SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

Objective

The main feature of osteoarthritis (OA) is degradation and loss of articular cartilage. Interleukin-1β (IL-1β) is thought to have a prominent role in shifting the metabolic balance toward degradation. IL-1β is first synthesized as an inactive precursor that is cleaved to the secreted active form mainly in the “inflammasome,” a complex of initiators (including NLRP3), adaptor molecule ASC, and caspase 1. The aim of this study was to clarify the roles of IL-1β and the inflammasome in cartilage breakdown.

Methods

We assessed IL-1β release by cartilage explants from 18 patients with OA. We also evaluated the lipopolysaccharide (LPS)–, IL-1α–, and tumor necrosis factor α (TNFα)–induced activity of matrix metalloproteinase 3 (MMP-3), MMP-9, and MMP-13 in NLRP3-knockout mice and wild-type mice and the inhibition of caspase 1 with Z-YVAD-FMK and the blockade of IL-1β with IL-1 receptor antagonist (IL-1Ra). Cartilage explants from NLRP3-knockout mice and IL-1R type I (IL-1RI)–knockout mice were subjected to excessive dynamic compression (0.5 Hz, 1 MPa) to trigger degradation, followed by assessment of load-induced glycosaminoglycan (GAG) release and MMP enzymatic activity.

Results

Despite the expression of NLRP3, ASC, and caspase 1, OA cartilage was not able to produce active IL-1β. LPS, IL-1α, and TNFα dose-dependently increased MMP-3, MMP-9, and MMP-13 activity in cultured chondrocytes and in NLRP3−/− chondrocytes, and this effect was not changed by inhibiting caspase 1 or IL-1β. The load-induced increase in GAG release and MMP activity was not affected by knockout of NLRP3 or IL-1RI in cartilage explants.

Conclusion

OA cartilage may be degraded independently of any inflammasome activity, which may explain, at least in part, the lack of effect of IL-1β inhibitors observed in previous trials.

Osteoarthritis (OA) is the most prevalent disease of articular joints and is the major cause of disability in older adults in industrialized countries (1). The main features of OA are degeneration and loss of articular cartilage, which occur concomitantly with changes in the underlying bone and some degree of synovial inflammation (2, 3). Cartilage breakdown is attributable to nonspecific cleavage of matrix molecules in response to abnormal biomechanical stress (3) and to specific catabolic processes involving matrix-degrading enzymes. As a result of this degeneration, glycosaminoglycan (GAG) and collagen fragments (mostly type II collagen) are released from OA cartilage. Along with aggrecanases (ADAMTS-4 and ADAMTS-5), numerous matrix metalloproteinases (MMPs) contribute to this degradation. In particular, MMP-3, MMP-9, and MMP-13 together can cleave proteoglycans and type II and type XI collagens (4, 5).

In addition to its crucial role in the context of infections and immune-mediated disease, the inflammatory cytokine interleukin-1β (IL-1β) is considered to be involved in joint diseases, including OA (6). Notably, IL-1β is a potent regulator of MMP expression and activity (6, 7). IL-1β is first synthesized as an inactive precursor to pro–IL-1β, which requires cleavage of its amino-terminal region by caspase 1 to change into the secreted active form. Caspase 1 itself needs to be converted from pro–caspase 1 to active caspase 1 via a molecular scaffold called the “inflammasome.” The inflammasome is also involved in the processing of IL-18 and IL-1F7 (for review, see refs.8–10) but not IL-1α, which is processed independently by calpain proteases.

Four inflammasome subtypes have been defined on the basis of the initiator proteins. Three of these initiator proteins, NLRP1, NLRP3, and NLRC4/IPAF, belong to NLR family. The fourth possible initiator protein is AIM2. These initiators recruit the adaptor molecule ASC, which interacts with pro–caspase 1. Formation of the complex initiates proximity-induced autocleavage of pro–caspase 1 into caspase 1. The NLRP3 inflammasome subtype has been studied most often. Because the inflammasome is a master regulator of inflammation, research is now focusing on the mechanisms leading to its activation (for review, see refs.8–12). Known activators of NLRP3 are danger-associated molecular patterns and pathogen-associated molecular patterns, including ATP and particulate or crystalline agonists such as fibrillar amyloid β peptide, monosodium urate, or silica (9).

