SEARCH

SEARCH BY CITATION

Keywords:

  • Apoptosis;
  • Interleukin-18;
  • Apoptosis-regulating genes;
  • Adult-onset Still's disease;
  • Systemic lupus erythematosus

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

Objective

To determine spontaneous and activation-induced apoptosis of peripheral blood lymphocytes (PBLs) from patients with active untreated adult-onset Still's disease (AOSD) and to examine the role of interleukin-18 (IL-18) involved in the apoptosis related to this disease.

Methods

The percentages of spontaneous and IL-18–stimulated apoptotic lymphocytes in peripheral blood of 20 patients with active untreated AOSD, 20 with active untreated systemic lupus erythematosus (SLE), and 20 healthy controls were determined using annexin V/propidium iodide staining and flow cytometry. Serum IL-18 levels were measured using enzyme-linked immunosorbent assay. The transcripts of caspase 3 gene and apoptosis-regulating genes, including Fas, FasL, Bcl-2, and p53 in IL-18–treated peripheral blood mononuclear cells (PBMCs) from 8 AOSD patients, 4 SLE patients, and 4 healthy controls, were examined by real-time quantitative polymerase chain reaction.

Results

Significantly higher percentages of spontaneous and IL-18–stimulated apoptotic PBLs were found in patients with active untreated AOSD and those with active untreated SLE than in healthy controls. The percentages of spontaneous and IL-18–stimulated apoptotic lymphocytes correlated positively with clinical activity scores and serum IL-18 levels for AOSD patients and SLE patients. The percentages of spontaneous and activation-induced apoptotic PBLs significantly declined, paralleling clinical remission and the decrease in serum IL-18 levels after effective therapy in AOSD patients. Up-regulation of FasL and p53 transcripts was demonstrated in IL-18–treated PBMCs from AOSD patients and SLE patients in a dose-dependent manner.

Conclusion

The increased apoptosis of PBLs from AOSD patients may be associated with the effect of IL-18 through up-regulation of FasL and p53 transcripts.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

Accumulating evidence indicates that apoptosis plays an important role in immunologic tolerance by halting the unwanted expansion of activated T and B cell clones beyond the course of inflammation (1, 2). The Fas (APO-1, CD95) is a cell-surface receptor, which mediates apoptosis when engaged by its ligand (FasL) via its cytoplasmic death domain (3, 4). Therefore, Fas-dependent apoptosis may be involved in the pathogenesis of autoimmune diseases (1, 5). In addition, Fas-mediated apoptosis could be modulated by Bcl-2 family members and p53 phosphoprotein (6, 7).

Adult-onset Still's disease (AOSD) is a systemic inflammatory disorder characterized by high fever, evanescent rash, arthritis, lymphadenopathy, and hepatosplenomegaly (8, 9). Our previous study demonstrated a predominance of Th1 cytokine in peripheral blood and pathologic tissues of patients with active AOSD (10). Zhang et al demonstrated that Th1 cells undergo activation-induced cell death via the Fas/FasL pathway more readily than Th2 cells (11). Furthermore, we and other investigators have shown that patients with active AOSD often have high levels of serum interleukin-18 (IL-18) (12, 13). Dao et al indicated that IL-18 might play a potential role in immunoregulation by enhancing FasL-mediated cytotoxicity of murine Th1 cells (14). Marked elevation of serum IL-18 levels and Th1 predominance in AOSD lead us to hypothesize that apoptosis may play a role in the pathogenesis of this disease.

The goal of this study was to determine spontaneous and IL-18–stimulated apoptosis of peripheral blood lymphocytes (PBLs) from patients with active untreated AOSD. We chose patients with systemic lupus erythematosus (SLE) as disease controls because increased IL-18 and the occurrence of apoptosis have been documented in SLE (15–17), and because of the similarity of some manifestations between SLE and AOSD. The changes in apoptotic PBLs and serum IL-18 levels during longitudinal followup of AOSD patients were also evaluated. To explore the role of IL-18 in the pathogenesis of apoptosis, we further analyzed the change in transcripts of apoptosis-regulating genes in recombinant human IL-18 (rHuIL-18)–treated peripheral blood mononuclear cells (PBMCs) from patients with AOSD and patients with SLE.

PATIENTS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

Patients.

Twenty patients with active untreated AOSD (16 women and 4 men, mean ± SD age 34.3 ± 12.9 years) fulfilling the criteria developed by Yamaguchi et al (18) were enrolled. Patients with infections, malignancies, or other rheumatic diseases were excluded. The disease activity scores (range 0–12) for each AOSD patient were assessed according to the criteria described by Pouchot et al (19). After initial investigation for apoptosis, all AOSD patients received corticosteroids and nonsteroidal antiinflammatory drugs. The disease-modifying antirheumatic drugs used were methotrexate (18 patients), hydroxychloroquine (14 patients), sulfasalazine (6 patients), and azathioprine (2 patients). Twenty age-matched patients (18 women and 2 men, mean ± SD age 32.5 ± 9.8 years) fulfilling the 1997 revised criteria of the American College of Rheumatology for SLE (20) were included as disease controls for systemic inflammation. SLE disease activity was assessed using the SLE Disease Activity Index (SLEDAI) (21). All SLE patients who had poor drug compliance did not receive corticosteroids or immunosuppressive agents at least 1 month before enrollment in this study and were in active status, which was defined as SLEDAI score ≥10. Twenty age- and sex-matched healthy volunteers were used as normal controls (16 women and 4 men, mean ± SD age 35.6 ± 11.8 years). The Ethics Committee of Clinical Research, Taichung Veterans General Hospital approved this study protocol and informed consent was obtained from each participant.

