SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

Objective

Syndecan 4, a heparan sulfate proteoglycan, has been associated with osteoarthritis. The present study was undertaken to analyze the functional role of syndecan 4 in endochondral ossification of mouse embryos and in adult fracture repair, which, like osteoarthritis, involves an inflammatory component.

Methods

Sdc4 promoter activity was analyzed in Sdc4−/− lacZ-knockin mice, using β-galactosidase staining. Endochondral ossification in embryos from embryonic day 16.5 was assessed by histologic and immunohistologic staining. Bone fracture repair was analyzed in femora of adult mice on days 7 and 14 postfracture. To evaluate Sdc2 and Sdc4 gene expression with and without tumor necrosis factor α (TNFα) and Wnt-3a stimulation, quantitative real-time polymerase chain reaction was performed.

Results

In Sdc4−/− lacZ-knockin animals, syndecan 4 promoter activity was detectable at all stages of chondrocyte differentiation, and Sdc4 deficiency inhibited chondrocyte proliferation. Aggrecan turnover in the uncalcified cartilage of the epiphysis was decreased transiently in vivo, but this did not lead to a growth phenotype at birth. In contrast, among adult mice, fracture healing was markedly delayed in Sdc4−/− animals and was accompanied by increased callus formation. Blocking of inflammation via anti-TNFα treatment during fracture healing reduced these changes in Sdc4−/− mice to levels observed in wild-type controls. We analyzed the differences between the mild embryonic and the severe adult phenotype, and found a compensatory up-regulation of syndecan 2 in the developing cartilage of Sdc4−/− mice that was absent in adult tissue. Stimulation of chondrocytes with Wnt-3a in vitro led to increased expression of syndecan 2, while stimulation with TNFα resulted in up-regulation of syndecan 4 but decreased expression of syndecan 2. TNFα stimulation reduced syndecan 2 expression and increased syndecan 4 expression even in the presence of Wnt-3a, suggesting that inflammation has a strong effect on the regulation of syndecan expression.

Conclusion

Our results demonstrate that syndecan 4 is functionally involved in endochondral ossification and that its loss impairs fracture healing, due to inhibition of compensatory mechanisms under inflammatory conditions.

Syndecans are a family of type I transmembrane heparan sulfate proteoglycans, with 4 members identified in vertebrates. Each syndecan family member has a tissue-specific and developmentally regulated expression pattern. While syndecan 1 is mainly expressed in epithelial cells, syndecan 2 is detectable in mesenchymal cells. Syndecan 3 is expressed during bone development and in the nervous system, whereas syndecan 4 is ubiquitously expressed (1). Of the 4 mammalian syndecan family members, syndecans 1 and 3, and syndecans 2 and 4, are structurally similar and can be considered to form subfamilies, based on sequence comparison. However, even the closely related syndecans have distinct functions, due to core protein–specific regulation mechanisms or distinct tissue expression patterns (2).

Although syndecans of all families have been detected in chondrocytes or their progenitor cells, the role of syndecans during bone development is only partially understood. Expression of syndecans 1, 2, and 4 has been observed in rat chondrocytes and progenitor cells during mandibular condyle development (3). Syndecan 3 has been implicated in regulating the size of skeletogenic condensations (4, 5) and growth factor–mediated proliferation of chondrocytes during limb development and growth (6–8). In addition, syndecans 2 and 4 are involved in osteoblast cell adhesion and survival (9).

To determine the functional role of syndecan 4 in bone development and repair, Sdc4-knockout mice generated via a lacZ-knockin strategy (10) were used. Sdc4−/− mice are viable and have no obvious postnatal abnormalities compared to their wild-type (WT) littermates. This suggests either that syndecan 4 is dispensable in normal development and growth or that other heparan sulfate proteoglycans compensate for important syndecan 4 functions. However, under various stress conditions, syndecan 4 function has been found to be indispensable; Sdc4−/− mice exhibit delayed wound closure (10) and protection against cartilage degradation in osteoarthritis-like disease (11). The latter is of particular interest, because several lines of evidence suggest that osteoarthritic cartilage remodeling has important similarities to early phases of bone formation during endochondral ossification (12).

Because of this role of syndecan 4 in the regulation of cartilage breakdown, we investigated in more detail its function during cartilage remodeling in endochondral ossification during embryogenesis and in adult fracture healing, in which important aspects of embryonic bone development are recapitulated (13, 14). However, fracture healing differs from embryonic bone development in that inflammatory cells infiltrate into the injured site, releasing proinflammatory cytokines such as interleukin-1 and tumor necrosis factor α (TNFα) to stimulate the repair process (15, 16).

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

Syndecan 4–knockout mice.

Sdc4-knockout mice were generated using a lacZ knockin strategy as described previously (10). In these mice, exons 2–4 of the Sdc4 gene are replaced by a cassette containing the lacZ gene, leading to expression of β-galactosidase under the control of the syndecan 4 promoter. WT and Sdc4−/− mice used in these studies were littermates of both sexes, derived from breeding of Sdc4+/− mice. X-gal staining to monitor syndecan 4 promoter activity in whole-mount embryos at various stages of development was performed as previously described (17). Deskinned embryos at different embryologic stages (embryonic day 12.5 [E12.5], 14.5, 17.5) were fixed in glutaraldehyde and stained with X-gal. For histologic analysis, X-gal–stained bone samples were fixed, decalcified, and embedded in paraffin. Sections (6 μm) were counterstained with Safranin–orange and examined using an inverted microscope (Olympus).

Preparation of tibia sections and histologic staining.

Hind legs from animals at E16.5 were dissected and fixed in freshly prepared 4% paraformaldehyde in phosphate buffered saline (PBS) for 24 hours at 4°C. The bones were decalcified in 20% EDTA, pH 7.3 (Sigma) and, after dehydration through a graded series of ethanol solutions, were embedded in paraffin. Sections (4 μm) were cut through the long axis of each tibia in a sagittal plane and were stained with Weigert's hematoxylin–Alcian blue–sirius red (Sigma).

