SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES

Objective

To define the molecular basis of familial Mediterranean fever (FMF) in patients with only 1 mutation in the MEFV gene.

Methods

Genetic analysis was performed in 20 FMF patients, including full sequencing of complementary DNA (cDNA) samples and multiplex ligation-dependent probe amplification analysis. In patients with first-degree relatives with FMF, haplotype analysis was also performed.

Results

A second mutation was found in 2 patients. In the other 18 patients, we could not identify additional mutations, large genomic deletions, or duplications. Analysis of single-nucleotide polymorphisms along the cDNA ruled out a lack of expression of 1 of the alleles. In 2 of the 3 families in which more than 1 sibling had FMF, we showed that the affected siblings inherited a different MEFV allele from the parent who did not have the MEFV mutation.

Conclusion

These findings are highly consistent with the existence of a clinical phenotype among some patients who are heterozygous for FMF and could explain the vertical transmission in some families. A single mutation in the MEFV gene may be much more common than was previously thought and may include up to 25% of patients who are diagnosed as having FMF.

Familial Mediterranean fever (FMF; OMIM no. *608107) is an inherited disorder characterized by recurrent episodes of fever accompanied by sterile peritonitis, arthritis, pleuritis, and a typical inflammatory skin rash called erysipelas-like erythema (1). The development of renal amyloidosis type AA is the most devastating manifestation of the disease, and prior to the advent of colchicine treatment, it was a major cause of morbidity and mortality among FMF patients.

The disease is caused by mutations in the MEFV gene, which is composed of 10 exons and encodes a protein consisting of 781 amino acids (2). To date, more than 50 disease-associated mutations have been identified, most of which are extremely rare (see the Infevers database of FMF and hereditary autoinflammatory disorders mutations online at http://fmf.igh.cnrs.fr/infevers). Very high FMF carrier rates have been described among the Mediterranean and Middle Eastern populations, ranging from 1:5 among North African Jews, Arabs, and Turks to 1:3 among Iraqi Jews and Armenians. Most patients have mutations in exon 10, which is the longest exon in this gene. FMF mutation analysis in clinical use is gaining increasing popularity. In many laboratories, testing is directed toward a search for specific mutations, but some perform full sequencing of exon 10. Complete sequencing of the whole gene for clinical purposes is rarely performed.

Two MEFV mutations are found in most, but not all, patients who have been diagnosed as having FMF. The proportion of patients with a single mutation varies between 16.5% and 33.8% (3, 4). Initially, we and other investigators assumed that these patients harbor less-common MEFV mutations on the second allele in MEFV, but a number of investigators have failed to detect such mutations in the coding region, the exon and intron boundaries, or in the promoter region of the gene in most of these patients, even when complete sequencing of the gene was performed (5, 6).

FMF has traditionally been considered an autosomal-recessive disease. However, previous serologic studies have shown that many patients heterozygous for MEFV show a mild inflammatory process, which is manifested by elevated C-reactive protein and serum amyloid A levels (7). Other investigators have shown that in the presence of other inflammatory conditions, such as tuberculosis and Behçet's disease, only 1 MEFV mutation is usually found (8, 9), and a few reports of families with seemingly dominant inheritance have been published (10, 11). Thus, it became evident that FMF is not fully recessive and that in some cases, heterozygous mutations are associated with clinical symptoms.

Herein, we present data that support the existence of a clinical phenotype among some patients who are heterozygous for FMF. We believe that this phenomenon may be by far more common than has previously been understood.

PATIENTS AND METHODS

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES

Patient population

Twenty unrelated patients with FMF were recruited from the National Center for FMF at Sheba Medical Center. The Institutional Review Board approved the study, and all participants gave informed consent.