Determination of IL-18 serum levels.

Serum levels of IL-18 were determined using an enzyme-linked immunosorbent assay kit (Bender MedSystems, Vienna, Austria). The overall intra- and interassay coefficients of variation in this study were 2.9% and 12.5%, respectively.

Determination of spontaneous and rHuIL-18–stimulated apoptotic PBLs.

PBMCs were immediately isolated from venous blood using Ficoll-Hypaque density gradient centrifugation (Amersham Biosciences, Uppsala, Sweden). After being washed 3 times with phosphate buffered saline, some of the cells were analyzed immediately for apoptosis using annexin V/propidium iodide (PI) staining and flow cytometry analysis (22). Briefly, washed PBMCs were supplemented with 1% bovine serum albumin and then stained directly with 10 μl PI (Clontech, Palo Alto, CA) and 2.5 μl fluorescein isothiocyanate (FITC)–labeled annexin V (Clontech) after the addition of 222.5 μl binding buffer. Immediately after incubation for 10 minutes in the dark on ice, flow cytometric analysis was performed with Cellquest software (Becton Dickinson, Mountain View, CA). Lymphocytes were identified on the basis of light scatter properties and CD45 expression. To exclude the contamination of necrotic cells, the gated apoptotic lymphocytes were stained with annexin V and were negative for PI.

Other freshly isolated PBMCs from 20 patients with active untreated AOSD, 20 patients with active untreated SLE, and 20 healthy controls were resuspended in medium (RPMI 1640 + 2 ng glutamine + 60 μg/ml gentamicin + 5% human pool serum) in a final concentration of 1 × 106 cells/well. According to the results of a recent report (23) and our data (Figure 1A), treatment with IL-18 (100 ng/ml) increased annexin V positive cells and peaked at 24 hours. We chose the 100 ng/ml concentration because of a trend of increased apoptosis in a dose-dependent manner (0 ng/ml, 50 ng/ml, and 100 ng/ml), whereas a higher concentration of rHuIL-18 (200 ng/ml) produced necrosis instead of apoptosis (Figure 1B). A concentration of cells 1 × 106/ml was treated with rHuIL-18 (Bender Medsystems) 100 ng/ml and then incubated at 37°C in 5% CO2 for 24 hours. IL-18–stimulated apoptotic lymphocytes, which were identified on the basis of light scatter properties and CD45 expression, were assayed using annexin V/PI staining and flow cytometry as in the previous procedures.

thumbnail image

Figure 1. A, The changes in the frequencies of apoptotic lymphocytes from patients with active untreated adult-onset Still's disease (AOSD) and healthy controls after treatment with recombinant human interleukin-18 (rhIL-18) at the different time periods. Peripheral blood mononuclear cells (PBMCs) were treated with rhIL-18 (100 ng/ml) at the indicated time periods and then were accessed for apoptosis using the annexin V-fluorescein isothiocyanate detection method. * P < 0.05 versus at other time periods, determined by nonparametric Friedman's test. B, The changes in the frequencies of apoptotic and necrotic lymphocytes from 3 patients with active untreated AOSD and 3 healthy controls after 24-hour stimulation of cultured PBMCs with different concentrations of rhIL-18 (50 ng/ml, 100 ng/ml, and 200 ng/ml). Data are expressed as the mean ± SEM. * P < 0.05 versus rhIL-18 at the concentration of 100 ng/ml.

Download figure to PowerPoint

Determination of the messenger RNA expression levels of apoptosis-regulating genes and caspase 3 gene on rHuIL-18–stimulated PBMCs.

PBMCs were resuspended in medium (RPMI 1640 + 2 ng glutamine + 60 μg/ml gentamicin + 5% human pool serum) in a final concentration of 1 × 106 cells/well. Culture conditions included medium alone; rHuIL-18 10 ng/ml; and rHuIL-18 100 ng/ml. Cultured PBMCs were incubated at 37°C in 5% CO2 for 24 hours. Total cellular RNA was obtained from PBMCs by the guanidinium isothiocyanate method (24) and was quantified by spectrophotometry at 260 nm. A 2.5-μg RNA aliquot was reverse transcribed with 200 units of Moloney murine leukemia virus reverse transcriptase (Boehhringer, Mannheim, Germany) according to standard procedures. The levels of messenger RNA (mRNA) expression for apoptosis-regulating genes were quantified using real-time TaqMan polymerase chain reaction (PCR) (25) according to the manufacturer's instructions (Maxim Biotech, Rockville, MD).