Immunohistologic assessment.

To evaluate the expression and localization of type X collagen, proliferating cell nuclear antigen (PCNA), ADAMTS-4, and the aggrecan neoepitope 374ARGSV and the proliferation rate of chondrocytes, the following antibodies were used: mouse anti–type X collagen (20315501005; Quartett), mouse anti-PCNA (M0879; Dako), anti–ADAMTS-4 (SP47035; Acris), and anti-374ARGSV (ab3773; Abcam). For type X collagen and aggrecan neoepitope staining, deparaffinized and rehydrated sections were preincubated with protease XXIV (0.05%; Sigma) in PBS for 10 minutes at 37°C and with testicular hyaluronidase (0.1%; Sigma) in acetate buffer, pH 6.0, for 90 minutes at 37°C. For ADAMTS-4 staining, deparaffinized sections were pretreated with trypsin (0.055; Invitrogen) in PBS for 10 minutes at 37°C. For PCNA staining, deparaffinized and rehydrated sections were subjected to antigen retrieval by microwave irradiation for 3 minutes at 350W in citrate buffer. After pretreatment, the sections were incubated with 0.3% H2O2 for 10 minutes at room temperature to block endogenous peroxidase activity. In order to biotinylate the primary antibodies, they were diluted at 1:25 (type X collagen), 1:250 (PCNA), 1:100 (374ARGSV), or 1:500 (ADAMTS-4) and incubated, directly on the sections, with the biotinylation reagent ARK (K3954, Dako). After incubation with this primary antibody mixture for 15 minutes at room temperature, sections were rinsed 3 times with PBS and incubated with streptavidin–horseradish peroxidase, rinsed again, and then treated with chromogenic substrate solution (both included in ARK). A DAB Vectastain ABC Elite Kit (Vector) was used to detect 374ARGSV aggrecan neoepitope and ADAMTS-4.

Sections from 5 WT and 5 Sdc4−/− mice were obtained for these assessments. Type X collagen, aggrecan neoepitope, and ADAMTS-4 staining was quantified, based on color intensity in 5 high-power fields per mouse, using Image-Pro Plus (Media Cybernetics) and is presented as the percentage of total cartilage area exhibiting brown staining. To determine the number of proliferating chondrocytes in the resting and proliferation zones, images from PCNA-stained sections were evaluated (3 images per area; n = 5 mice per group). Cell proliferation was quantified by counting PCNA-positive cells and the total number of nuclei stained with DAPI in the entire area. Sections incubated without primary antibody were examined as a negative control. No sections showed any staining in these control experiments (results not shown).

Syndecan 2 immunofluorescence.

For antigen retrieval, the sections were first equilibrated in 0.02% HCl for 7 minutes, digested in 3 mg/ml pepsin (Sigma) in 0.02% HCl for 45 minutes at 37°C, washed in water, and allowed to air dry for 20 minutes. Sections were then washed twice in 0.2% Tris buffered saline–Tween 20 (TBST), blocked in 0.5% bovine serum albumin in TBST for 1 hour at room temperature, blotted, and incubated overnight with syndecan 2 primary antibody (sc-15348; Santa Cruz Biotechnology) diluted 1:100. Subsequently, sections were washed twice in TBST and incubated for 1 hour with secondary antibody (Alexa Fluor 488–conjugated anti-rabbit IgG) diluted 1:200, for indirect immunofluorescence. Slides were mounted in Mowiol (EMD Biosciences), and images were acquired with a fluorescence microscope (BX61; Olympus) using an Uplan-Fluor 40× NA 0.85 objective lens. Images were acquired at room temperature, using an F-View II camera (SIS) and Cell P software.

MTT assay.

Chondrocytes from WT and Sdc−/− mice (12,500 from each group of mice) were seeded in triplicate in a 24-well microtiter plate and grown overnight. After 24 hours the viability/proliferation of the chondrocytes was determined by incubation for 3 hours at 37°C with MTT test reagent, which is based on the capacity of mitochondrial dehydrogenase enzymes in living cells to convert the yellow substrate MTT into a dark-blue formazan product. Extraction was performed using an extraction solution (90% isopropanol, 10% DMSO) for 15 minutes at 30°C. Results were read at 540 nm using a microplate enzyme-linked immunosorbent assay reader.

Alcian blue–alizarin red staining of developing skeleton.

Mouse embryos at E12.5, E14.5, E16.5, and E18.5 were eviscerated, fixed in ethanol and acetone, and stained for 5 days at 37°C with alizarin red S and Alcian blue 8GS (both from Sigma). KOH-cleared skeletons were placed in glycerol for long-term storage. Anatomic details were examined using a stereomicroscope (Stemi 2000C; Zeiss). For statistical analysis, alizarin red–stained areas and Alcian blue–stained areas were measured using Cell Explorer software (BioSciTec).

Bone fracture experiments.

All experimental procedures were performed with the permission of local government animal rights protection authorities (G67/2006 and 84-02.04.2012.A066) in accordance with National Institute of Health guidelines for the use of laboratory animals. Twelve-week-old female syndecan 4–deficient and WT mice were subjected to closed, standardized femur shaft fracture (18). After anesthesia by intraperitoneal injection of a mixture of ketamine hydrochloride (80 mg/kg) and xylazine (12 mg/kg), the left leg was fractured with a fracture machine (3-point bending) and stabilized with an intramedullar nail (hollow needle 23G; modified as described by Schmidmaier et al [19]). Carprofen (4 mg/kg) was administered intramuscularly as an analgesic immediately after the procedure and then at 24-hour intervals as needed. In order to block the effects of TNFα during fracture repair, Sdc4−/− and WT mice were injected intraperitoneally with certulizumab (10 mg/kg) immediately after fracture and every 3 days during healing. On day 7, 14, or 28 after fracture, the mice were killed by cervical dislocation. Fractured femurs (n = 6 or more per time point) were carefully removed without destroying the callus and used for histologic and immunohistochemical analysis.