All of the patients had definite FMF according to the Tel Hashomer criteria (12). Briefly, the combination of recurrent attacks of fever accompanied by peritonitis, pleuritis, or arthritis that respond to colchicine is considered definite disease. In order to qualify as meeting the criteria, the fever and the abdominal pain had to last for at least 12 hours (usually, 12–72 hours), and the abdominal pain had to be severe enough that the patient was unable to get out of bed without assistance or that peritoneal signs were elicited on physical examination.

The patients had previously undergone molecular genetic testing and were found to have 1 MEFV mutation. Clinical details were taken from the patients' medical records.

MEFV expression analysis

From each study participant, 5 ml of blood was drawn into tubes containing heparin, and RNA and DNA were extracted using a commercial kit (Gentra Systems, Minneapolis, MN). Complementary DNA (cDNA) was formed using random primers (Reverse-iT First-Strand synthesis kit; ABgene, Surrey, UK), and the transcript of MEFV was amplified in 6 overlapping segments (Table 1).

Table 1. Primers used for MEFV cDNA amplification*
SegmentForward primerReverse primerTemperatureExon
  • *

    The MEFV cDNA transcript was amplified in 6 overlapping segments. 5′-UTR = 5′-untranslated region.

1GCTCGAGCCTCTCCTGCTCTTCTCTCTGCGTTTGCTCAG56°C5′-UTR, exons 1–2
2AGCCCAGGAGCCTGAAGACGTACCGTCAACTGGGTCTCCTT55°CExons 2–3
3TCTGGACTCGGCAACAGAACTTTCAGAAAGCTCACTGCCTTC55°CExons 3–4
4GAAAATTCAGAAGCAGCTGGAGACATTAACAGCATGTGCCTGAG58°CExons 4–7
5TCAGAGTTTGTGGAGAAGAGCACAGGGCTGAAGATAGGTTGAAG58°CExons 7–10
6TTACAATGTGACAGCCAGATCCTAGGCTTCCCATATCCTCAAGA56°CExon 10, 3′-UTR

DNA and cDNA amplifications were performed in a 25-μl reaction volume containing 50 ng of DNA, 13.4 ng of each primer, 1.5 mM dNTPs, in 1.5 mM MgCl2 polymerase chain reaction buffer, with 1.2 units of Taq polymerase (Bioline, London, UK). After an initial denaturation at 95°C for 5 minutes, 30 cycles were performed (94°C for 30 seconds, 55–58°C for 30 seconds, and 72°C for 30 seconds), followed by a final extension at 72°C for 10 minutes. Sequencing was performed using an automated ABI Prism 3100 Genetic Analyzer (PerkinElmer, Warrington, UK).

Haplotype analysis

Haplotypes were determined with 4 polymorphic markers: D16S3275 and D16S3373, which are located upstream of the MEFV gene, and D16S2617 and D16S3070, which are located downstream of the gene. Markers were amplified under the conditions described above and were analyzed with an automated ABI Prism 3100 Genetic Analyzer.

MEFV deletion analysis

The search for genomic deletions was performed with the use of a commercial multiplex ligation-dependent probe amplification (MLPA) kit (Salsa MLPA P094 MEFV Probemix; MRC-Holland, Amsterdam, The Netherlands). The kit includes 15 probes for the coding exons, the 5′-untranslated region (5′-UTR), and the 3′-UTR region of the MEFV gene. As controls, the kit includes 10 probes from other chromosomes. The MLPA protocol was performed as previously described (13), using 100 ng of DNA from 3 healthy control subjects and FMF patients. Products were analyzed with an ABI Prism 3100 Genetic Analyzer, and the data were analyzed with MRC-Coffalyser version 3 software (MRC-Holland).

RESULTS

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES

Analysis of the entire MEFV cDNA revealed a second mutation in 2 of the 20 FMF patients evaluated. One patient was found to be homozygous for M694V, and the other was compound heterozygous for M694V/V726A. Surprisingly, in 18 of the patients no additional mutations were detected.