The following oligonucleotide primers and TaqMan probes for apoptosis-related genes were designed and synthesized: for Fas, sense primer 5′-CCTGCCAAGAAGGGAAG-3′ and antisense primer 5′-TGGGTCCGGGTGCAGT-3′, TaqMan probe 5′ 6-FAM d (CAAAGCCCATTTTTCTTCCA) 3′; for FasL, sense primer 5′-ACCAGCCAGATGCACAC-3′ and antisense primer 5′-TGGGCCACTTTCCTCAGC-3′, TaqMan probe 5′ 6-FAM d (CACCCCAGTCCACCCC) 3′; for p53, sense primer 5′-CGGAGGTTGTGAGGCG-3′ and antisense primer 5′-CACATGTAGTTGTAGTGG-3′, TaqMan probe 5′ 6-FAM d (AGCGATGGTCTGGCCC) 3′; for Bcl-2, sense primer 5′-CAGCTGCACCTGACGCC-3′ and antisense primer 5′-CCCAGCCTCCGTTATCCTG-3′, TaqMan probe 5′ 6-FAM d (CATCTCCCGGTTGACGCTC) 3′; and for caspase 3, sense primer 5′-TGGAACAAATGGACCTG-3′ and antisense primer 5′-ACCACGGCAGGCCTGA-3′, TaqMan probe 5′ 6-FAM d (CAAACTTTTTCAGAGGGG) 3′. PCR was performed in a total volume of 50.0 μl containing 100 ng of complementary DNA, 0.5 μl Taq DNA polymerase (5 units/μl), 5.0 μl TaqMan probe, 5.0 μl each oligonucleotide primer, 25.0 μl PCR buffer, and 9.5 μl RNase-free water. PCR conditions were incubation for 2 minutes at 50°C, activation of Taq DNA polymerase for 10 minutes at 95°C, and then 40 cycles of 95°C for 15 seconds, followed by 58°C for 1.5 minutes. To standardize mRNA levels of apoptosis-regulating genes and caspase 3 gene, transcript levels of the housekeeping gene β-actin were determined in parallel for each sample. Final results were expressed as the copy ratio of specific apoptosis-regulating gene or caspase 3 gene/β-actin transcripts.

Statistical analysis.

Data were analyzed using SPSS software, version 10.0 for Windows (SPSS, Chicago, IL). Differences among groups were determined by Kruskal-Wallis test for nonparametric analysis of variance. The correlation coefficient was obtained by nonparametric Spearman's rank correlation test. Wilcoxon's signed rank test was used for comparison of the percentages of apoptotic lymphocytes from AOSD patients both at the active phase and the remission phase during followup and for comparison of the transcript levels of apoptosis-regulating genes and caspase 3 gene on PBMCs treated with different doses of rHuIL-18. P values less than 0.05 were considered statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

Clinical characteristics for AOSD patients and SLE patients.

All 20 patients with active untreated AOSD had daily spiking fevers (≥39°C) and articular symptoms. Evanescent rash and sore throat were present in 17 patients (85%). Lymphadenopathy and hepatomegaly were noted in 7 patients (35%) and 6 patients (30%), respectively. All SLE patients had active disease (median SLEDAI score 27.0, range 17.5–28.8) and half of them had renal involvement.

Percentage of spontaneous and rHuIL-18–stimulated apoptotic PBLs.

Representative examples of flow cytometric dot plots of spontaneous and rHuIL-18–stimulated apoptotic PBLs obtained from 1 patient with active untreated AOSD are shown in Figures 2A and 2B, respectively. Significantly higher percentages of spontaneous apoptotic lymphocytes were observed in patients with active untreated AOSD (median 4.74%, interquartile range [IQR] 3.03–7.81) and in patients with active untreated SLE (median 5.03%, IQR 3.01–6.53) than in healthy controls (median 0.47%, IQR 0.19–0.79; both P < 0.001). However, there was no significant difference in the percentage of spontaneous apoptotic lymphocytes between AOSD patients and SLE patients (Figure 2C).

thumbnail image

Figure 2. Flow cytometric dot plots of A, spontaneous and B, 24-hour interleukin-18 (IL-18)–stimulated apoptotic lymphocytes obtained from peripheral blood of 1 patient with active adult-onset Still's disease (AOSD). The value in the right lower quadrant denotes the percentage of early apoptotic lymphocytes. The median percentage of C, spontaneous and D, 24-hour IL-18–stimulated apoptotic lymphocytes in peripheral blood was obtained from 20 patients with active untreated AOSD, 20 patients with active untreated systemic lupus erythematosus (SLE), and 20 healthy controls (HC). Individual values are plotted and horizontal bars indicate the median value for each group. P values are indicated for comparisons of these 3 groups, determined by Mann-Whitney U test. Ann-V = annexin V; PI = propidium iodide.

Download figure to PowerPoint

To determine the activation-induced apoptosis, we assessed the percentages of apoptotic lymphocytes after 24 hours of incubation with rHuIL-18 (100 ng/ml). Significantly higher percentages of rHuIL-18–stimulated apoptotic lymphocytes were found in patients with active untreated AOSD (median 10.62%, IQR 5.77–15.36) and in patients with active untreated SLE (median 9.81%, IQR 8.53–13.09) than in healthy controls (median 1.29%, IQR 0.64–2.11; both P < 0.001) (Figure 2D). However, there was no significant difference in the percentage of rHuIL-18–stimulated apoptotic lymphocytes between AOSD patients and SLE patients.

Changes in the frequency of apoptotic lymphocytes after stimulation with rHuIL-18.

