SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Objective

A characteristic feature of the inflammatory infiltrate in rheumatoid arthritis is the segregation of CD4 and CD8 T lymphocyte subsets into distinct microdomains within the inflamed synovium. The aim of this study was to test the hypothesis that chemokines in general and stromal cell–derived factor 1 (SDF-1; CXCL12) in particular are responsible for generating this distinctive microcompartmentalization.

Methods

We examined how synovial CD4/CD8 T cell subsets interacted in coculture assays with fibroblasts derived from chronic inflammatory synovial lesions and normal synovial tissue as well as from fetal lung and adult skin. We used the ability of T cells to migrate beneath fibroblasts (a process called pseudoemperipolesis) as an in vitro marker of T cell accumulation within synovial tissue.

Results

Rheumatoid fibroblast-like synoviocytes (FLS) displayed a unique ability to support high levels of CD4 and CD8 T cell pseudoemperipolesis. Nonrheumatoid FLS as well as fetal lung fibroblasts supported low levels of pseudoemperipolesis, while skin-derived fibroblasts were unable to do so. CD8 T cells migrated under fibroblasts more efficiently and at a higher velocity than CD4 T cells, a feature that was intrinsic to CD8 T cells. Rheumatoid fibroblasts constitutively produced high levels of SDF-1 (CXCL12), which was functionally important, since blocking studies showed reductions in T cell pseudoemperipolesis to levels seen in nonrheumatoid FLS. Rheumatoid fibroblasts also constitutively produced high levels of vascular cell adhesion molecule 1 (VCAM-1; CD106), but this did not contribute to T cell pseudoemperipolesis, unlike the case for B cells, which require SDF-1 (CXCL12)–CXCR4 and CD49d–VCAM-1 (CD106) interactions. Importantly, only combinations of rheumatoid FLS and rheumatoid-derived synovial fluid T cells supported pseudoemperipolesis when examined ex vivo, confirming the in vivo relevance of these findings.

Conclusion

These studies demonstrate that features intrinsic to both fibroblasts (the production of SDF-1) and CD8/CD4 T cells (the expression of CXCR4) are responsible for the characteristic pattern of T lymphocyte accumulation seen in the rheumatoid synovium. These findings suggest that the SDF-1/CXCR4 ligand/receptor pair is likely to play an important functional role in T lymphocyte accumulation and positioning within the rheumatoid synovium.

Rheumatoid arthritis (RA) is characterized by hyperplasia of synovial tissue and by the accumulation of large numbers of leukocytes within the inflamed synovium (1, 2). Despite considerable efforts, the contribution of individual leukocyte subsets and stromal elements to the pathogenesis of the disease remains elusive (3). T lymphocytes have been proposed to play an important role, but there is now ample evidence that macrophages and activated synovial fibroblasts also contribute significantly to the destructive nature of the disease (4). For example, synovial macrophages produce important proinflammatory cytokines, such as tumor necrosis factor α and interleukin-1β (IL-1β), while synovial fibroblasts are the principal cells mediating joint destruction, through their production of proinflammatory chemokines, cytokines, and matrix metalloproteinases (5).

It has been assumed that the predominant interaction of T lymphocytes in the synovial microenvironment is with antigen-presenting cells such as monocyte/macrophages, dendritic cells, and B cells. However, interactions between infiltrating bone marrow–derived hematopoietic cells (such as lymphocytes) and endogenous stromal cells (such as fibroblasts) have been shown to directly contribute to the intensity and persistence of chronic inflammation (6–9). For example, T cell–fibroblast interactions within the synovium induce the expression of adhesion molecules, cytokines, and chemokines by synovial fibroblasts (3, 10). They also lead to the survival and active, chemokine-mediated retention of T cells within the synovium (6, 7, 11). Whether these cellular interactions also regulate the formation of lymphoid aggregates within the synovium, as occurs in lymphoid neogenesis, has not been analyzed in detail.

Chronically inflamed tissues such as the rheumatoid joint often contain lymphoid aggregates that share many of the structural and functional features of secondary lymphoid tissue (12–14). We and others have recently shown that many of the chemokines required for effective lymphoid organogenesis are also expressed by stromal cells in the rheumatoid synovium (11, 12, 15). In addition, rheumatoid fibroblast-like synoviocytes (FLS) are able to support B cell survival (16), induce osteoclastogenesis, and regulate bone erosion (17). Rheumatoid FLS also display features of “nurse-like” stromal cells in their ability to support the spontaneous migration of B cells beneath them in vitro, a process called pseudoemperipolesis (18–20). These findings suggest that, as occurs in lymphoid neogenesis, the interactions between stromal cells of the synovial membrane and infiltrating lymphocytes might dictate the distribution of leukocyte subsets within the synovial microenvironment.

A striking feature of the rheumatoid synovium is the distribution of T cell subsets within the rheumatoid synovial compartment. CD4 T cells preferentially accumulate in a perivascular distribution, whereas CD8 T cells are sparsely distributed throughout the synovial tissue (21). Furthermore, the ratio of CD8 to CD4 T cells within the synovial tissue is much lower than that within the synovial fluid. The molecular basis for this high degree of cellular organization within distinct microdomains remains unclear.

In this study, we set out to determine whether differential chemokine-dependent interactions between T cell subsets and synovial fibroblasts might explain this longstanding conundrum of distinct T cell subset distribution within distinct microdomains in rheumatoid synovitis. We found that FLS derived from the rheumatoid synovium are able to support high levels of T cell migration beneath them (pseudoemperipolesis). The ability to support pseudoemperipolesis was dependent on the expression of the chemokine stromal cell–derived factor 1 (SDF-1; CXCL12), which was constitutively overexpressed by rheumatoid FLS. Unlike the case for B cells, neither CD4 nor CD8 T cells required CD49d–vascular cell adhesion molecule 1 (VCAM-1) interactions for efficient pseudoemperipolesis. CD8 T cells migrated more efficiently and with a higher velocity than CD4 T cells when underneath rheumatoid FLS. Finally, studies using synovial T cells ex vivo confirmed the in vivo relevance of the CXCR4–SDF-1 interaction. These results support the concept that rheumatoid FLS directly affect the behavior of infiltrating T lymphocytes, and that T cell–fibroblast interactions contribute to the distinctive architectural features that define the rheumatoid microenvironment.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Media, cytokines, and antibodies.