Histologic staining of fractured bones.

For histomorphologic analysis, tissue samples were fixed in 4% paraformaldehyde for 12 hours at 4°C. The bones were decalcified in 20% EDTA with 0.2% paraformaldehyde and embedded in paraffin, or decalcified in methylmethacrylate (Technovit 9100; Heraeus). Sections (5 μm) were cut through the long axis of each femur in a sagittal plane, and standard histologic staining was performed with a Masson-Goldner kit (Merck) and Alcian blue. To generate a histomorphologic comparison of fracture healing between WT and syndecan-4–knockout mice, the total area of fracture callus and cartilaginous volume of the calluses were measured using an Olympus BX51 Microscope and an image analysis system (Image-Pro Plus 5.0). Parameters were measured at 4× magnification. The dimensions of whole fracture callus and the cartilaginous fraction in callus were compared between mouse genotypes at various time points.

Quantitative analysis of messenger RNA (mRNA) expression.

Total RNA was extracted from the cartilage of WT and Sdc4−/− mouse cartilage using TRIzol reagent according to the instructions of the manufacturer (Invitrogen). Total RNA (500 ng) from each sample was reverse transcribed using a ThermoScript Reverse Transcription Kit (Invitrogen) with oligo(dT) primer. Quantitative polymerase chain reaction was performed with hot-start DNA polymerase (Qiagen) in the presence of 0.1× SYBR green (Sigma) and 0.2× ROX dye (Invitrogen) using, respectively, a T7900 HD or a 96 well GeneAmp PCR system 9700 apparatus (both from Applied Biosystems). Primer sequences are shown in Table 1.

Table 1. Primer sequences used in the study
PrimerForward, 5′–3′Reverse, 5′–3′
Syndecan 2TTCAGGAGTATATCCTATTGATGATGAACTCTCTATGTCTTCATCAGCTCCT
Syndecan 4CCCTTCCCTGAAGTGATTGAAGTTCCTTGGGCTCTGAGG
β-actinCACGGCTGCTTCCAGCTCCACAGGACTCCATGCCCAG

Chondrocyte isolation for in vitro cytokine stimulation.

Chondrocytes were isolated and cultured as described previously (20). For stimulation, monolayer chondrocytes from WT and Sdc4−/− mice in P0 were incubated for 24 hours with (1–100 ng/ml), Wnt-3a (1–100 ng/ml) (both from R&D Systems), or a combination of the 2 cytokines.

Statistical analysis.

Results are presented as the mean ± SEM or mean ± SD. Statistical comparisons were performed using the Mann-Whitney U-test or Student's t-test. All data were analyzed with GraphPad Prism 5. P values less than 0.05 were considered significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

The expression of syndecan 4 during embryogenesis was examined by β-galactosidase staining of Sdc4−/− lacZ-knockin mouse embryos. We observed expression of syndecan 4 throughout the entire course of skeletal development (Figure 1a). In Sdc4−/− mice, strong activity of the syndecan 4 promoter in condensating cells of developing bones was seen starting at E12.5. Developing appendicular and axial bones, i.e., the cartilaginous portions of long bones and ribs, were also positive at later stages. At E17.5, syndecan 4 promoter activity was most prominent in the growth plates of long bones and ribs (Figure 1a). These findings demonstrate that Sdc4 promoter activity is present in all cartilaginous tissues that are involved in endochondral bone formation. At the cellular level, syndecan 4 promoter activity was seen throughout the cartilage of the epiphysis and in resting, proliferating, prehypertrophic, and hypertrophic chondrocytes within the epiphyses (Figure 1b).

thumbnail image

Figure 1. Expression of syndecan 4 in growth plate chondrocytes during bone development. a, Syndecan 4 promoter–dependent β-galactosidase activity is detected in the axial and appendicular skeleton of syndecan 4–deficient, but not wild-type (WT), embryonic mice. Syndecan 4 expression is localized to mesenchymal condensations in the limbs on embryonic day 12.5 (E12.5) and has spread to the growth plates at E14.5, with β-galactosidase staining also detectable in rib growth plates at E17.5. b, At the cellular level, syndecan 4 promoter activity is detected in resting, proliferating, and hypertrophic chondrocytes in tibial growth plates. Original magnification × 200.

Download figure to PowerPoint

To investigate a possible function of syndecan 4 during endochondral ossification, sections of paraffin-embedded tibiae from Sdc4−/− mice and WT littermates were compared at E16.5 by Alcian blue–sirius red and type X collagen staining (Figure 2a). No obvious differences in the overall morphology of Sdc4−/− and WT mouse tissue were observed at this time point of embryonic development. However, at E16.5, substantially reduced staining for ADAMTS-4 protein was detected throughout the tibial cartilage of Sdc4−/− mice in comparison with that of WT mice. Notably, in the early phases of chondrocyte differentiation, almost no ADAMTS-4 staining was found within the cartilage of the epiphysis or resting zones of Sdc4−/− mouse tibiae, with a higher percentage of stained area in WT mouse samples (mean ± SEM 14.9 ± 3.1% versus 1.6 ± 0.2%; P < 0.01) (Figure 2b). The reduction of ADAMTS-4 expression was associated with reduced aggrecanase activity as assessed by staining for the 374ARGSV neoepitope sequence of aggrecanase-cleaved aggrecan (6.4 ± 0.9% of the area stained in WT mice versus 3.4 ± 1.1% in Sdc4−/− mice); however, this reduction was not significant.