To determine whether IL-18 could enhance apoptosis of PBLs, the percentages of apoptotic lymphocytes were assessed before and after 24 hours of incubation with rHuIL-18 (100 ng/ml). Our results showed that the percentages of apoptotic lymphocytes after 24 hours of incubation were significantly higher than at time zero of incubation in AOSD patients (mean ± SEM 10.50% ± 1.27% versus 5.51% ± 0.67%; P < 0.001), SLE patients (10.49% ± 0.88% versus 4.76% ± 0.44%; P < 0.001), and in healthy controls (1.54% ± 0.26% versus 0.53% ± 0.09%; P < 0.005) (Figure 3).

thumbnail image

Figure 3. The changes in the frequency of apoptotic lymphocytes from patients with active untreated adult-onset Still's disease (AOSD), active untreated systemic lupus erythematosus (SLE), and healthy controls (HC) after stimulation with recombinant human interleukin-18 (rhIL-18). After addition of rhIL-18 (100 ng/ml), the percentages of apoptotic lymphocytes were assessed at time zero of incubation and after 24 hours of incubation. * P < 0.005, ** P < 0.001 versus at time zero of incubation.

Download figure to PowerPoint

Serum IL-18 levels for AOSD patients and SLE patients.

The serum levels of IL-18 were significantly higher in patients with active untreated AOSD (median 361.0 pg/ml, IQR 178.5–571.1) and in those with active untreated SLE (median 387.7 pg/ml, IQR 224.1–515.5) than in healthy controls (median 72.4 pg/ml, IQR 55.0–82.2; both P < 0.001).

Correlation between percentages of apoptotic PBLs and disease activity scores.

The percentages of spontaneous and IL-18–stimulated apoptotic PBLs from AOSD patients correlated positively with disease activity scores (r = 0.737 and 0.767, respectively; both P < 0.001) and serum IL-18 levels (r = 0.454, P < 0.05, and r = 0.630, P < 0.005, respectively). Similarly, the percentages of spontaneous and IL-18–stimulated apoptotic PBLs from SLE patients correlated positively with SLEDAI (r = 0.789 and 0.771, respectively; both P < 0.001) and serum IL-18 levels (r = 0.595, P < 0.01 and r = 0.731, P < 0.001, respectively).

The mRNA expression of caspase 3 gene on PBMCs from active untreated AOSD patients and active untreated SLE patients.

Significantly higher levels of caspase 3 mRNA expression were demonstrated on PBMCs with and without stimulation with rHuIL-18 in patients with active untreated AOSD and those with active untreated SLE compared with healthy controls (Figure 4). In addition, real-time quantitative PCR (RQ-PCR) analysis demonstrated that exposure of PBMCs from patients with active untreated AOSD to rHuIL-18 enhanced the expression of caspase 3 mRNA in a dose-dependent manner (P < 0.05). In patients with active untreated SLE, exposure of PBMCs to rHuIL-18 showed a trend of enhancement of caspase 3 transcripts in a dose-dependent manner (P = 0.068).

thumbnail image

Figure 4. The messenger RNA expression levels of caspase 3 gene on peripheral blood mononuclear cells stimulated with different concentrations (0 ng/ml, 10 ng/ml, and 100 ng/ml) of recombinant human interleukin-18 (rhIL-18) in 8 patients with active untreated adult-onset Still's disease (AOSD), 4 with active untreated systemic lupus erythematosus (SLE), and 4 healthy controls (HC) were analyzed by real-time TaqMan polymerase chain reaction. * P < 0.005, ** P < 0.001 versus healthy controls. Solid bars = AOSD; shaded bars = SLE; open bars = HC.

Download figure to PowerPoint

The mRNA expression of apoptosis-regulating genes on rHuIL-18–stimulated PBMCs.

We examined whether cultured PBMCs stimulated with rHuIL-18 could up-regulate expression of apoptosis-regulating genes in 8 patients with active untreated AOSD, 4 patients with active untreated SLE, and 4 healthy controls. After 24-hour stimulation of cultured PBMCs with different concentrations of rHuIL-18 (10 ng/ml or 100 ng/ml), the levels of FasL and p53 mRNA expression were significantly higher than those of unstimulated cells from patients with active untreated AOSD and patients with active untreated SLE (P < 0.05) in a dose-dependent manner (Figure 5). However, 24-hour treatment with rHuIL-18 had no significant effect on Fas or Bcl-2 mRNA expression on PBMCs from patients with active untreated AOSD, patients with active untreated SLE, or healthy controls.

thumbnail image

Figure 5. The messenger RNA expression levels of apoptosis-regulating genes (Fas, FasL, p53, and Bcl-2) on peripheral blood mononuclear cells (PBMCs) stimulated with different concentrations (0 ng/ml,10 ng/ml, and 100 ng/ml) of recombinant human interleukin-18 (rhIL-18) in 8 patients with active untreated adult-onset Still's disease (AOSD), 4 patients with active untreated systemic lupus erythematosus (SLE), and 4 healthy controls (HC) were analyzed by real-time TaqMan polymerase chain reaction. Data are expressed as the mean ± SEM. * P < 0.05 for comparison of the copy ratio of apoptosis-regulating gene/β-actin transcripts on PBMCs with and without rhIL-18 stimulation; # P < 0.05 for comparison of the copy ratio of apoptosis-regulating gene/β-actin transcripts on PBMCs treated with 10 ng/ml and with 100 ng/ml rhIL-18. Open bars = 0 ng/ml; shaded bars = 10 ng/ml; solid bars = 100 ng/ml.