All tissue culture reagents were purchased from Sigma (St. Louis, MO) unless stated otherwise. Fibroblasts were cultured in RPMI 1640 supplemented with 1 mM sodium pyruvate, 10 mM glutamine, 100 μg/ml streptomycin, 50 units/ml penicillin, and 20% fetal calf serum (FCS). T cells were cultured in RPMI 1640 supplemented with 10% FCS. Recombinant IL-2 was purchased from Chiron (Harefield, UK). Media used for coculture during migration assays consisted of fresh media with 20 mM HEPES added.

Function-blocking antibodies to chemokine receptors and chemokines were purchased from R&D Systems (Abingdon, UK) unless stated otherwise. Antibodies to chemokine receptors were those to CXCR4 (MAB170 clone 12G5) and CCR5 (MAB182). Blocking antibodies included those to SDF-1 (MAB310), interferon-γ–inducible 10-kd protein (IP-10) (MAB266), RANTES (MAB278), monokine induced by interferon-γ (Mig) (MAB392), and macrophage inflammatory protein 1α (MIP-1α) (MCA1819; Serotec, Oxford, UK). Blocking antibody BD 314700 to α4 integrin (CD49d) was from Becton Dickinson (San Diego, CA). Recombinant human SDF-1 was purchased from R&D Systems and used at 200 ng/ml.

Patients, peripheral blood, and synovial cell and synovial fluid separation.

Samples of peripheral venous blood and synovial fluid obtained from patients who fulfilled the American College of Rheumatology (formerly, the American Rheumatism Association) 1987 revised criteria for RA (22) were collected into preservative-free heparin. Synovial tissue was obtained from the knee, hip, and elbow joints at the time of joint replacement with the approval of the Local Ethics Committee (LREC 5735).

Primary fibroblast cell lines were established as follows. Tissue was cut into ∼1-mm3 cubes using a sterile blade and resuspended in RPMI 1640 containing 0.2% collagenase. The sample was then incubated, with vigorous shaking, for 4–5 hours at 37°C. Cells were washed 3 times in fresh media to remove the collagenase and were cultured in fresh media until adherent fibroblast colonies became confluent.

Fibroblasts were expanded by trypsin digestion and then reseeded into tissue culture flasks with twice the surface area. Established fibroblast cell lines were grown in culture media consisting of a 1:1 mixture of conditioned media (from the flask being passaged) to fresh media.

Isolation of CD4+,CD45RO+ and CD8+,CD45RO+ T cells from peripheral blood and synovial fluid was conducted using negative selection with magnetic beads (Dynal, Wirral, UK) as described previously (6). Cells were stored as centrifuged pellets on ice and resuspended in coculture media immediately prior to use.

T cells (CD4 and CD8) and B cell lines.

CD4 and CD8 T cells from peripheral blood obtained from healthy volunteers were prepared by negative depletion using magnetic beads. These cells were stimulated every 14 days with phytohemagglutinin (9 μg/ml) and gamma-irradiated Epstein-Barr virus–transformed cells (1:10 cell:cell ratio). The T cells were maintained in culture media (RPMI 1640, 10% FCS) and were supplemented with IL-2 (25 units/ml) every 2 days. The B cell lines Ramos and Nalm-6 were a kind gift from Prof. John Gordon, Medical Research Council Center for Immune Regulation (University of Birmingham, Birmingham, UK), and were also maintained in RPMI 1640, 10% FCS. Cells for coculture experiments were used between day 7 and day 14 after stimulation. Lymphocytes for coculture were prepared by washing and resuspension at a concentration of 2.5 × 106/ml in coculture media.

Flow cytometry.

Analysis of cell surface markers was performed using 1-, 2-, or 3-color immunofluorescence as previously described (23). All flow cytometry was done using EPICS XL and an Elite flow cytometer (Beckman Coulter, High Wycombe, UK). Cytometer calibration was standardized using Flow-set fluorospheres (Beckman Coulter).

Pseudoemperipolesis and velocity assays.

Pseudoemperipolesis assays were conducted using fibroblast cell lines between passages 5 and 12. Fibroblasts were seeded onto 24-well plates at a density of 1 × 105/well and cultured for 2–3 days. Prior to coculture, the fibroblast layer was washed, and 400 μl of coculture media (fresh media with 20 mM HEPES) was added. A 100-μl volume of T lymphocytes (2.5 × 105) was added to the well containing the fibroblasts, and the coculture was gently mixed and then incubated under stasis for a period of 2 hours. For B cells, higher levels of input cells were required to achieve efficient pseudoemperipolesis and 100 μl of both Ramos and Nalm-6 cells, as has been previously described (18); therefore, 1 × 106 Nalm-6 B cells and 5 × 106 Ramos B cells were used.

Pseudoemperipolesis was assessed by counting phase dark cells in 3 independent fields and was expressed as a percentage of total input cells. Phase dark cells were cells that had migrated into and under the fibroblast layer; phase light cells were cells that either remained nonadherent or adhered to the surface of the fibroblast layer. Microscopes used for the assays were the IX70 and IMT-2 (both from Olympus, Basingstoke, UK) as well as the Labovert (Leica Microsystems, Welwyn Garden City, UK) with Olympus lenses. All were set up for phase-contrast microscopy. All microscopes were fitted with heated cabinets and standard closed-circuit television cameras (Hitachi models HV720K and KP110 and JVC model TK-S350) connected to time-lapse video recorders (Panasonic model AG6040E) for offline analysis.

Velocity assays were performed by analyzing the velocity of CD4 and CD8 T cells migrating underneath the fibroblast monolayers. Thirty cells from 3 independent experiments (10 cells per experiment) were tracked for 2 minutes using a semiautomated tracking system (Optimas v5; Vision Base, Reading, UK). The average speed was recorded as micrometers per minute.