Twelve single-nucleotide polymorphisms (SNPs) were found throughout the MEFV gene, 10 in the coding region and 2 in the 3′-UTR, all of which have previously been reported. Each of the patients was heterozygous for at least 1 of the SNPs, ruling out the possibility of silencing of 1 of the alleles due to an unknown mutation in the promoter, a mutation in an intronic sequence, or abnormal methylation. MLPA studies performed in the 18 heterozygous patients excluded genomic deletions in the MEFV gene. All of these 18 patients were found to have 2 copies of the MEFV gene. Thus, in this group of patients, we found no role of copy number variation in the pathogenesis of the disease.

Three of the study participants had first-degree relatives with FMF. We therefore performed haplotype analyses of these patients and their family members, using 4 polymorphic markers located very close to, and on both sides of, MEFV (Figure 1). In family A, the M694V homozygous mother transmitted a carrier allele to each of her 3 children. Two of the affected children (subjects A-3 and A-5) inherited the same allele from the father, but 1 child (subject A-4) inherited the opposite allele. The father's cDNA was fully sequenced, but no mutations were found. In family B, the 2 affected brothers inherited the opposite noncarrier haplotypes. Neither of the parents had any symptoms consistent with FMF. In family C, both affected children inherited the same allele from the mother and from the father. Thus, only family C is consistent with a recessive mode of inheritance and an unidentified mutation on the second allele. However, this may have occurred by chance.

thumbnail image

Figure 1. Family pedigrees and findings of haplotype analyses in 3 patients with familial Mediterranean fever (FMF) who had first-degree relatives with FMF. Solid circles and squares in the pedigree represent affected family members. Rectangles underneath the pedigree symbols represent chromosomes; solid rectangles indicate carrier chromosomes and open rectangles indicate noncarrier chromosomes. Four polymorphic markers located very close to, and on both sides of, MEFV were used. Top row to bottom row: D16S3070, D16S2617, D16S3373, and D16S3275. MEFV mutations are indicated as WT (wild-type), 694 (M694V), and 369 (P369S).

Download figure to PowerPoint

Clinical details of the 18 patients with a single mutation in the MEFV gene are provided in Table 2. The most prominent features were fever and abdominal pain, which were present in all of the patients. Arthritis and erysipelas-like erythema were rare. Disease symptoms were mild in most of the patients, and amyloidosis was not found in any of them. The majority of patients carried the M694V allele, but V726A and P369S were also detected (1 patient each). The mean ± SD dosage of colchicine needed to control the disease symptoms was 1.333 ± 0.641 mg/day. Over time, 8 of the patients tried to stop treatment, but had to resume it because of recurrence of disease symptoms. This self challenge can be taken as further proof of the diagnosis of FMF.

Table 2. Clinical symptoms and results of mutation analysis in the 18 FMF patients with a single MEFV mutation*
PatientAge at symptom onset, yearsCurrent age, yearsMutationFMF symptomsColchicine dosage, mg/day
Abdominal painFeverChest painArthritisELEAmyloidosis
  • *

    No mutation on the second allele (/0) was identified in any of these 18 patients with familial Mediterranean fever (FMF). ELE = erysipelas-like erythema.

  • Patients who stopped and then resumed colchicine treatment after recurrence of FMF attacks.

12.510M694V/0++1.5
26.556M694V/0++3
3102.6M694V/0+++1
435.2M694V/0++1
589.8M694V/0+++1
64.55.5M694V/0++1
7214.1M694V/0++1
837.4M694V/0++1
91.52.9M694V/0++0.5
10Infancy8.3M694V/0+++1.5
111725M694V/0++1
12Infancy14.6M694V/0+++++2
131.54M694V/0+++1
14731M694V/0+++2
1515.516.5M694V/0++2
1624M694V/0++1
171719V726A/0+++1
181131P369S/0++2.5

DISCUSSION

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES

In this study, we examined the clinical and genetic features of 18 unrelated patients with definitive symptoms of FMF who carried only 1 mutation in the MEFV gene. Despite an exhaustive analysis of MEFV, no additional mutations were found in these 18 patients. A second mutation was identified in only 2 of our entire study population of 20 unrelated patients with FMF.