In addition to its intracellular maturation by caspase 1, pro–IL-1β can be activated by extracellular proteases such as trypsin, chymotrypsin, cathepsin G, elastase, or some MMPs (13). Specifically, MMP-9, and to a lesser extent MMP-3 and MMP-2, can process the IL-1β precursor into biologically active forms (14). Such activity from MMP family members is of particular interest in the context of OA cartilage, because MMP levels are particularly high in OA joints (4).

Given the primary role of the inflammasome in IL-1β maturation and the putative role of IL-1β in OA pathology, we sought to clarify the role of both the inflammasome and IL-1β in cartilage breakdown. We first investigated the expression of inflammasome components and the capacity of human OA knee joint cartilage explants to release active IL-1β. Second, we triggered a prodegradative phenotype in primary mouse articular chondrocytes, using the following proinflammatory treatments: lipopolysaccharide (LPS), IL-1α, and tumor necrosis factor α (TNFα). We studied the effect of NLRP3 knockout, caspase 1 inhibition, and IL-1 blockade in order to assess the involvement of the inflammasome and IL-1β in the inflammatory stress–induced prodegradative responses of chondrocytes. Finally, we used dynamic compression to induce biomechanical degradation in mouse cartilage explants in order to investigate the role of NLRP3 and IL-1β in mechanical stress–induced cartilage breakdown.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

Effectors and inhibitors.

LPS and TNFα were obtained from Sigma-Aldrich. Z-YVAD-FMK peptide, a cell-permeable inhibitor of caspase 1, was obtained from Alexis Biochemicals. IL-1α, IL-1β, and IL-1 receptor antagonist (IL-1Ra) were obtained from PeproTech.

Human OA cartilage and synovium.

Human joint samples were obtained from the Department of Bone and Joint Diseases at AP-HP Saint-Antoine Hospital as surgical waste, in the absence of patient opposition and in accordance with French ethics laws (L. 1211-2 to L. 1211-7, L. 1235-2, and L. 1245.2). Both cartilage and synovium samples were obtained from 18 patients undergoing total joint replacement for OA. The OA diagnosis was based on clinical and radiographic evaluation according to the American College of Rheumatology criteria (15). The investigation conformed to the principles outlined in the Declaration of Helsinki.

Animals.

All experiments involving pharmacologic inhibitor treatments were performed on primary chondrocytes extracted from 6-day-old Swiss mice (Janvier). Some experiments were performed using NLRP3-knockout mice (a gift from J. Tschopp, Lausanne University, Switzerland [16]) or IL-1R type I (IL-1RI)–knockout mice (a gift from Dr. Pap). All of the mice were housed in a pathogen-free facility. All procedures were performed in accordance with the European Directive N886/609 and the local committees for animal use and care.

Genomic DNA from mice tail fragments was prepared according to the HotSHOT technique (17) and was used for genotyping. The screening strategy allowed for polymerase chain reaction (PCR) amplification of both mutant and wild-type (WT) allele fragments in the same tube. For NLRP3 genotyping, the mutant fragment was 500 bp, the WT fragment was 250 bp, and the primer sequences were as follows: common sense TCAAGCTAAGAGAACTTTCTG, mutant antisense AAGTCGTGCTGCTTCATGT, and WT antisense ACACTCGTCATCTTCAGCA. For IL-1RI genotyping, the mutant fragment was 170 bp, the WT fragment was 350 bp, and the primer sequences were as follows: mutant sense CTGAATGAACTGCAGGACGA, mutant antisense ATACTTTCTCGGCAGGAGCA, WT sense CCACATATTCTCCATCATCTCTGCTGGTA, and WT antisense TTTCGAATCTCAGTTGTCAAGTGTGTCCC.

Primary culture of articular chondrocytes.

Primary chondrocytes were isolated from the articular cartilage of mice (ages 4–6 days), as previously described (18). After 1 week of amplification, the cells were placed in serum-free conditions (0.1% bovine serum albumin; Sigma-Aldrich) for 24 hours and then treated in serum-free medium supplemented with up to 1 μg/ml LPS, 10 ng/ml IL-1α, or 100 ng/ml TNFα with or without pharmacologic inhibitors (10 μM Z-YVAD-FMK and 100 ng/ml IL-1Ra). Human chondrocytes were isolated and amplified for 1 week, using identical protocols. Chondrocytes were extracted from the articular cartilage from a patient with OA who was undergoing total joint replacement surgery.