Pertussis toxin and antibody treatment.

Cultured lymphocytes were counted, washed, and resuspended at a concentration of 5 × 105/ml (2.5 × 105 cells were used per flow assay). Pertussis toxin was added at a concentration of 1 μg/ml, and the cells were incubated at room temperature for 2 hours. Antibodies were used at 10 μg/ml, and cells were incubated on ice for 30 minutes. The cells were then washed and resuspended at a concentration of 2.5 × 106/ml and used in the migration assay as described.

Statistical analysis.

Statistical analysis of differences in T cell pseudoemperipolesis supported by different fibroblasts was performed assuming parametric distributions and 95% confidence intervals (95% CIs) using one-way analysis of variance. For velocity experiments (CD4 and CD8 T cells), a nonparametric distribution was assumed, and significance was assessed using the Mann-Whitney test with 2-tailed P values and 95% CIs. Results are shown as the mean ± SD of at least 3 data points. Experiments were performed on at least 3 separate occasions.

TaqMan analysis.

Each sample used for TaqMan analysis was produced from the reverse transcription of 1 μg of messenger RNA (mRNA). Samples were diluted with water to an 80-μl total volume, and 4-μl aliquots of each sample were plated in 96-well polymerase chain reaction (PCR) plates (Perkin-Elmer Applied Biosystems, Warrington, UK) using a Hydra 96 robot (Robbins Scientific, Sunnyvale, CA) for parallel PCR reactions. Serial dilutions of human genomic DNA (Clontech, Palo Alto, CA) were used in triplicate for preparation of a standard curve. PCR reactions, in triplicate, were performed in an ABI Prism 7700 sequence detector machine (10-minute activation at 95 °C, 40 cycles of 1 minute at 60°C and 1 minute at 95°C). Data were analyzed using the sequence detector program (Perkin-Elmer Applied Biosystems).

Primers and probes were designed using the Primer Select V1.0 software package (Perkin-Elmer Applied Biosystems). Restrictions were placed on primer selection such that the melting temperature of each primer was 60°C and the most 3′ base was A or T. The probe was selected with the criterion that the ratio of C to G had to be >1:1. Short amplicons (80–120 bp) were selected in preference to longer amplicons, and 3′ loci were preferred to 5′ loci within the translated region. The following primers were used for SDF-1: forward ACCAAGTCTGGCGGGTCAG, reverse CAGCCGGGCTACAATCTGAA, and for the fluorescence-labeled probe, CATCTCAAAATTCTCAACACTCCAAACTGTGC. The following primers were used for VCAM-1: forward TCTCCTGAGCTTCTCGTGCTCT, reverse ACCCCTTCATGTTGGCTTTTC, and for the fluorescence-labeled probe, TGCATCCTCCTTAATAATACCTGCCATTGC.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

High levels of CD4 and CD8 T cell pseudoemperipolesis supported by rheumatoid FLS.

Previous studies have shown that rheumatoid FLS support the spontaneous migration of leukocytes beneath them, a process termed pseudoemperipolesis (18, 24). To determine whether rheumatoid fibroblasts support the migration of both CD4 and CD8 T cell subsets (pseudoemperipolesis), we cocultured rheumatoid FLS with CD45RO+,CD4+ and CD45RO+,CD8+ T cell lines. These T cell lines are highly differentiated (CD45RObright,CD45RBdull) and have a phenotype very similar to that of T cells found in synovial fluid (25). For comparison, we used FLS derived from patients who had had a self-limiting viral arthritis or had undergone surgery for trauma. We also used fibroblasts derived from noninflamed fetal lung and adult skin. Pseudoemperipolesis was monitored by phase dark microscopy.

We found that all 6 lines of rheumatoid FLS could support high levels of CD4 and CD8 T cell pseudoemperipolesis (Figure 1). FLS derived from a patient with resolved, self-limiting viral arthritis or from a normal joint (trauma) as well as fetal lung fibroblasts also supported T cell pseudoemperipolesis, but less efficiently. Fibroblasts derived from skin were incapable of supporting either CD4 or CD8 T cell pseudoemperipolesis. This suggests that the ability to support CD4 and CD8 T cell pseudoemperipolesis is an intrinsic property of all types of FLS and fetal lung fibroblasts, but not skin fibroblasts. These findings also show that rheumatoid FLS are significantly more efficient at supporting pseudoemperipolesis than are other FLS and fetal lung fibroblasts. Furthermore, CD8 T cell pseudoemperipolesis was much more efficient than CD4 T cell pseudoemperipolesis in all fibroblasts tested except skin, suggesting that enhanced pseudoemperipolesis of CD8 T cells is an intrinsic property of CD8 T cells compared with CD4 T cells.

thumbnail image

Figure 1. Pseudoemperipolesis of CD4 and CD8 T cells supported by different fibroblasts. CD4 (A) or CD8 (B) T cells were cocultured with different fibroblasts for 2 hours. These included 6 different rheumatoid fibroblast cell lines (RA 1–6) as well as synovial fibroblasts derived from patients with either resolved parvovirus infection (resolved viral) or trauma. Nonsynovial fibroblasts were derived from fetal lung and adult skin. Pseudoemperipolesis was expressed as the percentage migration (phase dark cells) of total cells per unit field. A total of 3 fields were counted and expressed as the mean ± SD percentage migration. Significant differences were seen between the migration of CD4 T cells for the pooled rheumatoid panel (29.7 ± 4.1%) and their migration on fibroblasts derived from patients with resolved virus infection (14.3 ± 1%; P = 0.0003) or trauma (13.7 ± 3.2%; P = 0.0003) or on fibroblasts from fetal lung (14.3 ± 1.5%; P = 0.0003) or adult skin (7.2 ± 1.6%; P < 0.0001). Significant differences were also seen between the migration of CD8 T cells for the pooled rheumatoid panel (49.8 ± 5.8%) and their migration on fibroblasts derived from patients with resolved virus infection (29 ± 2.8%; P = 0.0044) or trauma (28.4 ± 6%; P = 0.0066) or on fibroblasts from adult skin (8.2 ± 1%; P < 0.0001). Results are representative of 3 independent experiments.