Sequencing of cDNA, as performed in this study, offers 2 main advantages over that of genomic DNA. First, it allowed us to rule out silencing of the second allele due to a possible mutation in regulatory noncoding regions. Second, the cDNA sequencing results ruled out de novo mutations that, theoretically, could occur only in white blood cells. Since neither genomic nor cDNA sequencing can rule out the existence of large genomic deletions or duplications on the second allele, we used an MLPA technique to search for genomic deletions. MLPA is a relatively new technique that has led to the detection of new mutations in many of the diseases of Mendelian inheritance. No alterations were detected in our patients. This is consistent with the results of a recent study using MLPA analysis of 216 patients with FMF, which found no deletions or duplications (14).

These findings highlight the possibility that the pathogenesis of the disease in this cohort of patients involves only a single MEFV mutation. In an attempt to further test this hypothesis, we performed haplotype studies in the families of 3 patients who had first-degree relatives with FMF who were available for testing. In 2 of the 3 families in which affected siblings were analyzed, we demonstrated that a typical recessive mode of inheritance is unlikely and that vertical transmission of a single mutation from 1 parent is more likely to explain the disease pathogenesis.

The most common presentation in our patients was fever and abdominal pain. Although the differential diagnosis of these 2 symptoms is broad, their recurrent appearance and prompt response to colchicine therapy are highly specific for a diagnosis of FMF. Arthritis and erysipelas-like erythema were less common, and none of the patients had amyloidosis. A relatively low dose of colchicine was sufficient to control the symptoms. The presence of arthritis, erysipelas-like erythema, and amyloidosis and the requirement of high-dose colchicine characterize a more severe disease and have been shown to coincide with severe mutations, such as homozygous M694V (15). The patients with 1 mutation tended to have milder disease as compared with the patients with 2 mutations, and it was manifested mainly by fever and abdominal symptoms.

The findings described above cannot provide definitive proof, but taken together, the results are highly consistent with the existence of a clinical phenotype among some patients heterozygous for FMF and, thus, have several important implications. First, in some cases, FMF can be viewed as a dominant condition with low penetrance and variable disease expression, presenting not only in homozygous subjects, but also in heterozygous subjects. Heterozygous patients tend to have relatively mild disease, but the disease cannot be distinguished clinically from that in homozygous patients. Second, considering the fact that in 90% of the patients included in this study, only 1 MEFV mutation was found, single-mutation FMF may be much more common than has previously been thought, and it may include up to 25% of the patients with clinical disease. Third, in the Israeli population, if screening for the common mutations does not reveal 2 disease-associated mutations, it is highly ineffective to perform further analyses.

Interestingly, FMF caused by a single mutation is not limited to severe mutations such as M694V. It also occurs in the presence of mild mutations such as V726A and P369S. Why the subclinical inflammation that is found in many heterozygous patients with FMF transforms into overt disease is largely unknown, but it is likely to involve other modifier genes and environmental factors, many of which probably play a role in the penetrance and expressivity of the “2-mutation disease.” Future genome-wide association studies may help to identify some of these genes.

In conclusion, our study shows that the genetics of FMF are more complex than has previously been appreciated. Partial penetrance and variable expression in heterozygous subjects could explain the lack of a second mutation in many of the patients. It could also explain vertical transmission in some families and mild FMF-like symptoms in seemingly unaffected family members. In addition, our results have important implications for genetic counseling.

AUTHOR CONTRIBUTIONS

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES

All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. E. Pras had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study conception and design. Marek-Yagel, Berkun, Padeh, Reznik-Wolf, Livneh, E. Pras.

Acquisition of data. Marek-Yagel, Berkun, Padeh, Reznik-Wolf, M. Pras, E. Pras.