thumbnail image

Figure 2. Loss of Sdc4 is associated with inhibition of chondrocyte proliferation and reduced aggrecanase activity in uncalcified cartilage of the epiphysis. a, Histochemical/immunohistochemical analysis of cartilage at E16.5. Alcian blue–sirius red staining and immunohistochemical localization of type X collagen reveal no differences between WT and Sdc4−/− mice. However, substantially reduced staining for ADAMTS-4 protein, linked to slightly reduced aggrecanase activity as analyzed by immunohistochemical detection of the 374ARGSV neoepitope sequence of aggrecanase-cleaved aggrecan, is detected throughout the cartilage of the epiphysis in Sdc4−/− mouse tibia compared to WT mouse cartilage. Proliferation of chondrocytes, examined by immunohistochemical staining of proliferating cell nuclear antigen (PCNA), also is reduced in Sdc4−/− mice. Original magnification × 100. b, Quantification of the immunohistochemical results shown in a. c, Results of MTT assay of cultured WT and Sdc4−/− mouse chondrocytes, revealing inhibition of chondrocyte proliferation in Sdc4−/− mouse chondrocytes in vitro. d, Morphometric analysis of alizarin red–Alcian blue–stained bones from WT and Sdc4−/− mice at E16.5. Measurement of calcified area as a percentage of total body area revealed no significant differences between WT and Sdc4−/− mice. Values in b–d are the mean ± SEM (n = 5 or more per group, 12 per group, and 3 per group in b, c, and d, respectively). ∗∗ = P < 0.01; ∗∗∗ = P < 0.005 versus WT mice. See Figure 1 for other definitions.

Download figure to PowerPoint

Interestingly, the proliferation of chondrocytes in E16.5 tibiae, examined by immunohistochemical staining of PCNA, was also diminished in Sdc4−/− mice. Compared with WT littermates, in which a mean ± SEM of 66.7 ± 2.7% of the chondrocytes were found to be in a proliferative stage, only 40.0 ± 1.1% of the cells from Sdc4−/−mice showed PCNA staining (Figure 2b), suggesting a role of syndecan 4 in cell cycle regulation in chondrocytes. Consistent with these in vivo observations, Sdc4−/− mouse chondrocytes in culture also proliferated less than WT cells (Figure 2c).

In order to analyze whether the alterations described above translate into skeletal changes, whole-mount alizarin red–Alcian blue–stained skeletal preparations from Sdc4−/− mice were compared with those from WT littermates at different embryologic stages (E12.5, E14.5, E16.5, and E18.5). Morphometric measurements of the calcified tissue area in relation to the whole body area revealed no significant changes in Sdc4−/− mouse embryos compared with WT littermates at E16.5 (Figure 2d) or at any other time point investigated (data not shown). This was consistent with the already reported absence of any prominent differences in size compared to WT littermates at birth (10).

In adult bones, many aspects of skeletal development and endochondral bone formation are recapitulated during fracture healing with the notable difference of inflammation, which is present in fracture repair but not in embryonic bone formation. Although syndecan 4 deficiency did not significantly alter fetal endochondral bone formation, syndecan 4 may still be important for fracture repair since inflammation is a prominent feature of fracture healing during the early stages, but not of endochondral ossification during development (13). To discriminate between inflammation-driven effects and endochondral bone formation during fracture healing, we analyzed callus formation with and without treatment with anti-TNFα (certulizumab).

Indeed, on day 14 of fracture healing, calluses in untreated Sdc4−/− mice displayed a reduced amount of trabecular bone as assessed by Masson's-Goldner's trichrome staining (Figure 3a). In addition, histologic and immunohistologic analyses of fractured femurs revealed a notable increase in callus formation in untreated Sdc4−/− mice compared with WT mice. On day 14 postfracture, calluses in untreated Sdc4−/− mice displayed a larger total cartilage area (mean ± SD 15.7 ± 2.6 mm2, versus 9.17 ± 2.5 mm2 in WT mice; P < 0.01) and a larger fraction of hypertrophic cartilage area as revealed by Alcian blue staining and type X collagen immunostaining (27% versus 10%, respectively; P < 0.01) (Figures 3b and c). At the same time point, calluses were ∼42% smaller in the bones of WT mice compared with Sdc4−/− mice. The differences between groups in terms of cartilage area within the calluses were abolished between day 14 and day 28 (data not shown). In all samples from anti–TNFα-treated animals except those obtained from WT mice on day 14, however, the total callus area was drastically reduced (9.2 ± 4.3 mm2 in Sdc4−/− mice and 6.9 ± 3.1 mm2 in WT mice on day 14) and the differences between Sdc4−/− and WT mice were abolished, indicating the importance of syndecan 4 under inflammatory conditions. (Callus area in WT mice on day 14 was already small without anti-TNFα treatment, and therefore was not reduced further.)

thumbnail image

Figure 3. Increased callus formation in the femora of Sdc4−/− mice compared to wild-type (WT) mice. a, Masson's-Goldner's, Alcian blue, and type X collagen staining, revealing increased callus formation in the femora of Sdc4−/− mice compared to WT mice on day 14 of fracture healing in the absence of (w/o) anti–tumor necrosis factor α (a-TNFα) treatment (certulizumab). Bars = 200 μm. b and c, Histomorphometric measurements (total callus area [b] and cartilage area/total callus area [c]) in fractured bones on days 7 and 14 of fracture healing in the absence and presence of anti-TNFα treatment. d, Proliferating cell nuclear antigen (PCNA) staining of sections through the fracture callus, revealing delayed onset of fracture healing with augmented proliferation in the femora of untreated Sdc4−/− mice on day 14, leading to increased callus formation at this time point. With anti-TNFα treatment, the percentage of proliferating cells in Sdc4−/− animals on day 14 is reduced and resembles the level in WT mice. Bars = 100 μm. e, Quantification of the PCNA staining shown in d. Values in b, c, and e are the mean ± SD (n = 7 or more per group, 7 or more per group, and 6 or more per group at each time point in b, c, and e, respectively). ∗ = P < 0.05; ∗∗ = P < 0.01; ∗∗∗ = P < 0.005.