Download figure to PowerPoint

More efficient and faster migration of CD8 T cells than CD4 T cells beneath rheumatoid fibroblasts.

To determine the kinetics of CD4 and CD8 T cell pseudoemperipolesis with rheumatoid FLS, we chose a representative RA FLS line (RA 6) and examined its ability to support CD4 and CD8 T cell pseudoemperipolesis. Pseudoemperipolesis was rapid and maximal within 2 hours. Once cells migrated within the fibroblast monolayer, they remained there (i.e., remained phase dark and did not become phase bright again). As before, CD8 T cells were more efficient than CD4 T cells (Figure 2A).

thumbnail image

Figure 2. Pseudoemperipolesis of CD4 and CD8 T cells in rheumatoid fibroblast cocultures. A, CD4 and CD8 T cells were cocultured with rheumatoid fibroblasts for 12 hours. Pseudoemperipolesis was expressed as the percentage migration of total cells per unit field. Three fields were counted from each of 3 independent experiments (total of 9 fields) and expressed as the mean ± SD percentage migration. B, The speed of migration for CD4 and CD8 T cells was measured for a period of 2 minutes following 2 hours of culture. For each group, 10 individual cells were tracked in 3 independent experiments. Horizontal lines indicate median cell speeds in each group. The migration velocity of CD8 T cells on rheumatoid fibroblasts (median cell speed 11.9 μm/minute) was significantly higher than that of CD4 T cells (median cell speed 7.9 μm/minute; P = 0.0006).

Download figure to PowerPoint

We next examined the migration velocity of CD4 and CD8 T cells once they had accumulated within the monolayer (Figure 2B). CD8 T cells migrated at significantly higher velocities (11.9 μm/minute) compared with CD4 T cells (7.9 μm/minute). This differential ability to migrate at higher speeds compared with CD4 T cells was an intrinsic feature of CD8 T cells, since higher velocities were also observed for CD8 T cells compared with CD4 T cells under other fibroblasts tested (data not shown).

CD4 and CD8 T cell pseudoemperipolesis beneath rheumatoid fibroblasts inhibited by pertussis toxin.

To determine whether chemokines might be involved in CD4 and CD8 T cell pseudoemperipolesis, we pretreated T cells with pertussis toxin, a well-characterized inhibitor of chemokine-mediated migration. As shown in Figure 3, both CD4 and CD8 T cell pseudoemperipolesis under rheumatoid FLS was inhibited by pretreatment with pertussis toxin to basal levels seen with the nonrheumatoid FLS and fetal lung fibroblasts. Interestingly, basal migration of both CD4 and CD8 T cells beneath normal FLS and fetal lung fibroblasts was not significantly inhibited. Taken together, these results suggest that two types of pseudoemperipolesis occur with fibroblasts, only one of which is likely to be chemokine driven. It is this chemokine-sensitive form which is unique to rheumatoid FLS.

thumbnail image

Figure 3. Enhanced pseudoemperipolesis under rheumatoid fibroblast-like synoviocytes inhibited, but basal levels of pseudoemperipolesis not affected, by pertussis toxin. Cultured CD4 (A) or CD8 (B) T cells were not pretreated or were pretreated with pertussis toxin and then cocultured for 2 hours with different fibroblast layers. Pseudoemperipolesis was expressed as the percentage migration (phase dark cells) of total cells per unit field. A total of 3 fields were counted and expressed as the mean ± SD percentage migration. Significant differences were seen for CD4 T cells with versus those without pertussis toxin pretreatment (13.2 ± 2.7% and 29.6 ± 6%, respectively; P = 0.006) and for CD8 T cells with versus those without pertussis toxin pretreatment (18.7 ± 1.7% and 49.7 ± 3.4%, respectively; P = 0.0003) under rheumatoid fibroblasts. Results are representative of 3 independent experiments. See Figure 1 for description of fibroblast lines.

Download figure to PowerPoint

Constitutive overexpression of the chemokine SDF-1 (CXCL12) and the adhesion molecule VCAM-1 (CD106) by rheumatoid FLS.

Our previous research and that of others have suggested that the chemokine SDF-1 (CXCL12) plays an important role in retaining T cells within the inflamed synovium (11, 26, 27). In addition, previous studies have shown that both SDF-1 and the adhesion molecule VCAM-1 are involved in B cell pseudoemperipolesis (18). We therefore examined the expression of SDF-1 (CXCL12) and VCAM-1 (CD106) in the panel of fibroblasts using real-time TaqMan PCR analysis. Spontaneous expression of SDF-1 and VCAM-1 mRNA was much higher in rheumatoid FLS (range 40–2,240 copies for SDF-1 and 45–970 copies for VCAM-1) compared with the other fibroblasts (range 0.75–25 copies for SDF-1 and 0.03–5.1 copies for VCAM-1) (Figure 4). This strongly suggested that SDF-1 might be the chemokine and VCAM-1 the adhesion molecule responsible for the enhanced T cell pseudoemperipolesis observed for rheumatoid FLS.

thumbnail image

Figure 4. TaqMan polymerase chain reaction (PCR) detection profiles of stromal cell–derived factor 1 (SDF-1) and vascular cell adhesion molecule 1 (VCAM-1) expression on different fibroblasts. TaqMan PCR was performed using primers specific to SDF-1 (A) and VCAM-1 (B) as described in Materials and Methods. Template copies were calculated from a standard curve using single-copy genomic DNA, and data were normalized to GAPDH. Bars show the mean and SD of 3 independent samples. See Figure 1 for description of fibroblast lines.

Download figure to PowerPoint

T cell pseudoemperipolesis mediated by SDF-1 (CXCL12), but not by VCAM-1 (CD106).