Download figure to PowerPoint

Changes in serum IL-18 levels and in the percentages of spontaneous and IL-18–stimulated apoptotic lymphocytes in peripheral blood of AOSD patients after therapy.

All AOSD patients achieved remission, which was defined as the absence of systemic manifestations for at least 2 months, within 6 months of commencement of therapy. Ten AOSD patients were available for examination both at the active phase and at the remission phase. The levels of serum IL-18 declined markedly, paralleling the clinical remission (mean ± SEM 457.9 ± 74.1 pg/ml versus 207.5 ± 43.1 pg/ml; P < 0.01) (Figure 6). The mean percentage of spontaneous and IL-18–stimulated apoptotic PBLs declined significantly, paralleling the clinical remission and the decrease in serum IL-18 levels (mean ± SEM 6.60 ± 1.26 versus 1.18 ± 0.18, and 10.26 ± 1.59 versus 3.95 ± 0.61, respectively; both P < 0.01) (Figure 6).

thumbnail image

Figure 6. Changes in the levels of serum interleukin-18 (IL-18) and in the percentages of spontaneous and recombinant human IL-18–stimulated apoptotic lymphocytes in peripheral blood of 10 patients with adult-onset Still's disease are shown both at the active phase and at the remission phase. Data are expressed as the mean ± SEM.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

This study is the first attempt to investigate in vitro apoptosis, both spontaneous and IL-18–stimulated, of PBLs from patients with active untreated AOSD and patients with active untreated SLE. The apoptotic assay used in this study, by combining usage of FITC-labeled annexin V and dye exclusion of PI, discriminates intact cells (FITC/PI), early apoptotic cells (FITC+/PI), and late apoptotic cells mixed with necrotic cells (FITC+/PI+) (22). To avoid the contamination of necrotic cells, only early apoptotic cells were gated in accordance with previous studies in the assessment of apoptotic lymphocytes from SLE patients (26). The results of apoptotic assay, which was used in this study, correlate with the results of DNA-flow cytometry and DNA electrophoresis (27, 28). Our data showed that accelerated in vitro apoptosis, both spontaneous and IL-18–stimulated, occurred in PBLs from patients with active AOSD. This observation was supported by RQ-PCR analysis showing an increase in transcript levels of caspase 3, which is thought to be responsible for the actual demolition of the cell during apoptosis (29). Our results were consistent with recent reports demonstrating an increase in the mean apoptotic index of PBLs and in the activation-induced apoptotic PBMCs from patients with juvenile-onset Still's disease (30, 31). In addition, we demonstrated that the percentages of peripheral blood apoptotic lymphocytes significantly correlated with the disease activity scores and declined markedly after effective therapy in AOSD patients. Our results suggest that an increase in apoptosis may play an important role in the elimination of autoreactive lymphocytes in AOSD.

The notion of a central role for IL-18 in the pathogenesis of AOSD is supported by our and other investigators' reports (12, 13). To examine the effects of IL-18 on the in vitro apoptosis in AOSD patients, we investigated the frequency of apoptotic lymphocytes after 24-hour incubation with rHuIL-18. Because a growth factor deficiency may contribute to apoptosis of autoreactive lymphocytes in vitro and apoptotic cell preparations may contain increasing numbers of secondary necrotic cells during prolonged incubation, we used higher concentrations of IL-18 (100 ng/ml) in the shorter culture period (24-hour time point) in accordance with previous studies (23). Our data showed that increased percentages of IL-18–stimulated apoptotic lymphocytes correlated positively with disease activity scores and serum IL-18 levels in AOSD patients. The effect of IL-18 on the apoptosis is further supported by our results, which showed the up-regulation of mRNA expression of caspase 3 on IL-18–treated PBMCs from AOSD patients in a dose-dependent manner (Figure 4), and by a recent report demonstrating that IL-18 up-regulated caspase 3 expression in human cardiac endothelial cells (23). Our results suggest that IL-18 plays an important role in the pathogenesis of apoptosis associated with AOSD. There are conflicting findings concerning the role of IL-18 in the pathogenesis of inflammation and apoptosis in AOSD. However, accumulating evidence supports the concept of a dual role of interferon-γ that can be induced by IL-18 (32) in inflammation and in the regulatory pathways including activation of apoptosis (33). Therefore, we speculated that IL-18 might act as a proinflammatory and proapoptotic cytokine, and enhance apoptosis of autoreactive lymphocytes in patients with AOSD. Because the local concentrations of IL-18 in tissues are not known, it is impossible to indicate whether the elevated serum concentrations observed are sufficient to cause the apoptosis found in this study.

Similar to AOSD patients, augmented apoptosis in IL-18–stimulated lymphocytes and up-regulated caspase 3 transcripts on IL-18–treated PBMCs were observed in our SLE patients. Amerio et al also demonstrated that increased levels of serum IL-18 correlated positively with disease activity in SLE (34). Our results suggest that accelerated in vitro apoptosis and up-regulation of caspase 3 transcripts by IL-18 may be a general characteristic of systemic inflammation. It may be speculated that IL-18 priming can render PBLs susceptible to activation-induced cell death in AOSD and SLE. However, this hypothesis needs to be confirmed by future studies. Although other proapoptotic cytokines were not investigated in the present study, tumor necrosis factor α and IL-10 have been shown to promote lymphocyte apoptosis through the Fas-dependent pathway in patients with active SLE (35, 36). To test whether the enhanced in vitro apoptosis is unique to IL-18 in systemic inflammatory diseases, further investigation of other apoptosis inducers are needed.