Download figure to PowerPoint

Investigation of cell proliferation based on PCNA staining (Figures 3d and e) revealed that on day 7 there were fewer proliferating cells in the calluses of untreated Sdc4−/− mice compared with untreated WT mice (mean ± SD 12.6 ± 3.8% and 18.8 ± 8.9%, respectively). However, on day 14 the percentage of PCNA-positive cells was increased (12.0 ± 7.4% in WT mice and 24.1 ± 7.8% in Sdc4−/− mice), correlating with the increased callus size on day 14. In accordance with the reduced callus size in anti-TNFα–treated animals, proliferation was also reduced on day 14 with antiinflammatory treatment, and the differences between WT and Sdc4−/− animals were abolished (5.3 ± 2.9% in WT mice and 7.1 ± 5.2% in Sdc4−/− mice). After 4 weeks, all fractures were fully healed and there were no differences between genotypes in bone stability (maximum torque, angle of failure, and stiffness) (data not shown).

One striking aspect of these findings was that, in spite of the similarity of endochondral bone formation in development and in fracture repair, the absence of syndecan 4 resulted in a phenotype only in fracture repair. We conclude that the differences in syndecan 4 function in embryonic and adult bones probably relate to different compensatory mechanisms in embryonic cartilage and adult tissue, or under physiologic and inflammatory conditions. Given the similarities between syndecans 2 and 4, we investigated whether the loss of syndecan 4 in endochondral bone formation is compensated for by enhanced expression of syndecan 2. Interestingly, syndecan 4 deletion resulted in a 7.5-fold up-regulation of syndecan 2 mRNA and a 3-fold up-regulation of protein expression in the developing skeletal elements at E16.5, as evaluated by reverse transcription–polymerase chain reaction and quantification of immunofluorescence staining, respectively (Figures 4a–c). In contrast to the findings observed during embryonic bone development, we did not demonstrate a comparable up-regulation of syndecan 2 in the adult fracture callus cartilage with or without anti TNFα treatment, suggesting a loss of this compensatory mechanism in Sdc4−/− mouse cartilage, related either to age or to the activity of cytokines involved in inflammation (Figures 4d and e).

thumbnail image

Figure 4. Compensatory up-regulation of syndecan 2 in Sdc4−/− mice during bone development is absent in adult bones during fracture repair. a, Quantitative reverse transcription–polymerase chain reaction analysis, demonstrating up-regulation of Sdc-2 mRNA expression (shown as the fold increase over expression in WT mice) in Sdc4−/− mice during bone development. b, Immunohistochemical staining, confirming increased levels of syndecan 2 protein in Sdc4−/− mice during bone development. Original magnification × 200. c, Quantification of the immunohistochemical results shown in b. d, Immunohistochemical staining, demonstrating slightly enhanced syndecan 2 expression during fracture repair in mice treated with anti-TNFα. Original magnification × 200. e, Quantification of the immunohistochemical results shown in d. Values in a, c, and e are the mean ± SEM (n = 3 per group, 3 per group, and 5 or more per group in a, c, and e, respectively). ∗∗ = P < 0.01 versus WT mice. See Figure 3 for definitions.

Download figure to PowerPoint

Syndecan 2 expression during development is most likely induced by Wnt-3a, a growth factor that is involved in the transition of mesenchymal cells into chondroprogenitor cells (21). We demonstrated that stimulation of WT mouse chondrocytes with 100 ng/ml Wnt-3a in vitro led to increased syndecan 2 mRNA levels (3-fold up-regulation). In contrast, TNFα stimulation reduced syndecan 2 mRNA levels by up to 50%, in a dose-dependent manner (Figure 5a).

thumbnail image

Figure 5. The effect of TNFα overrides the effect of Wnt-3a on the regulation of Sdc2 mRNA expression in vitro. a, Regulation of Sdc2 mRNA expression in WT mouse chondrocytes. Quantitative reverse transcription–polymerase chain reaction (RT-PCR) analysis reveals up-regulation of Sdc2 mRNA expression upon stimulation with Wnt-3a (100 ng/ml) and dose-dependent down-regulation of Sdc2 mRNA expression upon stimulation with TNFα (left). In the presence of 100 ng/ml Wnt-3a, TNFα still down-regulates Sdc2 mRNA expression in WT mouse chondrocytes (right). b, Regulation of Sdc4 mRNA expression in WT mouse chondrocytes. Quantitative RT-PCR analysis reveals no effects of stimulation with Wnt-3a (1–100 ng/ml) on Sdc4 mRNA expression, and dose-dependent up-regulation of Sdc4 mRNA expression upon stimulation with TNFα (1–100 ng/ml) (left). In the presence of 100 ng/ml Wnt-3a, TNFα still up-regulates Sdc4 mRNA expression in WT mouse chondrocytes (right). The levels of Sdc2 and Sdc4 expression with no treatment were set at 1. Values are the mean ± SEM (n = 6 per group). ∗ = P < 0.05; ∗∗ = P < 0.01; ∗∗∗ = P < 0.005 versus no treatment. See Figure 3 for other definitions.

Download figure to PowerPoint

To confirm that the loss of syndecan 2 mRNA expression in cartilage in adult bones during fracture repair is dependent on the action of inflammatory cytokines and cannot be counterbalanced by Wnt-3a, WT mouse chondrocytes were stimulated concomitantly in vitro with the proinflammatory cytokine TNFα and 100 ng/ml Wnt-3a (Figure 5a). The expression of syndecan 2 was decreased with TNFα stimulation even in the presence of Wnt-3a, suggesting a strong effect of inflammation on the regulation of syndecan 2 mRNA expression.