Analysis and interpretation of data. Marek-Yagel, Berkun, Abu, Reznik-Wolf, Livneh, M. Pras, E. Pras.

REFERENCES

  1. Top of page
  2. Abstract
  3. PATIENTS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. REFERENCES
  • 1
    Sohar E, Gafni J, Pras M, Heller H. Familial Mediterranean fever: a survey of 470 cases and review of the literature. Am J Med 1967; 43: 22753.
  • 2
    The International FMF Consortium. Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever. Cell 1997; 90: 797807.
  • 3
    Federici L, Rittore-Domingo C, Kone-Paut I, Jorgensen C, Rodiere M, Le Quellec A, et al. A decision tree for genetic diagnosis of hereditary periodic fever in unselected patients. Ann Rheum Dis 2006; 65: 142732.
  • 4
    Padeh S, Shinar Y, Pras E, Zemer D, Langevitz P, Pras M, et al. Clinical and diagnostic value of genetic testing in 216 Israeli children with familial Mediterranean fever. J Rheumatol 2003; 30: 18590.
  • 5
    Tchernitchko D, Moutereau S, Legendre M, Delahaye A, Cazeneuve C, Lacombe C, et al. MEFV analysis is of particularly weak diagnostic value for recurrent fevers in western European Caucasian patients. Arthritis Rheum 2005; 52: 36035.
  • 6
    Bernot A, da Silva C, Petit JL, Cruaud C, Caloustian C, Castet V, et al. Non-founder mutations in the MEFV gene establish this gene as the cause of familial Mediterranean fever (FMF). Hum Mol Genet 1998; 7: 131725.
  • 7
    Lachmann HJ, Sengul B, Yavuzsen TU, Booth DR, Booth SE, Bybee A, et al. Clinical and subclinical inflammation in patients with familial Mediterranean fever and in heterozygous carriers of MEFV mutations. Rheumatology (Oxford) 2006; 45: 74650.
  • 8
    Holmes AH, Booth DR, Hawkins PN. Familial Mediterranean fever gene. N Engl J Med 1998; 338: 9923.
  • 9
    Livneh A, Aksentijevich I, Langevitz P, Torosyan Y, G-Shoham N, Shinar Y, et al. A single mutated MEFV allele in Israeli patients suffering from familial Mediterranean fever and Behçet's disease (FMF-BD). Eur J Hum Genet 1998; 9: 1916.
  • 10
    Booth DR, Gillmore JD, Lachmann HJ, Booth SE, Bybee A, Soyturk M, et al. The genetic basis of autosomal dominant familial Mediterranean fever. QJM 2000; 93: 21721.
  • 11
    Aldea A, Campistol JM, Arostegui JI, Rius J, Maso M, Vives J, et al. A severe autosomal-dominant periodic inflammatory disorder with renal AA amyloidosis and colchicine resistance associated to the MEFV H478Y variant in a Spanish kindred: an unusual familial Mediterranean fever phenotype or another MEFV-associated periodic inflammatory disorder? Am J Med Genet A 2004; 124A: 6773.
  • 12
    Pras M, Kastner DL. Familial Mediterranean fever. In: KlippelJH, DieppePA, editors. Rheumatology. 2nd ed. London: Mosby; 1997. p. 23.123.4.
  • 13
    Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 2002; 30: e57.
  • 14
    Van Gijn ME, Soler S, de la Chapelle C, Mulder M, Ritorre C, Kriek M, et al. Search for copy number alterations in the MEFV gene using multiplex ligation probe amplification, experience from three diagnostic centres. Eur J Hum Genet 2008. E-pub ahead of print.
  • 15
    Shinar Y, Livneh A, Langevitz P, Zaks N, Aksentijevich I, Koziol DE, et al. Genotype-phenotype assessment of common genotypes among patients with familial Mediterranean fever. J Rheumatol 2000; 27: 17037.