Tsuchiya N, Kuroki K, Fujimoto M, Murakami Y, Tedder TF, Tokunaga K, Takehara K, Sato S. Association of a functional CD19 polymorphism with susceptibility to systemic sclerosis, Arthritis Rheum (2004) 50 (12) 4002-7


Abstract

The original article to which this Erratum refers was published in Arthritis Rheum(2004) 50(5) 4002–7

In the article by Tsuchiya et al published in the December 2004 issue of Arthritis & Rheumatism (pp 4002–4007), the primer sequences for the first polymerase chain reaction were shown incorrectly. The second sentence in the second paragraph of the “Genotyping and case–control association study” section (page 4003) should have read, “The first primer set (CD19promoterF [GCCTGGCTGTAACTGACATG] and CD19promoterR [CTCAAGTTTCCAGCCTCAATC]) was designed to amplify −1351 to 136 using long PCR.”

Ancillary