In contrast, expression of syndecan 4 mRNA was not influenced by Wnt-3a, but was dose dependently up-regulated by TNFα. Treatment with a combination of TNFα and Wnt-3a revealed a superior effect of TNFα over Wnt-3a on syndecan 4 expression (Figure 5b).

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

In this study we analyzed the expression and function of syndecan 4 during normal skeletal maturation and during bone fracture repair; a process that resembles, at least in part, the process of endochondral ossification in adult bones. Skeletal healing, however, in contrast to skeletal development, involves an inflammatory initiation phase.

We have shown that syndecan 4 promoter activity is specifically induced in chondrocytes at all phases of differentiation during embryonic endochondral ossification mice. However, its deletion is associated with only minor changes in bone development, including reduced proliferation and slight changes in aggrecanase-mediated matrix remodeling. A functional link between syndecan 4 and aggrecanase activity has been previously demonstrated in osteoarthritic cartilage (11) and intervertebral disc cartilage (22). In osteoarthritic cartilage, ADAMTS-5 was shown to bind to the heparan sulfate chains of syndecan 4 at the chondrocyte cell surface, where the activity of the aggrecanase is regulated (11). However, both the alteration in the cell cycle of chondrocytes and the differences in ADAMTS-4 expression and activity have no striking influence on overall skeletal development. Mineralization of the skeleton in Sdc4−/− animals is almost normal, and the animals did not differ in size compared with their WT littermates.

A minor effect of aggrecanases in endochondral bone development was demonstrated previously in mice with a targeted mutation in exon 7 of the aggrecan gene, ablating cleavage in the interglobular domain. These mice exhibited no differences in growth plate architecture at any age, suggesting that aggrecanase cleavage of the interglobular domain is not required for aggrecan resorption during endochondral ossification or skeletal growth (23). In addition, ADAMTS-4–, ADAMTS-5–, and ADAMTS-4/5–knockout mice exhibit no obvious distinct skeletal phenotype (24–26). This provides further evidence that none of these enzymes are vitally required for aggrecan turnover during skeletal development.

Findings of several studies support the notion that syndecans play a role in regulating the proliferation of different cells and cell lines. These effects are most likely mediated by the binding of growth factors or the presentation of these factors via the heparan sulfate chains of syndecans; the core proteins, however, seem to play a minor role. It has been shown that, in Swiss 3T3 cells, fibroblast growth factor 2 (FGF-2)–dependent proliferation is mediated by syndecan 2 (27). In growth plate chondrocytes, however, syndecan 3 was described to regulate proliferation by interaction with FGF-2 or with Indian hedgehog (6, 8, 28). Similarly, syndecan 4 regulates proliferation by growth factor–mediated or adhesion-mediated mechanisms in different cell types (29–32).

The absence of fundamental effects on endochondral bone development in Sdc4−/− animals is most likely due to the action of compensatory mechanisms in embryonic cartilage. In this study we have demonstrated that during bone development, the loss of syndecan 4 is compensated for by a marked up-regulation of syndecan 2, the member of the syndecan family that is most closely related to syndecan 4. In chondrocytes of developing limbs, syndecans 2 and 4 seem to have redundant functions. It is known that some functions, such as the regulation of cytoskeleton organization or growth factor binding and signaling, are shared by the two syndecans. However, each syndecan also has distinct functions due to the presence of different core proteins, possibly translating into differences in oligomerization status and distinct signal transduction mechanisms (2).

We have shown that under pathologic conditions, such as those in adult bones during fracture repair, the loss of syndecan 4 cannot be fully compensated. The fracture repair process is delayed and a larger callus is observed in Sdc4−/− mice compared to WT mice. This difference between fetal and adult bones is related to a lack of compensation by syndecan 2 in adult bones. Interestingly, syndecan 2 mRNA expression was not up-regulated, likely due to the inhibitory effect on syndecan 2 expression exerted by proinflammatory cytokines that play a role during the initial phases of fracture repair. In the presence of antiinflammatory treatment (anti-TNFα antibody), calluses remain small and the difference between WT and Sdc4−/− mice is no longer obvious. Also, the changes in proliferation during fracture healing in syndecan 4–deficient animals were abolished with anti-TNFα treatment. These results corroborate our hypothesis that syndecan 4 exerts its major role under inflammatory conditions. Moreover, our in vitro data indicate that the up-regulation of syndecan 2 by Wnt-3a is more pronounced during embryonic bone development than during fracture healing, because the effect of Wnt-3a on syndecan 2 expression is not as strong as that of TNFα. The same is true for syndecan 4, which is up-regulated by TNFα but not influenced by Wnt-3a.

Our results imply that the general functions of syndecan 4 under physiologic conditions, e.g., during development, are redundant with those of syndecan 2. In contrast, under stress conditions in adult tissue, the functions of syndecan 4 are unique. Essential functions of syndecan 4 under pathologic conditions have been described previously in osteoarthritis (11), wound healing (10), kidney disease (33, 34), lipopolysaccharide-induced sepsis (35), muscle cell damage (36, 37), and myocardial infarction (38–40). All of those studies suggest that syndecan 4 is indispensable under pathologic conditions, possibly to avert further damage, to induce the healing process, or to restore homeostasis. In kidney disease the loss of syndecan 4 was also compensated for by enhanced expression of syndecan 2, leading to augmented expression and activity of transforming growth factor β (TGFβ) (33). Up-regulation and enhanced activity of TGFβ may also play a role in embryonic bone development in Sdc4−/− animals. During endochondral ossification, TGFβ reduces hypertrophic chondrocyte differentiation in synergy with FGF-2 while TGFβ alone inhibits proliferation, as has been observed in chondrocytes in vitro and in vivo (41, 42).