Mouse cartilage explants and compression experiments.

The procedure for compression of mouse costal cartilage explants was performed as previously described (19). Briefly, explants were harvested from the rib cages of mice (ages 4–6 days). Once cleaned, divided into segments, pooled, and weighed for further normalization, the explants were allowed to rest for ∼20 hours in 3 ml of serum-free medium and then washed, and 1.5 ml of fresh medium was added. The samples then underwent 6-hour dynamic compression (sinusoidal waveform 0–1 MPa at 0.5 Hz), using a Flexcell compression system.

Real-time PCR analysis.

Total RNA was extracted from monolayer-cultured cells, using an RNeasy Mini Kit (Qiagen). Complementary DNA samples were obtained by reverse transcription of 1 μg RNA, using an Omniscript kit (Qiagen). Relative quantification of genes was performed using a LightCycler 480 Real-Time PCR System (Roche Applied Science) and GoTaq qPCR Master Mix (Promega). Messenger RNA (mRNA) levels were normalized to that of hypoxanthine guanine phosphoribosyltransferase (HPRT), which was used as an internal standard. Hybridization at 60°C was performed for the following murine primer sequences: for MMP-2, sense GATGCTGCCTTTAACTGGAGTA and antisense GGAGTCTGCGATGAGCTT; for MMP-3, sense TGAAAATGAAGGGTCTTCCGG and antisense GCAGAAGCTCCATACCAGCA; for MMP-9, sense AACTACGGTCGCGTCCACT and antisense CCACAGCCAACTATGACCAG; for MMP-13, sense GATGGCACTGCTGACATCAT and antisense TGTAGCCTTTGGAACTGCTT; for ADAMTS-4, sense CTTCCTGGACAATGGTTATGG and antisense GAAAAGTCGCTGGTAGATGGA; for ADAMTS-5, sense CAGCCACCATCACAGAA and antisense CCAGGGCACACCGAGTA; for IL-1β, sense GGGCCTCAAAGGAAAGAATC and antisense CCACTTTGCTCTTGACTTCTATC; for IL-18, sense TCTGCAACCTCCAGCAT and antisense TTTCTTCAGGTATAAAGTAAAGCGTG; for HPRT, sense AGGACCTCTCGAAGTGT and antisense ATTCAAATCCCTGAAGTACTCAT.

Soluble IL-1β and IL-18 assay in OA cartilage and synovium–conditioned medium.

Explants of cartilage and synovium from the same patient with OA were cut into small pieces (∼1 mm3), weighed, and incubated for 24 hours in serum-free RPMI medium (with or without 1 μg/ml of LPS or 100 ng/ml of TNFα). The incubation volume was normalized to the wet weight of the explants (6 ml/gm). The levels of soluble IL-1β and IL-18 were measured in the conditioned medium, using a high-sensitivity enzyme-linked immunosorbent assay (ELISA) kit for human IL-1β with a detection threshold of 0.4 pg/ml (Sanquin), and a kit for human IL-18 with a detection threshold of 12.5 pg/ml (Life Technologies).

Assay of MMP-3, MMP-9, and MMP-13 secretion.

Total mouse MMP-3 secretion was assayed using a commercially available ELISA kit with a detection threshold of 0.2 ng/ml (R&D Systems). Total mouse MMP-13 secretion was determined by Western blot analysis, as previously described (20), with rabbit polyclonal antibody for MMP-13 (H-230; Santa Cruz Biotechnology). Densitometric analysis of immunoblots was performed using Multi-Gauge software (Fujifilm Medical Systems). MMP-9 secretion was analyzed by zymography with 8% acrylamide/bis-acrylamide separation gel containing 1.2 mg/ml gelatin (21). Briefly, after electrophoresis under nonreducing conditions and sodium dodecyl sulfate removal, gels were incubated overnight at 37°C in hydrolysis buffer (50 mM Tris HCl, pH 7.4, 100 mM NaCl, 5 mM CaCl2). Lysis bands were detected by negative staining with Coomassie brilliant blue R250. Samples were concentrated using cellulose membrane columns with a weight cutoff of 3 kd (Ultracel-3K; Millipore); a bicinchoninic acid quantification kit (Interchim) was used to standardize measurements to the total protein concentration.

GAG assays.