To determine whether SDF-1 expressed by rheumatoid FLS was functionally important, we performed inhibition studies using function-blocking monoclonal antibodies to SDF-1 and its only known receptor CXCR4 (Figures 5A and B). Because the levels of SDF-1 and VCAM-1 were variable in the panel of rheumatoid fibroblasts examined, we used RA 6 as a representative rheumatoid FLS line for subsequent assays. Blocking antibodies to CCR5 and to combinations of RANTES/MIP-1α and IP-10/Mig were also used to determine whether these chemokines contribute to T cell pseudoemperipolesis (Figure 5). Both anti–SDF-1 and anti-CXCR4 blocking antibodies inhibited pseudoemperipolesis (to 50% of control levels), consistent with SDF-1 and CXCR4 being a receptor/ligand pair. Furthermore, these reagents inhibited both CD4 and CD8 T cell pseudoemperipolesis, suggesting that SDF-1/CXCR4 was responsible for both CD4 and CD8 T cell pseudoemperipolesis. There was no significant effect of blocking antibodies to CCR5 or to the combinations of RANTES/MIP-1α or IP-10/Mig.

thumbnail image

Figure 5. CD4 and CD8 T cell pseudoemperipolesis under rheumatoid fibroblast-like synoviocytes mediated by stromal cell–derived factor 1 (SDF-1) and CXCR4. Cultured CD4 T cells (A), CD8 T cells (B), or Ramos and Nalm-6 B cells (C) were cocultured with function-blocking antibodies to CCR5, CXCR4, SDF-1, or combinations of RANTES/macrophage inflammatory protein 1α (MIP-1α) and interferon-γ–inducible 10-kd protein/monokine induced by interferon-γ (IP-10/Mig). Function-blocking antibodies to α4 integrin (α-4) were also used as described in Materials and Methods. Results are shown as the mean and SD percentage of pseudoemperipolesis compared with control (media alone). For CD4 T cells treated with function-blocking antibodies to SDF-1 and CXCR4, P = 0.01 and P = 0.002, respectively, versus control. For CD8 T cells treated with function-blocking antibodies to SDF-1 and CXCR4, P = 0.0013 and P = 0.0011, respectively, versus control. For Ramos and Nalm-6 B cells treated with function-blocking antibodies to SDF-1, CXCR4, and α4 integrin, all P < 0.05 versus control. None of the other antibody blockades reached statistical significance. Results are representative of 3 independent experiments.

Download figure to PowerPoint

To determine whether the VCAM-1/α4 integrin system might also contribute to T cell pseudoemperipolesis, we examined the effects of function-blocking antibodies to α4 integrin (CD49d). There was no effect of function-blocking antibodies to α4 integrin on either CD4 or CD8 T cell pseudoemperipolesis (Figures 5A and B). There was also no effect of function-blocking antibodies to α1–α6 integrins for either CD4 or CD8 T cells (data not shown). We were unable to determine the effect of anti–VCAM-1 and anti–β1 integrin (anti-CD29) chain antibodies, since these reagents affected fibroblast morphology (leading to cells rounding up but not detaching) over the course of the assay, making the measurement of pseudoemperipolesis difficult. The reason for this is currently under investigation.

The lack of a role for α4 integrin (CD49d) in both CD4 and CD8 T cell pseudoemperipolesis is in complete contrast to the need for both SDF-1 and α4 integrin (CD49d) in B cell pseudoemperipolesis. When we examined the ability of anti–α4 integrin (anti-CD49d) blocking antibody to inhibit pseudoemperipolesis of two B cell lines (Nalm-6 and Ramos), we found that as has been previously described (18), pseudoemperipolesis of Ramos (and, to a lesser extent, Nalm-6) B cells could be inhibited by anti–α4 integrin (anti-CD49d) antibodies (Figure 5C). Pseudoemperipolesis for both Nalm-6 and Ramos was dependent on SDF-1–CXCR4 interactions, although it remains unclear why the blockade of CXCR4 was more efficient than that of SDF-1 (Figure 5C). These results suggest that the mechanisms of T cell pseudoemperipolesis are quite different from those of B cell pseudoemperipolesis in their lack of requirement for VCAM-1 (CD106)–α4 integrin (CD49d) interactions; however, like B cells, T cells require SDF-1–CXCR4 interactions for efficient pseudoemperipolesis to occur.

Occurrence of pseudoemperipolesis only when synovial T cells express CXCR4 and synovial fibroblasts express SDF-1 (CXCL12).

To confirm the in vivo relevance of the above observations, CD4 and CD8 T cells were prepared from freshly collected synovial fluid and peripheral blood obtained from the same RA patients. Infiltrating T cells at sites of chronic inflammation are exclusively of a memory CD45RO phenotype; we therefore isolated CD4+,CD45RO+ and CD8+,CD45RO+ T cells from peripheral blood as a comparison for synovial CD4 and CD8 T cells. When different combinations of either peripheral blood or synovial fluid CD4/CD8 T cells were cocultured with rheumatoid FLS or skin fibroblasts, only synovial fluid–derived T cells were able to migrate underneath rheumatoid FLS (Figure 6A). The levels of pseudoemperipolesis for both CD4 and CD8 T cells derived from synovial fluid were very similar to those observed for the cultured CD4 and CD8 T cell lines used in the study (Figure 1). Surprisingly, peripheral blood CD45RO T cells were unable to migrate underneath rheumatoid FLS (Figure 6A). We hypothesized that this might occur because peripheral blood CD45RO T cells lack high levels of expression of CXCR4 (11). To test this, we examined the expression of CXCR4 on paired peripheral blood and synovial fluid CD4 and CD8 T cells. High expression of CXCR4 was observed only on synovial fluid T cells (Figure 6B).