In accordance with previously reported findings in other cells (22), we have shown that syndecan 4 expression is induced by proinflammatory cytokines such as TNFα. Proinflammatory cytokines have been described to determine the speed of fracture healing; the administration of interleukin-1 during early phases of fracture repair slightly accelerated bone repair (15), and the loss of TNFα receptor delayed chondrocyte differentiation and bone resorption during fracture healing (16). Given our findings of an up-regulation of syndecan 4 in the presence of TNFα and a delay in fracture healing in Sdc4−/− animals, we conclude that delay in fracture repair in the absence of proinflammatory signals could be provoked by a loss of syndecan 4 function.

AUTHOR CONTRIBUTIONS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. Dreier had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study conception and design. Bertrand, Stange, Bruckner, Pap, Dreier.

Acquisition of data. Bertrand, Stange, Hidding, Echtermeyer, Nalesso, Godmann, Timmen, Dreier.

Analysis and interpretation of data. Bertrand, Stange, Hidding, Echtermeyer, Nalesso, Timmen, Bruckner, Dell'Accio, Raschke, Pap, Dreier.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES

The excellent technical assistance of Marianne Ahler, Anne Forsberg, Ulrike Breite, Simone Niehues, Iska Leifert, and Vera Eckervogt is gratefully acknowledged.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgements
  8. REFERENCES
  • 1
    Kim CW, Goldberger OA, Gallo RL, Bernfield M. Members of the syndecan family of heparan sulfate proteoglycans are expressed in distinct cell-, tissue-, and development-specific patterns. Mol Biol Cell 1994; 5: 797805.
  • 2
    Oh ES, Couchman JR. Syndecans-2 and -4; close cousins, but not identical twins. Mol Cells 2004; 17: 1817.
  • 3
    Molteni A, Modrowski D, Hott M, Marie PJ. Differential expression of fibroblast growth factor receptor-1, -2, and -3 and syndecan-1, -2, and -4 in neonatal rat mandibular condyle and calvaria during osteogenic differentiation in vitro. Bone 1999; 24: 33747.
  • 4
    Hall BK, Miyake T. All for one and one for all: condensations and the initiation of skeletal development. Bioessays 2000; 22: 13847.
  • 5
    Koyama E, Leatherman JL, Shimazu A, Nah HD, Pacifici M. Syndecan-3, tenascin-C, and the development of cartilaginous skeletal elements and joints in chick limbs. Dev Dyn 1995; 203: 15262.
  • 6
    Shimo T, Gentili C, Iwamoto M, Wu C, Koyama E, Pacifici M. Indian hedgehog and syndecans-3 coregulate chondrocyte proliferation and function during chick limb skeletogenesis. Dev Dyn 2004; 229: 60717.
  • 7
    Shimazu A, Nah HD, Kirsch T, Koyama E, Leatherman JL, Golden EB, et al. Syndecan-3 and the control of chondrocyte proliferation during endochondral ossification. Exp Cell Res 1996; 229: 12636.
  • 8
    Pacifici M, Shimo T, Gentili C, Kirsch T, Freeman TA, Enomoto-Iwamoto M, et al. Syndecan-3: a cell-surface heparan sulfate proteoglycan important for chondrocyte proliferation and function during limb skeletogenesis. J Bone Miner Metab 2005; 23: 1919.
  • 9
    Wang Z, Telci D, Griffin M. Importance of syndecan-4 and syndecan -2 in osteoblast cell adhesion and survival mediated by a tissue transglutaminase-fibronectin complex. Exp Cell Res 2011; 317: 36781.
  • 10
    Echtermeyer F, Streit M, Wilcox-Adelman S, Saoncella S, Denhez F, Detmar M, et al. Delayed wound repair and impaired angiogenesis in mice lacking syndecan-4. J Clin Invest 2001; 107: R914.
  • 11
    Echtermeyer F, Bertrand J, Dreier R, Meinecke I, Neugebauer K, Fuerst M, et al. Syndecan-4 regulates ADAMTS-5 activation and cartilage breakdown in osteoarthritis. Nat Med 2009; 15: 10726.
  • 12
    Saito T, Fukai A, Mabuchi A, Ikeda T, Yano F, Ohba S, et al. Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nat Med 2010; 16: 67886.
  • 13
    Ferguson C, Alpern E, Miclau T, Helms JA. Does adult fracture repair recapitulate embryonic skeletal formation? Mech Dev 1999; 87: 5766.
  • 14
    Vortkamp A, Pathi S, Peretti GM, Caruso EM, Zaleske DJ, Tabin CJ. Recapitulation of signals regulating embryonic bone formation during postnatal growth and in fracture repair. Mech Dev 1998; 71: 6576.
  • 15
    Lange J, Sapozhnikova A, Lu C, Hu D, Li X, Miclau T III, et al. Action of IL-1β during fracture healing. J Orthop Res 2010; 28: 77884.
  • 16
    Gerstenfeld LC, Cho TJ, Kon T, Aizawa T, Tsay A, Fitch J, et al. Impaired fracture healing in the absence of TNF-α signaling: the role of TNF-α in endochondral cartilage resorption. J Bone Miner Res 2003; 18: 158492.
  • 17
    Kim JE, Nakashima K, de Crombrugghe B. Transgenic mice expressing a ligand-inducible cre recombinase in osteoblasts and odontoblasts: a new tool to examine physiology and disease of postnatal bone and tooth. Am J Pathol 2004; 165: 187582.
  • 18
    Holstein JH, Menger MD, Culemann U, Meier C, Pohlemann T. Development of a locking femur nail for mice. J Biomech 2007; 40: 2159.
  • 19