The release of sulfated GAG by cartilage explants into culture media was examined by determining the amount of polyanionic material reacting with dimethylmethylene blue (22), with shark chondroitin sulfate used as a standard. Results were normalized to the milligram wet weight of cartilage and the concentration of proteins in the culture supernatant.

MMP enzymatic activity assays.

Global MMP activity was measured using Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 synthetic fluorogenic substrate (Bachem) in continuous assays (21, 22). When 1% EDTA was added, enzymatic activity was completely inhibited; this demonstrated that metal cations were needed as coactivators as expected, because all MMPs depend on Zn2+. Results were normalized to the milligram wet weight of cartilage and the concentration of proteins in the culture supernatant.

Statistical analysis.

Data are expressed as the mean ± SEM and were analyzed by analysis of variance, using InStat software (GraphPad). P values less than 0.05 were considered significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

Slight amounts of IL-1β released by human OA cartilage.

We assessed IL-1β release by cartilage explants and synovial tissue from 18 patients with OA. Soluble IL-1β release by OA cartilage samples was poorly detectable (Figure 1A); it was not detected in 6 of 18 patients. The release of IL-1β by synovium explants was greater than that from cartilage (mean ± SEM 854 ± 533 versus 8 ± 2 pg/gm) (Figure 1A). The IL-18 concentration in cartilage and synovium from 9 of 18 patients was measured; IL-18 was not detected in conditioned media from cartilage explants (detection threshold 75 pg/gm) but was detected in media from synovium (mean ± SEM 2,064 ± 545 pg/gm) (data not shown). The concentrations obtained using this protocol may represent the release of newly synthesized cytokines and former cytokines trapped in the tissue.

thumbnail image

Figure 1. Release of interleukin-1β (IL-1β) by cartilage (C) and synovium (S) from 18 patients with osteoarthritis (OA). A, Soluble IL-1β concentrations in conditioned medium after 24-hour incubation with cartilage explants, as determined by enzyme-linked immunosorbent assay (ELISA). Corresponding synovium explants were used as positive controls. ∗ = P < 0.05. B, Fold induction of IL-1β in response to treatment with proinflammatory agents, as determined by ELISA. Cartilage and synovium explants from 4 patients with OA were stimulated with 1 μg/ml lipopolysaccharide (LPS) or 100 ng/ml tumor necrosis factor α (TNFα). Results for treated explants were normalized to those for untreated explants. Symbols represent individual data points. Boxed areas show the mean. The broken line represents no induction. ∗∗ = P < 0.01 versus no induction.

Download figure to PowerPoint

Inability of human OA cartilage to produce IL-1β despite the presence of NLRP3–inflammasome components.

To evaluate the putative capacity of OA chondrocytes to produce IL-1β and IL-18, we investigated the presence of inflammasome components involved in pro–IL-1β and pro–IL-18 maturation. Western blot analysis revealed the expression of caspase 1, ASC, and NLRP3 protein in lysates of primary chondrocytes from OA knee joint explants (data not shown). The mRNA expression of inflammasome components in chondrocytes was confirmed by quantitative reverse transcription–polymerase chain reaction (data not shown). Therefore, OA chondrocytes expressed all of the components needed for the maturation of IL-1β and IL-18.

To determine the ability of OA tissue to secrete newly synthesized IL-1β and IL-18, we stimulated cartilage and synovium explants from 4 patients with OA with 1 μg/ml LPS for 24 hours. LPS stimulation of cartilage samples did not increase the expression of soluble IL-1β in conditioned media (Figure 1B), and IL-18 expression remained undetectable (results not shown). However, the same LPS treatment increased IL-1β release from synovium explants (from 28-fold to 74-fold) (Figure 1B); no change in IL-18 release was observed (results not shown). Cartilage and synovium explants from 4 other patients with OA were stimulated for 24 hours with 100 ng/ml TNFα. Similarly, TNFα treatment increased IL-1β release by synovium explants (from 2-fold to 32-fold) but not from cartilage explants (Figure 1B). More precisely, IL-1β was detected in only 1 of the 4 untreated cartilage explants, and its level was not further increased by TNFα stimulation. In 2 of the 3 other samples, IL-1β was detected following TNFα treatment but only at low levels (17 pg/gm and 2 pg/gm, respectively). Incubation for 24 hours did not alter cell viability in the explants (data not shown).

Inflammatory stress–induced prodegradative response of mouse articular chondrocytes.