It remains unclear whether increased apoptosis is a contributing factor to the development of AOSD, or is just a secondary phenomenon common to systemic inflammation. Several reports have shown that mutations in Fas and FasL are associated with peripheral lymphoid expansion, indicating that defective apoptosis of autoreactive lymphocytes may be involved in the pathogenesis of SLE and other autoimmune diseases (1, 37, 38). We also demonstrated that the increased frequency of apoptotic lymphocytes correlated positively with both disease activity and levels of proinflammatory cytokine IL-18 in AOSD patients and SLE patients. Accumulating evidence showed that activation-induced apoptosis plays an important role in deletion of autoreactive T cells (39), and apoptotic cells can inhibit the production of proinflammatory cytokines and induce the production of immunosuppressive cytokines from PBMCs and monocytes (40, 41). Our results indicated that enhanced apoptosis of lymphocytes might be a compensatory mechanism designed to eliminate excess autoreactive cells in AOSD and SLE.

To clarify the role of IL-18 in the accelerated apoptosis of PBLs from patients with active AOSD, we used RQ-PCR analysis to investigate the mRNA expression of apoptosis-regulating genes on rHuIL-18–stimulated PBMCs. The 45-kd membrane protein Fas is a major apoptogenic cell-surface receptor, which mediates apoptosis when engaged by its ligand (FasL) via cytoplasmic death domain (3, 4). The p53 gene is a potent transcriptional factor that promotes apoptosis in response to a variety of stresses (7), whereas Bcl-2 belongs to apoptosis-inhibitory members that can inhibit the release of mitochondrial factors (6). Our results demonstrated that the transcript levels of FasL and p53 were up-regulated on PBMCs treated with IL-18 in a dose-dependent manner for AOSD patients and SLE patients (Figure 5). Our observation is similar to recent reports showing that IL-18 can up-regulate FasL in human cardiac endothelial cells (23), and FasL as well as p53 in myelomonocytic KG-1 cells (42). Based upon these findings, we postulate that IL-18 may play a role in the pathogenesis of apoptosis through up-regulation of FasL and p53 transcripts in AOSD and SLE. However, further investigation to demonstrate the real involvement of FasL and p53 in the pathogenesis of apoptosis is needed.

During apoptosis, surface-exposed phosphatidylserine (PS) offers a recognition signal for clearance of apoptotic cells by macrophages and other scavenger cells (43). This overexpression of surface PS is supported by our finding of a considerable increase in PBLs with positive FITC-labeled annexin V staining in patients with active AOSD and patients with SLE. Increased numbers of apoptotic lymphocytes in patients with active AOSD may occur as a result of increased apoptosis of circulating cells, or because of defective clearance. Although there are no data concerning the clearance of apoptotic cells in AOSD compared with SLE, impaired clearance of apoptotic cells is already known to be a hallmark of SLE (44, 45). Increased apoptosis of lymphocytes together with impaired engulfment of early apoptotic cells may cause secondary necrosis and release of intracellular autoantigens, and then trigger autoimmune reactions in SLE (46, 47). Moreover, the presence of apoptotic cells may shift the helper T cells' response toward Th2 cells that characterize the immune response in SLE (48), while a predominance of Th1 cells was observed in AOSD (10). Additionally, elevation of C-reactive protein, which is a common finding in AOSD patients, enhanced opsonization and phagocytosis of apoptotic cells by macrophage (49) and hyperferritinemia, which is a hallmark of AOSD patients (50), may be a marker of excessive macrophage activation (51). Our data suggest that the increased apoptotic lymphocytes in peripheral blood from patients with active AOSD are not due to defective clearance. This hypothesis may be supported by the absence of antinuclear antibodies (18) and the self-limited course in a majority of AOSD patients (12, 52).

In conclusion, accelerated in vitro apoptosis, both spontaneous and IL-18–stimulated, was found in patients with active AOSD and patients with SLE, and may be a common characteristic of systemic inflammatory diseases. IL-18 may play an important role in apoptosis by augmenting FasL and p53 expression on PBMCs from AOSD patients and SLE patients. Although the present study does not directly address the causative role of IL-18 and apoptosis in the pathogenesis of AOSD, our work may provide a new insight into the effects of IL-18 on the regulation of apoptosis-related genes in this disease.

AUTHOR CONTRIBUTIONS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES

Dr. Lan had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study design. Chen, Lan.

Acquisition of data. Chen, Tsu-Yi Hsieh, Chia-Wei Hsieh, Lin, Lan.

Analysis and interpretation of data. Chen, Lin, Lan.

Manuscript preparation. Chen, Tsu-Yi Hsieh, Lan.