    Schmidmaier G, Wildemann B, Bail H, Lucke M, Fuchs T, Stemberger A, et al. Local application of growth factors (insulin-like growth factor-1 and transforming growth factor-β1) from a biodegradable poly(D,L-lactide) coating of osteosynthetic implants accelerates fracture healing in rats. Bone 2001; 28: 34150.
  • 20
    Gosset M, Berenbaum F, Thirion S, Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc 2008; 3: 125360.
  • 21
    Goldring MB, Tsuchimochi K, Ijiri K. The control of chondrogenesis. J Cell Biochem 2006; 97: 3344.
  • 22
    Wang J, Markova D, Anderson DG, Zheng Z, Shapiro IM, Risbud MV. TNF-α and IL-1β promote a disintegrin-like and metalloprotease with thrombospondin type I motif-5-mediated aggrecan degradation through syndecan-4 in intervertebral disc. J Biol Chem 2011; 286: 3973849.
  • 23
    Little CB, Meeker CT, Golub SB, Lawlor KE, Farmer PJ, Smith SM, et al. Blocking aggrecanase cleavage in the aggrecan interglobular domain abrogates cartilage erosion and promotes cartilage repair. J Clin Invest 2007; 117: 162736.
  • 24
    Majumdar MK, Askew R, Schelling S, Stedman N, Blanchet T, Hopkins B, et al. Double-knockout of ADAMTS-4 and ADAMTS-5 in mice results in physiologically normal animals and prevents the progression of osteoarthritis. Arthritis Rheum 2007; 56: 36704.
  • 25
    Glasson SS, Askew R, Sheppard B, Carito BA, Blanchet T, Ma HL, et al. Characterization of and osteoarthritis susceptibility in ADAMTS-4–knockout mice. Arthritis Rheum 2004; 50: 254758.
  • 26
    Rogerson FM, Stanton H, East CJ, Golub SB, Tutolo L, Farmer PJ, et al. Evidence of a novel aggrecan-degrading activity in cartilage: studies of mice deficient in both ADAMTS-4 and ADAMTS-5. Arthritis Rheum 2008; 58: 166473.
  • 27
    Villena J, Berndt C, Granes F, Reina M, Vilaro S. Syndecan-2 expression enhances adhesion and proliferation of stably transfected Swiss 3T3 cells. Cell Biol Int 2003; 27: 100510.
  • 28
    Kirsch T, Koyama E, Liu M, Golub EE, Pacifici M. Syndecan-3 is a selective regulator of chondrocyte proliferation. J Biol Chem 2002; 277: 421717.
  • 29
    Ikesue M, Matsui Y, Ohta D, Danzaki K, Ito K, Kanayama M, et al. Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol 2011; 31: 106674.
  • 30
    Orend G, Huang W, Olayioye MA, Hynes NE, Chiquet-Ehrismann R. Tenascin-C blocks cell-cycle progression of anchorage-dependent fibroblasts on fibronectin through inhibition of syndecan-4. Oncogene 2003; 22: 391726.
  • 31
    Rauch BH, Millette E, Kenagy RD, Daum G, Fischer JW, Clowes AW. Syndecan-4 is required for thrombin-induced migration and proliferation in human vascular smooth muscle cells. J Biol Chem 2005; 280: 1750711.
  • 32
    Song Y, McFarland DC, Velleman SG. Role of syndecan-4 side chains in turkey satellite cell growth and development. Dev Growth Differ 2011; 53: 97109.
  • 33
    Cevikbas F, Schaefer L, Uhlig P, Robenek H, Theilmeier G, Echtermeyer F, et al. Unilateral nephrectomy leads to up-regulation of syndecan-2- and TGF-β-mediated glomerulosclerosis in syndecan-4 deficient male mice. Matrix Biol 2008; 27: 4252.
  • 34
    Ishiguro K, Kadomatsu K, Kojima T, Muramatsu H, Matsuo S, Kusugami K, et al. Syndecan-4 deficiency increases susceptibility to κ-carrageenan-induced renal damage. Lab Invest 2001; 81: 50916.
  • 35
    Ishiguro K, Kadomatsu K, Kojima T, Muramatsu H, Iwase M, Yoshikai Y, et al. Syndecan-4 deficiency leads to high mortality of lipopolysaccharide-injected mice. J Biol Chem 2001; 276: 474838.
  • 36
    Cornelison DD, Wilcox-Adelman SA, Goetinck PF, Rauvala H, Rapraeger AC, Olwin BB. Essential and separable roles for Syndecan-3 and Syndecan-4 in skeletal muscle development and regeneration. Genes Dev 2004; 18: 22316.
  • 37
    Cornelison DD, Filla MS, Stanley HM, Rapraeger AC, Olwin BB. Syndecan-3 and syndecan-4 specifically mark skeletal muscle satellite cells and are implicated in satellite cell maintenance and muscle regeneration. Dev Biol 2001; 239: 7994.
  • 38
    Echtermeyer F, Harendza T, Hubrich S, Lorenz A, Herzog C, Mueller M, et al. Syndecan-4 signalling inhibits apoptosis and controls NFAT activity during myocardial damage and remodelling. Cardiovasc Res 2011; 92: 12331.
  • 39
    Matsui Y, Ikesue M, Danzaki K, Morimoto J, Sato M, Tanaka S, et al. Syndecan-4 prevents cardiac rupture and dysfunction after myocardial infarction. Circ Res 2011; 108: 132839.
  • 40
    Kojima T, Takagi A, Maeda M, Segawa T, Shimizu A, Yamamoto K, et al. Plasma levels of syndecan-4 (ryudocan) are elevated in patients with acute myocardial infarction. Thromb Haemost 2001; 85: 7939.
  • 41
    Bohme K, Winterhalter KH, Bruckner P. Terminal differentiation of chondrocytes in culture is a spontaneous process and is arrested by transforming growth factor-β2 and basic fibroblast growth factor in synergy. Exp Cell Res 1995; 216: 1918.
  • 42
    Serra R, Karaplis A, Sohn P. Parathyroid hormone-related peptide (PTHrP)-dependent and -independent effects of transforming growth factor β (TGF-β) on endochondral bone formation. J Cell Biol 1999; 145: 78394.