LPS, IL-1α, and TNFα treatments activated a prodegradative phenotype in mouse articular chondrocytes, as evaluated by induction of cartilage matrix degradation enzymes. The expression of MMP-3, MMP-13, and MMP-9 mRNA was up-regulated, but the expression of MMP-2, ADAMTS-4, and ADAMTS-5 mRNA was not up-regulated (Figure 2A). A dose-dependent induction of these 3 major cartilage MMPs at the protein level was confirmed by the observation that proinflammatory treatments significantly increased MMP-3 release into chondrocyte culture medium. The amount of MMP-3 released was 447 ng/ml with 1,000 ng/ml LPS, 302 ng/ml with 10 ng/ml IL-1α, and 51 ng/ml with 100 ng/ml of TNFα (Figure 3A). In addition, MMP-13 release was dose-dependently increased in response to LPS and IL-1α (Figure 3B). Finally, inflammatory stress–induced MMP-9 secretion was assessed by gelatin zymography (Figure 3C). The 3 MMPs were used as prodegradative markers for the experiments with cultured mouse chondrocytes.

thumbnail image

Figure 2. Dose-dependent stimulation of protease expression by primary cultures of mouse articular chondrocytes in response to inflammatory stress. Chondrocytes were left untreated (open bars) or were treated for 24 hours with LPS (10 ng/ml [shaded bars] or 1,000 ng/ml [solid bars]), IL-1α (1 ng/ml [shaded bars] or 10 ng/ml [solid bars]), or TNFα (10 ng/ml [shaded bars] or 100 ng/ml [solid bars]). The expression of matrix metalloproteinase 2 (MMP-2), ADAMTS-4, ADAMTS-5, MMP-3, MMP-13, and MMP-9 was determined by real-time polymerase chain reaction analysis. Values are the mean ± SEM. ∗ = P < 0.05; ∗∗ = P < 0.01 versus untreated. See Figure 1 for other definitions.

Download figure to PowerPoint

thumbnail image

Figure 3. Dose-dependent stimulation of protease release by primary cultures of mouse articular chondrocytes in response to inflammatory stress. Chondrocytes were left untreated (open bars) or were treated for 24 hours with LPS (10 ng/ml [shaded bars] or 1,000 ng/ml [solid bars]), IL-1α (1 ng/ml [shaded bars] or 10 ng/ml [solid bars]), or TNFα (10 ng/ml [shaded bars] or 100 ng/ml [solid bars]). A, Total matrix metalloproteinase 3 (MMP-3) secretion in culture media, as determined by ELISA. B, Quantification of MMP-13 protein expression, as determined by Western blot analysis; the immunoblots were analyzed by densitometry. C, MMP-9 activity, as determined using gelatin zymography. The results in B and C are representative of 4 independent experiments. Values are the mean ± SEM. ∗ = P < 0.05 versus untreated; ∗∗ = P < 0.01 versus untreated. See Figure 1 for other definitions.

Download figure to PowerPoint

NLRP3- and caspase 1–independent prodegradative response of mouse articular chondrocytes.

To characterize the role of the NLRP3 inflammasome in the prodegradative response of chondrocytes, we used NLRP3−/− mouse chondrocytes. The mRNA and protein levels of MMP-3, MMP-13, and MMP-9 induced by inflammatory stress was similar in WT and NLRP3−/− chondrocytes (Figure 4). The response may involve other inflammasome subtypes. Because caspase 1 is a required partner of all inflammasomes, we inhibited its enzymatic activity with Z-YVAD-FMK (10 μM). The nontoxicity, efficiency, and specificity of the inhibitor at this concentration have been shown in primary chondrocytes (23). MMP-3, MMP-9, or MMP-13 stimulation at the mRNA level (data not shown) or the protein level (Figures 5A–C) was similar with and without caspase 1 inhibition. These results strongly suggest that chondrocytes can acquire a catabolic phenotype in inflammasome-independent pathways.

thumbnail image

Figure 4. Involvement of NLRP3 in the inflammatory stress–induced prodegradative response of mouse primary articular chondrocytes. NLRP3−/− and wild-type (WT) mouse chondrocytes were treated for 24 hours with LPS (1 μg/ml), IL-1α (10 ng/ml), or TNFα (100 ng/ml). A, Expression of matrix metalloproteinase 3 (MMP-3), MMP-13, and MMP-9 mRNA, as determined by real-time polymerase chain reaction analysis. B, Total MMP-3 release, as determined by ELISA. C, MMP-13 protein expression, as determined by Western blot analysis. D, MMP-9 activity, as determined using gelatin zymography. Results in D are representative of 3 independent experiments. Values in A–C are the mean ± SEM. ∗ = P < 0.05; ∗∗ = P < 0.01 versus untreated. NS = not significant (see Figure 1 for other definitions).