Statistical analysis. Chen, Lan.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. PATIENTS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. AUTHOR CONTRIBUTIONS
  8. REFERENCES
  • 1
    Mountz JD, Zhou T, Su X, Wu J, Cheng J. The role of programmed cell death as an emerging new concept for the pathogenesis of autoimmune disease. Clin Immunol Immunopathol 1996; 80(3 Suppl 2 ): S214.
  • 2
    Nagata S. Apoptosis by death factor. Cell 1997; 88: 35565.
  • 3
    Nagata S, Golstein P. The Fas death factor. Science 1995; 267: 144956.
  • 4
    Ju ST, Panka DJ, Cui H, Ettinger R, el-Khatib M, Sherr DH, et al. Fas(CD95)/ FasL interactions required for programmed cell death after T-cell activation. Nature 1995; 373: 4448.
  • 5
    Ito RM, Terasaki S, Itoh J, Katoh H, Yonehara S, Nose M. Rheumatic diseases in an MRL strain of mice with a deficit in the functional Fas ligand. Arthritis Rheum 1997; 40: 105463.
  • 6
    Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998; 281: 13226.
  • 7
    Sionov RV, Haupt Y. Apoptosis by p53: mechanisms, regulation, and clinical implications. Springer Semin Immunopathol 1998; 19: 34562.
  • 8
    Bywaters EG. Still's disease in the adult. Ann Rheum Dis 1971; 30: 12133.
  • 9
    Ohta A, Yamaguchi M, Kaneoka H, Nagayoshi T, Hiida M. Adult Still's disease: review of 228 cases from the literature. J Rheumatol 1987; 14: 113946.
  • 10
    Chen DY, Lan JL, Lin FJ, Hsieh TY, Wen MC. A predominance of Th1 cytokine in peripheral blood and pathological tissues of patients with active untreated adult onset Still's disease. Ann Rheum Dis 2004; 63: 13006.
  • 11
    Zhang X, Brunner T, Carter L, Dutton RW, Rogers P, Bradley L, et al. Unequal death in T helper cell (Th)1 and Th2 effectors: Th1, but not Th2, effectors undergo rapid Fas/FasL-mediated apoptosis. J Exp Med 1997; 185: 183749.
  • 12
    Chen DY, Lan JL, Lin FJ, Hsieh TY. Proinflammatory cytokine profiles in the sera and pathological tissues of patients with active untreated adult onset Still's disease. J Rheumatol 2004; 31: 218998.
  • 13
    Kawashima M, Yamamura M, Taniai M, Yamauchi H, Tanimoto T, Kurimoto M, et al. Levels of interleukin-18 and its binding inhibitors in the blood circulation of patients with adult-onset Still's disease. Arthritis Rheum 2001; 44: 55060.
  • 14
    Dao T, Ohashi K, Kayano T, Kurimoto M, Okamura H. Interferon-gamma-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell Immunol 1996; 173: 2305.
  • 15
    Wong CK, Li EK, Ho CY, Lam CW. Elevation of plasma interleukin-18 concentration is correlated with disease activity in systemic lupus erythematosus. Rheumatology (Oxford) 2000; 39: 107881.
  • 16
    Lorenz HM, Grunke M, Hieronymus T, Herrmann M, Kuhnel A, Manger B, et al. In vitro apoptosis and expression of apoptosis-related molecules in lymphocytes from patients with systemic lupus erythematosus and other autoimmune disease. Arthritis Rheum 1997; 40: 30617.
  • 17
    Emlen W, Niebur J, Kadera R. Accelerated in vitro apoptosis of lymphocytes from patients with systemic lupus erythematosus. J Immunol 1994; 152: 368592.
  • 18
    Yamaguchi M, Ohta A, Tsunematsu T, Kasukawa R, Mizushima Y, Kashiwagi S, et al. Preliminary criteria for classification of adult Still's disease. J Rheumatol 1992; 19: 42430.
  • 19
    Pouchot J, Sampalis JS, Beaudet F, Carette S, Decary F, Salusinsky-Sternbach M, et al. Adult Still's disease: manifestations, disease course, and outcome in 62 patients. Medicine (Baltimore) 1991; 70: 11836.
  • 20
    Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus [letter]. Arthritis Rheum 1997; 40: 1725.
  • 21
    Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang CH, and the Committee on Prognosis Studies in SLE. Derivation of the SLEDAI: a disease activity index for lupus patients. Arthritis Rheum 1992; 35: 63040.
  • 22
    Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C. A novel assay for apoptosis: flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled Annexin V. J Immunol Methods 1995; 184: 3951.
  • 23
    Chandrasekar B, Vemula K, Surabhi RM, Li-Weber M, Owen-Schaub LB, Jensen LE, et al. Activation of intrinsic and extrinsic proapoptotic signaling pathways in interleukin-18-mediated human cardiac endothelial cell death. J Biol Chem 2004; 279: 2022133.
  • 24
    Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162: 1569.
  • 25
    Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res 1996; 6: 9951001.
  • 26
    Courtney PA, Crockard AD, Williamson K, McConnell J, Kennedy RJ, Bell AL. Lymphocyte apoptosis in systemic lupus erythematosus: relationships with Fas expression, serum soluble Fas and disease activity. Lupus 1999; 8: 50813.
  • 27
    Nicoletti I, Migliorati G, Pagliacci MC, Riccardi C. A rapid simple method for measuring apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods 1991; 139: 2719.
  • 28
