cells were stimulated in vitro with CpG with or without suppressive ODN. As seen in Figures 3A and B, suppressive ODN reduced TNFα production in a dose-dependent manner, whereas control ODN had no effect.

Figure 3.

Tumor necrosis factor α (TNFα) levels in supernatants of cell cultures were measured by enzyme-linked immunosorbent assay. A, BALB/c spleen cells were stimulated in vitro for 72 hours with 1 μM of various ODN or PBS. n.d. = not detected. Statistical significance was assessed by Wilcoxon's rank sum test. B, RAW 264.7 spleen cells (106/well) were stimulated for 24 hours with 1 μM CpG plus increasing amounts of suppressive ODN. % max = maximum production. C, Joints injected with 25 μg of ODN were processed into RNA on day 3. Representative examples of local TNFα and β-actin mRNA levels are shown. D, Relative intensity of TNFα mRNA (relative to β-actin mRNA) (n = 3). Data represent the mean and SEM of 5 independently studied animals/group. ∗ = P < 0.05 versus knees treated with CpG ODN plus suppressive ODN. See Figure 1 for other definitions.

To monitor the in vivo effect of suppressive ODN on TNFα production, cytokine messenger RNA (mRNA) levels were measured in the joint. Consistent with the findings in earlier reports (8–11), CpG ODN up-regulated local TNFα mRNA levels (Figures 3C and D). Coadministering suppressive ODN reduced TNFα mRNA levels by >50% (P < 0.003) (Figure 3D).

DISCUSSION

DNA containing unmethylated CpG motifs triggers an immune response characterized by the production of proinflammatory chemokines and cytokines. This immune response benefits the host by reducing susceptibility to bacterial infection, but unfortunately may trigger or exacerbate organ-specific autoimmune disease (such as experimental allergic encephalomyelitis and arthritis) (2, 12). This study is the first to demonstrate that suppressive ODN can effectively treat the immunopathologic process induced by CpG DNA.

Krieg et al were the first to document the existence of suppressive, or neutralizing DNA motifs (i.e., GGCCGG; GCGCGC; GCGGCG) (4). They showed that suppressive ODN could reduce CpG-mediated immune stimulation in vitro, and block the adjuvant effects of CpG DNA in vivo (4). Our work examined whether suppressive ODN could reduce the duration or severity of CpG-mediated arthritis in mice. Results, shown in Figures 1 and 2, demonstrate that suppressive ODN significantly decreased the joint swelling and histopathologic changes elicited by CpG DNA (P < 0.0001, r = 0.59 by Pearson correlation). Although suppressive ODN were most effective when administered immediately after the joint was exposed to CpG DNA, a significant reduction in swelling was observed when suppressive ODN were delivered up to 2 days later, after joint swelling became manifest (Figure 1C). In all of these studies, the observed effects were motif specific, since control ODN had no effect on the magnitude or duration of disease.

It remains a matter of conjecture whether human autoimmunity is caused or exacerbated by CpG motifs in bacterial DNA. Although reactive arthritis is temporally associated with bacterial infection of the GI or GU tracts (13), evidence that bacterial DNA plays a role in this disease remains circumstantial. Nevertheless, it is intriguing that bacterial DNA can be detected in inflamed joints (14), and that bacterial DNA up-regulates the production of cytokines (such as TNFα) that are commonly present in inflamed joints (13, 15). Although the mechanism by which suppressive ODN block CpG induced activation is uncertain, Deng and Tarkowski established that local TNFα contributes to the development of arthritis in murine models (8), and in the present study, we have shown that suppressive ODN significantly reduced CpG-dependent TNFα production (Figure 3).

Although caution must be exercised in applying results from animal experiments to humans, ongoing studies indicate that suppressive ODN inhibit the activity of murine and human immune cells equally well. Of note, suppressive ODN had no adverse effects in our studies, with all injected animals remaining physically vigorous and healthy. If further research confirms that treatment with suppressive ODN is safe and effective in animal models, clinical studies designed to evaluate their utility for the treatment of human arthritis should be considered.

Acknowledgements

We thank E. Romano, PhD, for help and advice in the statistical evaluation of the data.

Ancillary