Download figure to PowerPoint

thumbnail image

Figure 5. Involvement of caspase 1 and IL-1β in the inflammatory stress–induced prodegradative response of mouse primary articular chondrocytes. Chondrocytes were treated for 24 hours with LPS (1 μg/ml), IL-1α (10 ng/ml), or TNFα (100 ng/ml), with or without 10 μM Z-YVAD-FMK to inhibit caspase 1 enzymatic activity (A–C) and with or without 100 ng/ml IL-1 receptor antagonist (IL-1Ra) to block IL-1β (D–F). A and D, Total matrix metalloproteinase 3 (MMP-3) release, as determined by ELISA. B and E, Protein levels of MMP-13, as determined by Western blot analysis. C and F, MMP-9 activity, as determined using gelatin zymography. Values in A, B, D, and E are the mean ± SEM. Results in C and D are representative of 3 independent experiments. ∗ = P < 0.05; ∗∗ = P < 0.01; ∗∗∗ = P < 0.001 versus untreated. Ctrl = control; NS = not significant (see Figure 1 for other definitions).

Download figure to PowerPoint

IL-1β–independent prodegradative response of mouse articular chondrocytes.

Because proteolytic mechanisms other than inflammasomes may be implicated in IL-1β maturation, we sought to determine whether IL-1β could be released by mouse articular chondrocytes in response to proinflammatory treatments. Freshly produced IL-1β could act as an autocrine prodegradative inducer. Thus, we added a high concentration of IL-1Ra (100 ng/ml), together with LPS or TNFα, to the chondrocyte culture and observed that the induction of MMP-3, MMP-9, or MMP-13 mRNA (data not shown) and protein in response to LPS or TNFα was similar with and without IL-1Ra treatment (Figures 5D–F). Thus, LPS- and TNFα-induced matrix protease synthesis by chondrocytes does not involve IL-1β. IL-1Ra, at a dose of 100 ng/ml, could inhibit the increased MMP-3, MMP-9, and MMP-13 release induced by 10 ng/ml of IL-1α (Figures 5D–F).

NLRP3- and IL-1β–independent prodegradative response of mouse cartilage explants to compression.

To ex vivo test our hypothesis that IL-1β is not crucial for a prodegradative phenotype in chondrocytes, we used biomechanical load stimulation to trigger a prodegradative response in mouse cartilage explants. The prodegradative phenotype in the model was defined by 2 criteria: increase in GAG release (a marker of cartilage matrix degeneration) and increase in MMP enzymatic activity in the culture medium. We verified that compression did not alter cell viability in our system (data not shown). Dynamic compression for 6 hours increased GAG release by 3-fold (Figure 6A) and MMP activity by 3.7-fold (Figure 6B).

thumbnail image

Figure 6. Involvement of NLRP3 and interleukin-1β (IL-1β) in the load-induced prodegradative response of mouse cartilage explants. Cartilage explants from IL-1 receptor type I–knockout (IL-1RI−/−) mice (n = 3), NLRP3−/− mice (n = 4), or wild-type (WT) mice (n = 4) were subjected to dynamic compression (0.5 Hz, 1 Mpa) for 6 hours. The results for loaded cartilage explants were normalized to those for corresponding nonloaded explants. A, Amount of glycosaminoglycan (GAG) released from cartilage explants into culture medium. B, Matrix metalloproteinase (MMP) enzymatic activity in culture medium. Values are the mean ± SEM. ∗ = P < 0.05; ∗∗ = P < 0.01; ∗∗∗ = P < 0.001 versus control (Ctrl). NS = not significant.

Download figure to PowerPoint

We analyzed the effect of compression on the prodegradative response of chondrocytes in NLRP3−/− mouse cartilage explants. Similar to in vitro results, the prodegradative response of chondrocytes to compression did not differ between the WT and NLRP3-knockout mice in terms of GAG release (Figure 6A) or MMP activity (Figure 6B). Thus, load-induced GAG release did not depend on NLRP3. Furthermore, mechanical stress–activated chondrocytes could produce functional enzyme activity devoted to cartilage matrix degradation independently of NLRP3.