thumbnail image

Figure 6. Pseudoemperipolesis supported only by rheumatoid fibroblast-like synoviocytes (FLS) and synovial fluid T cells. A, Matched peripheral blood and synovial fluid T cell subsets isolated ex vivo were purified by negative depletion into the relevant subsets and cocultured with fibroblast layers for 2 hours. Pseudoemperipolesis was expressed as the percentage migration of total cells per unit field. A total of 3 fields were counted for each coculture and expressed as the mean ± SD percentage migration. Cocultures of rheumatoid fibroblasts with synovial fluid CD8+,CD45RO+ T cells yielded significantly greater pseudoemperipolesis (48.3 ± 2.5%) than with synovial fluid CD4+,CD45RO+ T cells (27.9 ± 7.9%; P = 0.0026), peripheral blood CD8+,CD45RO+ T cells (10.6 ± 2.0%; P < 0.0001), and synovial fluid CD8 cocultures with skin fibroblasts (6.3 ± 2.2%; P < 0.0001). Cocultures of rheumatoid fibroblasts with synovial fluid CD4+,CD45RO+ T cells also yielded significantly greater pseudoemperipolesis than with peripheral blood CD4+,CD45RO+ T cells (8.2 ± 3.6%; P = 0.004) and synovial fluid CD4 cocultures with skin fibroblasts (5.2 ± 1.0%; P = 0.0048). B, To test whether peripheral blood CD45RO T cells were unable to migrate underneath rheumatoid FLS because they lacked high levels of expression of CXCR4, we examined the expression of CXCR4 on paired peripheral blood and synovial fluid CD4 and CD8 T cells. High expression of CXCR4 was observed only on synovial fluid T cells.

Download figure to PowerPoint

T cell pseudoemperipolesis was not supported by skin fibroblasts, which produce very little SDF-1. In order to determine whether the lack of expression of SDF-1 alone was responsible for this effect, we exposed skin-derived fibroblasts to exogenously added SDF-1 (Figure 7). This was unable to complement the defect in pseudoemperipolesis observed with skin fibroblasts, suggesting that additional factors are produced by rheumatoid FLS compared with skin fibroblasts.

thumbnail image

Figure 7. Factors in addition to stromal cell–derived factor 1 (SDF-1) required to support pseudoemperipolesis. Cultured CD4 or CD8 T cells were cocultured for 2 hours with rheumatoid fibroblast-like synoviocytes, skin fibroblasts, or skin fibroblasts that had been pretreated with recombinant SDF-1 (200 μg/ml) for 20 minutes. Pseudoemperipolesis was expressed as the percentage migration (phase dark cells) of total cells per unit field. Bars show the mean and SD. The addition of SDF-1 to skin fibroblasts did not induce any significant change in their ability to support CD4/CD8 T cell pseudoemperipolesis. Results are representative of 3 independent experiments.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

The relative contribution of factors produced by T cells and fibroblasts to the accumulation of inflammatory cells within distinct microdomains in the rheumatoid synovium remains unclear. In this study, we set out to test the hypothesis that chemokines (such as SDF-1) produced by rheumatoid FLS are responsible for generating this distinctive microcompartmentalization. Using a coculture model of lymphocyte accumulation (pseudoemperipolesis), we found that FLS derived from 6 different patients with RA were able to support both CD4 and CD8 T cell pseudoemperipolesis at much higher levels than FLS from nonrheumatoid tissue. Pseudoemperipolesis was rapid (maximal within 2 hours) and depended on the expression of SDF-1 (but not VCAM-1) by the rheumatoid FLS as well as the expression of CXCR4 on the T cells. CD8 T cells were able to migrate much more efficiently and at higher velocity under the rheumatoid FLS monolayers than were CD4 T cells. This ability was an intrinsic property of CD8 T cells compared with CD4 T cells.

Only rheumatoid FLS were able to support high levels of T cell pseudoemperipolesis. It remains unclear whether this is a general property of rheumatoid FLS or whether it represents the activity of a small number of specialized “nurse-like” cells (NLCs) found only in the rheumatoid synovium (28). Previous studies have provided contradictory results for B cell pseudoemperipolesis in this regard. Shimaoka et al (19) have shown that only rheumatoid NLCs, but not conventional FLS, were able to support pseudoemperipolesis. In contrast, other investigators have found that conventional FLS from joints affected with either RA or osteoarthritis could support B cell pseudoemperipolesis (18). All observers have found that dermal fibroblasts do not support constitutive B cell pseudoemperipolesis. Burger et al (18) have suggested that these discrepancies are due to the way in which NLCs are prepared (via limiting dilution) and maintained (by the use of conditioned medium).

Our findings using an extended panel of primary FLS demonstrate that the ability to support basal levels of T cell pseudoemperipolesis is an intrinsic property of FLS, in agreement with findings of studies on B cells by Burger et al (18). However, we also observed higher levels of T cell pseudoemperipolesis with rheumatoid FLS compared with other nonrheumatoid FLS (resolved viral arthritis and skin). This is more in keeping with the findings of Shimaoka et al (19), who determined that only rheumatoid NLCs could support B cell pseudoemperipolesis. The additional, enhanced level of pseudoemperipolesis that we observed for rheumatoid FLS was seen for both CD4 and CD8 T cells, which further emphasizes that this feature is intrinsic to rheumatoid FLS.

We found that CD8 T cell pseudoemperipolesis was much more efficient than CD4 T cell pseudoemperipolesis. Since this was observed for all FLS as well as for fetal lung fibroblasts, this suggests that compared with CD4 T cells, CD8 T cells have an increased intrinsic ability to undergo migration beneath fibroblasts. Moreover, we found that the velocity of migration of CD8 T cells was much higher than that of CD4 T cells (Figure 2). It is tempting to speculate that this intrinsic ability of CD8 T cells might account for the differential localization of T cell subsets at sites of chronic inflammation and for the distinctive CD4:CD8 T cell ratio that is reversed between synovial tissue and fluid.

Recent studies have shown that stromal cells present within the inflamed synovium share many features with, and may even originate from, mesenchymal stem cell precursors found in peripheral blood (28, 29). A common feature of these mesenchymal stromal cells is their ability to produce high levels of the chemokine SDF-1 (CXCL12). We found that the high levels of T cell pseudoemperipolesis mediated by rheumatoid FLS was dependent on the ability of the rheumatoid FLS to express SDF-1. Dermal fibroblasts, which produce very little SDF-1, were unable to support pseudoemperipolesis. Rheumatoid FLS produced very high basal levels of SDF-1, as measured by real-time TaqMan PCR (40–2,240 copies). Other FLS and fetal lung and dermal fibroblasts expressed much lower levels of SDF-1 mRNA (range 0.75–25 copies). Despite the wide range in the number of copies, all 6 rheumatoid FLS lines were able to support pseudoemperipolesis, suggesting that a relatively low threshold level of SDF-1 exists for this function.

Although we have not shown a direct correlation between the expression of SDF-1 mRNA and SDF-1 protein production, our findings are consistent with those of other investigators who have found high levels of SDF-1 within the rheumatoid synovium (11, 27, 30, 31). Our finding of high levels of VCAM-1 mRNA expression by rheumatoid fibroblasts (45–970 copies) compared with other FLS and fetal lung and dermal fibroblasts (0.03–5.1 copies) is also in keeping with previous studies which have shown that VCAM-1 protein is constitutively expressed on rheumatoid, but not skin, fibroblasts (32).

Inhibition studies of T cell pseudoemperipolesis using pertussis toxin and function-blocking antibodies confirmed the functional relevance of the overexpression of SDF-1 by rheumatoid FLS. We found that while blockade of SDF-1–CXCR4 interactions inhibited T cell pseudoemperipolesis mediated by rheumatoid FLS, there was no effect of blockade of chemokines involved in either the CCR5 (RANTES, MIP-1α) or CXCR3 (IP-10, Mig) system. Both CCR5 and CXCR3 have been implicated in the recruitment of T cells to the inflamed synovium (33). Therefore, taken together, these results suggest that while CCR5 and CXCR3 may be important for T cell recruitment to the synovium (endothelial selection), T cell retention depends more on SDF-1/CXCR4 (stromal selection).

We did not find any effect of α4 integrin (CD49d) blockade on either CD4 or CD8 T cell pseudoemperipolesis despite high levels of VCAM-1 on rheumatoid fibroblasts (Figures 5A and B). This is unlike the case for B cells, which require both SDF-1 and VCAM-1 to support B cell pseudoemperipolesis (Figure 5C) and survival (18, 19). In agreement with the findings of Burger et al (18), we found that B cell pseudoemperipolesis was relatively inefficient (∼5% of total input cells) compared with CD4 (25%) and CD8 (50%) T cell pseudoemperipolesis. It is therefore tempting to speculate that while the functional consequence of SDF-1–mediated T cell pseudoemperipolesis is to regulate T cell positioning within the synovium, B cell pseudoemperipolesis supports SDF-1/VCAM-1–dependent survival and activation. This is in keeping with findings of our previous studies, which have shown that T cell survival within the rheumatoid synovium depends on the production of type I interferon and does not require VCAM-1–α4β1 interactions (6, 7). Whether T cell pseudoemperipolesis regulates T cell activation and cytokine production is currently under investigation in our laboratory. In addition, recent studies have shown that T cells can directly activate rheumatoid fibroblasts in coculture (9).

We and others have recently suggested that SDF-1 produced by stromal cells and CXCR4 expressed on infiltrating cells play an important role in the accumulation of CD4 memory T cells in the rheumatoid synovium (11, 27). The close relationship between synovial stromal cells and infiltrating T cells suggests that there may be intrinsic features of T cells and fibroblasts that contribute to the pathology of RA. In this study, we found that a critical requirement for both CD4 and CD8 T cell pseudoemperipolesis was the ability of fibroblasts to make SDF-1 and for the migrating T cells to express CXCR4. Neither process on its own was sufficient (Figure 7). Intriguingly, even when SDF-1 protein was added to skin fibroblasts (which do not produce SDF-1 at high levels), T cell pseudoemperipolesis did not occur, suggesting that additional factors, such as an appropriate extracellular matrix to support SDF-1 presentation, are perhaps needed.

Our findings emphasize the critical role of interactions between leukocytes and the stromal environments in which they reside in driving the pattern of leukocyte accumulation in chronic inflammatory diseases (34). Moreover, they suggest that stromal cell–derived factors such as SDF-1 that guide lymphocyte positioning within tissues might be attractive therapeutic targets in chronic inflammatory joint disease.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES
  • 1
    Buckley CD. Science, medicine, and the future: treatment of rheumatoid arthritis. BMJ 1997; 315: 2368.
  • 2
    Salmon M, Gaston JS. The role of T-lymphocytes in rheumatoid arthritis. Br Med Bull 1995; 51: 33245.
  • 3
    Fox DA. The role of T cells in the immunopathogenesis of rheumatoid arthritis: new perspectives. Arthritis Rheum 1997; 40: 598609.
  • 4
    Firestein GS, Panayi GS, Wollheim FA. Rheumatoid arthritis. 1st ed. Oxford (UK): Oxford University Press; 2000.
  • 5
    Ritchlin C. Fibroblast biology: effector signals released by the synovial fibroblast in arthritis. Arthritis Res 2000; 2: 35660.
  • 6
    Salmon M, Scheel-Toellner D, Huissoon AP, Pilling D, Shamsadeen N, Hyde H, et al. Inhibition of T cell apoptosis in the rheumatoid synovium. J Clin Invest 1997; 99: 43946.
  • 7
    Pilling D, Akbar AN, Girdlestone J, Orteu CH, Borthwick NJ, Amft N, et al. Interferon-beta mediates stromal cell rescue of T cells from apoptosis. Eur J Immunol 1999; 29: 104150.
  • 8
    Buckley CD, Pilling D, Lord JM, Akbar AN, Scheel-Toellner D, Salmon M. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol 2001; 22: 199204.
  • 9
    Yamamura Y, Gupta R, Morita Y, He X, Pai R, Endres J, et al. Effector function of resting T cells: activation of synovial fibroblasts. J Immunol 2001; 166: 22705.
  • 10
    Bombara MP, Webb DL, Conrad P, Marlor CW, Sarr T, Ranges GE, et al. Cell contact between T cells and synovial fibroblasts causes induction of adhesion molecules and cytokines. J Leukoc Biol 1993; 54: 399406.
  • 11
    Buckley CD, Amft N, Bradfield PF, Pilling D, Ross E, Arenzana-Seisdedos F, et al. Persistent induction of the chemokine receptor CXCR4 by TGF-beta 1 on synovial T cells contributes to their accumulation within the rheumatoid synovium. J Immunol 2000; 165: 34239.
  • 12
    Takemura S, Braun A, Crowson C, Kurtin PJ, Cofield RH, O'Fallon WM, et al. Lymphoid neogenesis in rheumatoid synovitis. J Immunol 2001; 167: 107280.
  • 13
    Hjelmstrom P. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J Leukoc Biol 2001; 69: 3319.
  • 14
    Nishikawa SI, Hashi H, Honda K, Fraser S, Yoshida H. Inflammation, a prototype for organogenesis of the lymphopoietic/hematopoietic system. Curr Opin Immunol 2000; 12: 3425.
  • 15
    Shi K, Hayashida K, Kaneko M, Hashimoto J, Tomita T, Lipsky PE, et al. Lymphoid chemokine B cell-attracting chemokine-1 (CXCL13) is expressed in germinal center of ectopic lymphoid follicles within the synovium of chronic arthritis patients. J Immunol 2001; 166: 6505.
  • 16
    Lindhout E, van Eijk M, van Pel M, Lindeman J, Dinant HJ, de Groot C. Fibroblast-like synoviocytes from rheumatoid arthritis patients have intrinsic properties of follicular dendritic cells. J Immunol 1999; 162: 594956.
  • 17
    Gravallese EM, Goldring SR. Cellular mechanisms and the role of cytokines in bone erosions in rheumatoid arthritis. Arthritis Rheum 2000; 43: 214351.
  • 18
    Burger JA, Zvaifler NJ, Tsukada N, Firestein GS, Kipps TJ. Fibroblast-like synoviocytes support B-cell pseudoemperipolesis via a stromal cell-derived factor-1- and CD106 (VCAM-1)-dependent mechanism. J Clin Invest 2001; 107: 30515.
  • 19
    Shimaoka Y, Attrep JF, Hirano T, Ishihara K, Suzuki R, Toyosaki T, et al. Nurse-like cells from bone marrow and synovium of patients with rheumatoid arthritis promote survival and enhance function of human B cells. J Clin Invest 1998; 102: 60618.
  • 20
    Takeuchi E, Tomita T, Toyosaki-Maeda T, Kaneko M, Takano H, Hashimoto H, et al. Establishment and characterization of nurse cell–like stromal cell lines from synovial tissues of patients with rheumatoid arthritis. Arthritis Rheum 1999; 42: 2218.
  • 21
    Kurosaka M, Ziff M. Immunoelectron microscopic study of the distribution of T cell subsets in rheumatoid synovium. J Exp Med 1983; 158: 1191210.
  • 22
    Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 1988; 31: 31524.
  • 23
    Faint JM, Annels NE, Curnow SJ, Shields P, Pilling D, Hislop AD, et al. Memory T cells constitute a subset of the human CD8+CD45RA+ pool with distinct phenotypic and migratory characteristics. J Immunol 2001; 167: 21220.
  • 24
    Reparon-Schuijt CC, van Esch WJE, van Kooten C, Rozier BCD, Levarht EWN, Breedveld FC, et al. Regulation of synovial B cell survival in rheumatoid arthritis by vascular cell adhesion molecule 1 (CD106) expressed on fibroblast-like synoviocytes. Arthritis Rheum 2000; 43: 111521.
  • 25
    Salmon M, Pilling D, Borthwick NJ, Viner N, Janossy G, Bacon PA, et al. The progressive differentiation of primed T cells is associated with an increasing susceptibility to apoptosis. Eur J Immunol 1994; 24: 8929.
  • 26
    Burger JA, Tsukada N, Burger M, Zvaifler NJ, Dell'Aquila M, Kipps TJ. Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells from spontaneous apoptosis through stromal cell-derived factor-1. Blood 2000; 96: 265563.
  • 27
    Nanki T, Hayashida K, El Gabalawy HS, Suson S, Shi K, Girschick HJ, et al. Stromal cell-derived factor-1-CXC chemokine receptor 4 interactions play a central role in CD4+ T cell accumulation in rheumatoid arthritis synovium. J Immunol 2000; 165: 65908.
  • 28
    Marinova-Mutafchieva L, Taylor P, Funa K, Maini RN, Zvaifler NJ. Mesenchymal cells expressing bone morphogenetic protein receptors are present in the rheumatoid arthritis joint. Arthritis Rheum 2000; 43: 204655.
  • 29
    Abe R, Donnelly SC, Peng T, Bucala R, Metz CN. Peripheral blood fibrocytes: differentiation pathway and migration to wound sites. J Immunol 2001; 166: 755662.
  • 30
    Seki T, Selby J, Häupl T, Winchester R. Use of a differential subtraction method to identify genes that characterize the phenotype of cultured rheumatoid arthritis synoviocytes. Arthritis Rheum 1998; 41: 135664.
  • 31
    Kanbe K, Takagishi K, Chen Q. Stimulation of matrix metalloprotease 3 release from human chondrocytes by the interaction of stromal cell–derived factor 1 and CXC chemokine receptor 4. Arthritis Rheum 2002; 46: 1307.
  • 32
    Morales-Ducret J, Wayner E, Elices MJ, Alvaro-Gracia JM, Zvaifler NJ, Firestein GS. Alpha 4/beta 1 integrin (VLA-4) ligands in arthritis: vascular cell adhesion molecule-1 expression in synovium and on fibroblast-like synoviocytes. J Immunol 1992; 149: 142431.
  • 33
    Qin S, Rottman JB, Myers P, Kassam N, Weinblatt M, Loetscher M, et al. The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J Clin Invest 1998; 101: 74654.
  • 34
    Firestein GS, Zvaifler NJ. How important are T cells in chronic rheumatoid synovitis? II. T cell–independent mechanisms from beginning to end. Arthritis Rheum 2002; 46: 298308.