    Koopman G, Reutlingsperger CP, Kuitjen GA, Keehnen RM, Pals ST, van Oers MH. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood 1994; 84: 141520.
  • 29
    Earnshaw WC, Martins LM, Kaufmann SH. Mammalian caspases: structure, activation, substrates and functions during apoptosis. Annu Rev Biochem 1999; 68: 383424.
  • 30
    Smolewska E, Brozik H, Smolewski P, Biernacka-Zielinska M, Darzynkiewicz Z, Stanczyk J. Apoptosis of peripheral blood lymphocytes in patients with juvenile idiopathic arthritis [published erratum appears in Ann Rheum Dis 2003;62:1126]. Ann Rheum Dis 2003; 62: 7613.
  • 31
    Pignatti P, Massa M, Travaglino P, Meazza C, Martini A, De Benedetti F. Activation-induced cell death and Fas-induced apoptosis in patients with systemic or pauciarticular juvenile idiopathic arthritis. Clin Exp Rheumatol 2001; 19: 33944.
  • 32
    Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature 1995; 378: 8891.
  • 33
    Muhl H, Pfeilschifter J. Anti-inflammatory properties of pro-inflammatory interferon-gamma. Int Immunopharmacol 2003; 3: 124755.
  • 34
    Amerio P, Frezzolini A, Abeni D, Teofoli P, Girardelli CR, De Pita O, et al. Increased IL-18 in patients with systemic lupus erythematosus: relations with Th-1, Th-2, pro-inflammatory cytokines and disease activity. IL-18 is a marker of disease activity but does not correlate with pro-inflammatory cytokines. Clin Exp Rheumatol 2002; 20: 5358.
  • 35
    Zheng L, Fisher G, Miller RE, Peschon J, Lynch DH, Lenardo MJ. Induction of apoptosis in mature T-cell by tumor necrosis factor. Nature 1995; 377: 34851.
  • 36
    Georgescu L, Vakkalanka RK, Elkon KB, Crow MK. Interleukin-10 promotes activation-induced cell death of SLE lymphocytes mediated by Fas ligand. J Clin Invest 1997; 100: 262233.
  • 37
    Rieux-Laucat F, Le Deist F, Hivroz C, Roberts IA, Debatin KM, Fischer A, et al. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 1995; 268: 13479.
  • 38
    Sneller MC, Wang J, Dale JK, Strober W, Middelton LA, Choi Y, et al. Clinical, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome associated with abnormal lymphocyte apoptosis. Blood 1997; 89: 13418.
  • 39
    Chen Y, Inobe JI, Marks R, Gonnella P, Kuchroo VK, Weiner HL. Peripheral deletion of antigen-reactive T cells in oral tolerance. Nature 1995; 376: 17780.
  • 40
    Voll RE, Herrmann M, Roth EA, Stach C, Kalden JR, Girkontaite I. Immunosuppressive effects of apoptotic cells. Nature 1997; 390: 3501.
  • 41
    Fadok VA, Bratton DL, Konowal A, Freed PW, Westcott JY, Henson PM. Macrophages that have ingested apoptotic cells in vitro inhibit pro-inflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. J Clin Invest 1998; 101: 8908.
  • 42
    Ohtsuki T, Micallef MJ, Kohno K, Tanimoto T, Ikeda M, Kurimoto M. Interleukin 18 enhances Fas ligand expression and induces apoptosis in Fas-expressing human myelomonocytic KG-1 cells. Anticancer Res 1997; 17: 32538.
  • 43
    Fadok VA, Voelker DR, Campbell PA, Cohen JJ, Bratton DL, Henson PM. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol 1992; 148: 220716.
  • 44
    Herrmann M, Voll RE, Zoller OM, Hagenhofer M, Ponner BB, Kalden JR. Impaired phagocytosis of apoptotic cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 1998; 41: 124150.
  • 45
    Tas SW, Quartier P, Botto M, Fossati-Jimack L. Macrophages from patients with SLE and rheumatoid arthritis have defective adhesion in vitro, while only SLE macrophages have impaired uptake of apoptotic cells. Ann Rheum Dis 2006; 65: 21621.
  • 46
    Vermes I, Haanen C, Richel DJ, Schaafsma MR, Kalsbeek-Batenburg E, Reutelingsperger CP. Apoptosis and secondary necrosis of lymphocytes in culture. Acta Haematol 1997; 98: 813.
  • 47
    Baumann I, Kolowos W, Voll RE, Manger B, Gaipl U, Neuhuber WL, et al. Impaired uptake of apoptotic cells into tingible body macrophages in germinal centers of patients with systemic lupus erythematosus. Arthritis Rheum 2002; 46: 191201.
  • 48
    Trebeden-Negre H, Weill B, Fournier C, Batteux F. B cell apoptosis accelerates the onset of murine lupus. Eur J Immunol 2003; 33: 160312.
  • 49
    Gershov D, Kim S, Brot N, Elkon KB. C-reactive protein binds to apoptotic cells, protects the cells from assembly of the terminal complement components, and sustains an antiinflammatory innate immune response: implications for systemic autoimmunity. J Exp Med 2000; 192: 135364.
  • 50
    Schwarz-Eywill M, Heilig B, Bauer H, Breitbart A, Pezzutto A. Evaluation of serum ferritin as a marker for adult Still's disease activity. Ann Rheum Dis 1992; 51: 6835.
  • 51
    Lambotte O, Cacoub P, Costedoat N, Le Moel G, Amoura Z, Piette JC. High ferritin and low glycosylated ferritin may also be a marker of excessive macrophage activation. J Rheumatol 2003; 30: 10278.
  • 52
    Cush JJ, Medsger TA Jr, Christy WC, Herbert DC, Cooperstein LA. Adult-onset Still's disease: clinical course and outcome. Arthritis Rheum 1987; 30: 18694.