To exclude the possibility that the prodegradative response to compression was mediated by IL-1β, we used cartilage from mice lacking IL-1RI, which mediates IL-1–dependent signaling. The prodegradative response of these chondrocytes to compression did not differ between the WT and IL-1RI–knockout mice in terms of GAG release (Figure 6A) or MMP enzymatic activity (Figure 6B). Thus, load-induced cartilage matrix degradation did not depend on IL-1β.

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

The question of whether active IL-1β is produced in OA cartilage remains highly controversial. Our results showing slight concentrations of soluble IL-1β released from OA cartilage explants at 24 hours suggest that OA chondrocytes may have poor exposure to IL-1β. These results are consistent with those of previous studies showing low IL-1β concentrations (∼0.4 pg/ml) in synovial fluid from OA knee joints (24–26). However, chondrocytes may have greater exposure to IL-18, the concentration of which in OA synovial fluid is ∼130 pg/ml (25). Even if IL-1β is present in OA joints, we believe that chondrocytes embedded in cartilage matrix may be barely exposed to this cytokine and may not have any exposure in the deep zone.

The capacity of chondrocytes to produce active IL-1β also remains highly controversial. In situ, IL-1β gene expression occurs at low levels in normal cartilage and is not significantly up-regulated in OA cartilage (27). However, local production of IL-1β in OA cartilage may be possible. Colocalization of caspase 1, IL-1β, and IL-18 expression has been demonstrated in OA chondrocytes (28, 29). Moreover, the production of IL-1β and IL-18 in cartilage explants can be blocked by a specific caspase 1 inhibitor (29).

To our knowledge, no in vitro study has demonstrated the release of active IL-1β from cultured chondrocytes, despite up-regulated mRNA or intracellular pro–IL-1β levels (30, 31). In contrast, mature IL-18 appears to be secreted in small amounts by human cultured chondrocytes (32). We observed that LPS, IL-1α, and TNFα dose-dependently increased IL-1β mRNA expression (which was not detected in control chondrocytes). IL-18 mRNA expression was detected at the same level in control and stimulated chondrocytes (data not shown). However, neither IL-1β expression nor IL-18 expression was detected in culture supernatants (detection thresholds 0.4 pg/ml and 12.5 pg/ml, respectively).

To explain why IL-1β does not seem to be produced by activated chondrocytes, we investigated expression of components of the inflammasome, the main cytosolic complex known to convert pro–IL-1β into active IL-1β. We confirmed the protein expression of NLRP3 (also known as NALP3 or cryopyrin), ASC, and caspase 1 (also known as ICE [IL-1β converting enzyme]) in articular chondrocytes from patients with OA. The expression of caspase 1 in human OA chondrocytes has been studied in detail (28, 29). Thus, chondrocytes possess the complete molecular machinery required for formation of the complex needed for IL-1β maturation. However, active IL-1β was barely detectable in OA chondrocyte lysates after in vitro incubation with pro–IL-1β (29), which suggests that the complex may not be functional.

Apart from chondrocytes, other types of joint cells have shown expression of inflammasome components. For instance, the NLRP3/ASC complex is functional in osteoblasts, because NLRP3 was required for caspase 1 activation, which led to osteoblast apoptosis (33). Of note, osteoblasts do not release the caspase 1–dependent cytokines IL-1β and IL-18 (33). NLRP3, ASC, and caspase 1 levels are also detected, at least at the mRNA level, in synovial fibroblasts (34, 35) and whole synovium extracts from patients with OA (36).

Whether IL-1β and IL-18 diffuse from the surrounding synovial fluid into the cartilage matrix is unknown, but the question is relevant in light of increased levels of IL-1β and IL-18 detected in the upper zone of OA articular cartilage (28, 29, 37). Consistently, our results showed that release of IL-1β and IL-18 from synovial membranes was greater than that from cartilage. In addition, activated IL-1β signaling pathways were localized in the uppermost zones of both normal and OA cartilage (27). The secretion of IL-18 has been studied less, but IL-18 production may also occur in the synovium (38).

The active IL-1β detected at slight concentrations in OA cartilage may be synthesized by cells from the synovium and diffused through synovial fluid into the superficial zone of cartilage. More precisely, active IL-1β is probably produced by immune cells present in the synovium under pathologic conditions, even in patients with early OA (34, 39). Indeed, catabolic and proinflammatory mediators, including IL-1β, produced by the inflamed synovium may exacerbate the prodegradative mechanisms responsible for cartilage breakdown, which has led to increasing interest in synovium-targeted therapy in OA (40).

We showed that chondrocytes can acquire a prodegradative phenotype without any contribution by the NLRP3 inflammasome and IL-1β, in 2 different models: release of cartilage catabolic enzymes (MMP-3, MMP-9, and MMP-13) from cultured articular chondrocytes and enhanced matrix degradation of cartilage explants. Neither blockade of the inflammasome complex by NLRP3 deficiency, caspase 1 inhibition, nor inactivation of IL-1β pathways had any effect on such prodegradative responses. Thus, inflammasome activity may not be crucial for OA-like cartilage breakdown.

The role of inflammasomes has been clearly revealed in inflammatory arthritis, which is highly dependent on IL-1β. In gout, acute inflammation is attributable to the presence of monosodium urate crystals that trigger the formation of the NLRP3 inflammasome (16, 41). Similarly, the NLRP3 inflammasome plays a critical role in arthritis; this role is associated with the deposition of hydroxyapatite crystals (42). However, such inflammatory pathways rely on activation of the inflammasome of monocytes or macrophages rather than resident joint cells. ASC−/− mice are protected against arthritis via inflammasome-independent pathways, because mice deficient in NLRP3 or caspase 1 are still susceptible to arthritis (35, 43). These results suggest an effect of ASC in joint pathology through cell-mediated immune responses; to date, however, no study has examined its potential role in chondrocytes themselves. Although some studies have demonstrated that caspase 1 inhibitors could reduce OA scores in animal models (44, 45), we observed that caspase 1 inhibition had no effect on the chondrocyte prodegradative phenotype. These results may not be discordant, because the favorable effect of caspase 1 inhibitors on OA-like lesions observed in vivo may not be attributable to decreased inflammasome activity but rather to diminished apoptotic behavior (23, 44).

More broadly, relatively few studies have broached the role of IL-1β in OA. In agreement with our hypothesis, intraperitoneal injections of IL-1Ra did not affect OA scores in an experimental murine model of OA based on knee meniscectomy (46). Interestingly, a recent clinical study corroborated these results. Chevalier et al evaluated the clinical response to a single intraarticular injection of anakinra, a recombinant form of IL-1Ra, in patients with knee OA and observed no improvement in OA symptoms (knee pain, function, stiffness, cartilage turnover) compared with placebo (47).

Richette et al reported that intraarticular injection of IL-1Ra “might be self-limited” in patients with knee OA (48). Indeed, a high endogenous IL-1Ra–to–IL-1β ratio was observed in knee synovial fluid from patients with OA. This ratio was not associated with pain but may explain the reduced efficiency of intraarticular supplementation with IL-1Ra (48). A limitation of these clinical studies may be timing, because all approaches involving anti–IL-1β have addressed established OA, whereas IL-1β is more likely to be involved in early-onset OA (49).

Moreover, according to Fan et al, OA articular chondrocytes are less responsive than normal chondrocytes to stimulation with IL-1β (50). In vitro, OA chondrocytes showed increased levels of catabolic enzymes and mediators, but this prodegradative phenotype was not further exacerbated by IL-1β treatment (50). Likewise, in a study determining susceptibility to IL-1β in cartilage at different anatomic locations on human OA knee joints, Barakat et al observed that cartilage biopsy specimens obtained from 4 of 12 patients were not susceptible to the effects of IL-1β (51). However, the literature contains some discrepancies relating to this hypothesis (52).

Taken together, the results of this study suggest that OA cartilage can be degraded independently of inflammasome activity, and that the IL-1β that is involved in OA cartilage degradation may not be produced by cartilage itself but rather by synovial tissue.

AUTHOR CONTRIBUTIONS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. Berenbaum had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study conception and design. Bougault, Houard, Jacques, Berenbaum.

Acquisition of data. Bougault, Gosset, Salvat, Godmann, Pap.

Analysis and interpretation of data. Bougault.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

We thank Christine Lamouroux and colleagues for maintaining and breeding the genetically modified mice. We also thank Prof. Jean-Michel Dayer for critically reviewing the manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES