SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

Objective

MicroRNAs (miRNAs) are endogenous small noncoding RNAs that regulate the activity of target messenger RNAs (mRNAs) and cellular processes. MicroRNA-451 (miR-451) is one of the miRNAs that is conserved perfectly among vertebrates, and it regulates cell proliferation, invasion, and apoptosis in tumors. However, the role of miR-451 in autoimmune arthritis is unknown. This study was undertaken to identify the role of miR-451 in autoimmune arthritis.

Methods

We compared the expression of miR-451 in neutrophils from patients with rheumatoid arthritis (RA) and healthy controls. We also evaluated the role of miR-451 in neutrophil chemotaxis in vivo and in vitro using murine neutrophils. The regulation of p38 MAPK by miR-451 was assessed. Double-stranded miR-451 was administered to SKG mice, the arthritis score was determined, and histologic examination was performed.

Results

MicroRNA-451 expression in neutrophils isolated from patients with RA was lower than that in healthy controls. Systemic administration of miR-451 significantly disrupted the infiltration of neutrophils in an air-pouch model of local inflammation without affecting apoptosis of neutrophils. Overexpression of miR-451 significantly suppressed the migration of neutrophils to fMLP. We identified CPNE3 and Rab5a as direct targets of miR-451. Overexpression of miR-451 suppressed the phosphorylation of p38 MAPK via 14-3-3ζ, a known target of miR-451, and Rab5a. In SKG mice, miR-451 treatment reduced the severity of arthritis and the number of infiltrating cells.

Conclusion

These results suggest that miR-451 suppresses neutrophil chemotaxis via p38 MAPK and is a potential target in the treatment of RA.

Rheumatoid arthritis (RA) is a systemic, chronic inflammatory disease characterized by synovial hyperplasia, joint destruction, and extraarticular manifestations, and it has a significant impact on both morbidity and mortality ([1]). Although the number of effective medications for RA has expanded rapidly, the pathogenesis of RA, in particular the role of microRNA (miRNA), remains to be determined.

MicroRNAs are endogenous small (∼22 nucleotides), single-stranded, noncoding RNAs that mediate messenger RNA (mRNA) cleavage, translational repression, and mRNA destabilization ([2]). Currently, >2,200 human miRNAs are registered in the miRBase database (release 19) ([3]). As fine-tuning regulators of gene expression, miRNAs have been implicated in important cellular processes such as apoptosis and differentiation ([4]), and it has been estimated that one-third of all mRNAs may be regulated by miRNAs ([5]).

In the past several years, research has shown that patients with RA have alterations in cellular miRNA. Dysregulation of miRNA in peripheral blood mononuclear cells (PBMCs), T lymphocytes, synovial fibroblasts, and osteoclasts, each considered a key effector of joint destruction, has been shown to contribute to inflammation, degradation of the extracellular matrix, and invasive behavior of resident cells ([6-9]). MicroRNAs are also present in human plasma (circulating miRNAs) ([10]). Altered expression of circulating miRNAs in patients with RA has been reported by our group and by others ([11-13]).

MicroRNA-451 (miR-451) is one of the miRNAs that is conserved perfectly among vertebrates and expressed abundantly in plasma ([14, 15]). It plays an important role as a tumor suppressor by regulating cell proliferation, invasion, and apoptosis ([16, 17]). MicroRNA-451 also regulates cytokine production by dendritic cells ([18]). However, the role of miR-451 in autoimmune arthritis is unknown.

In the present study, we showed that cellular miR-451 levels in neutrophils were lower in patients with RA than in healthy controls. We also demonstrated that enhancement of miR-451 suppressed neutrophil chemotaxis via down-regulation of p38 MAPK phosphorylation and that systemic administration of miR-451 with atelocollagen significantly suppressed neutrophil migration in an air-pouch model of local inflammation and severity of arthritis in SKG mice. These findings suggest that miR-451 has potential as a therapeutic target in RA.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

Mice

SKG/Jcl mice and BALB/cCrSlc mice were purchased from Clea Japan and Japan SLC, respectively. All mice were maintained in specific pathogen–free conditions, and all animal studies were conducted in accordance with the principles of the Kyoto University Committee of Animal Resources, which are based on the International Guiding Principles for Biomedical Research Involving Animals.

Reagents

Mannan from Saccharomyces cerevisiae was purchased from Sigma-Aldrich and dissolved in 200 μl of phosphate buffered saline (PBS) before intraperitoneal injection. Lipopolysaccharide (LPS) and fMLP were also obtained from Sigma-Aldrich. Human recombinant tumor necrosis factor α (TNFα), interleukin-1β (IL-1β), interferon-γ (IFNγ), and granulocyte–macrophage colony-stimulating factor (GM-CSF) were purchased from PeproTech. For flow cytometry, anti-mouse Ly-6G/Ly-6C (Gr-1) and anti-mouse CD11b antibodies, allophycocyanin-labeled annexin V, and 7-aminoactinomycin D (7-AAD) viability staining solution were purchased from BioLegend. Anti–phospho-p38 MAPK (Thr180/Tyr182) was purchased from Cell Signaling Technology. For Western blot analysis, anti–β-actin and anti-Rab5a were purchased from Santa Cruz Biotechnology, anti-CPNE3 was purchased from Atlas Antibodies, and anti-p38 and anti–phospho-p38 were purchased from Cell Signaling Technology.

Isolation of platelets, mononuclear cells (MNCs), neutrophils, and fibroblast-like synoviocytes (FLS).

Ethical approval of the use of human samples in this study was granted by the Ethics Committee of Kyoto University Graduate School and Faculty of Medicine, and written informed consent was obtained from all study participants. RA was diagnosed according to American College of Rheumatology criteria ([19]). Healthy control samples were collected from volunteers who were not being treated for arthralgia, heart failure, renal failure, or autoimmune disease.

Blood was drawn by cardiac puncture using EDTA-2K tubes. Blood was centrifuged at 600g for 3 minutes. Platelet-rich plasma was further centrifuged for 2 minutes at 400g to pellet the contaminating red blood cells (RBCs) and then centrifuged for 5 minutes at 1,300g to pellet the platelets. Contaminating RBCs were lysed with RBC lysis buffer (Roche Applied Science).

Human PBMCs and neutrophils were isolated by Ficoll density centrifugation (density 1.077 and density 1.119) using a lymphocyte separation solution (Nacalai Tesque). For RNA analysis, murine neutrophils were purified using a MACS cell separation system according to the instructions of the manufacturer (Miltenyl Biotec) and anti–Gr-1 antibodies. FLS from patients with RA were prepared as previously described ([11]).

Total RNA isolation from tissue, cell samples, and conditioned medium

RNA was extracted from cell samples using a High Pure miRNA Isolation kit or RealTime Ready Cell Lysis kit (both from Roche Applied Science). Tissue samples were snap frozen in liquid nitrogen, homogenized with TriPure Isolation Reagent (Roche Applied Science), incubated for 5 minutes at room temperature, mixed with one-fifth the volume of chloroform, shaken vigorously for 15 seconds, incubated for 3 minutes, and centrifuged at 12,000g for 15 minutes at 4°C. Then 300 μl of aqueous phase was applied to a High Pure miRNA Isolation kit according to the manufacturer's protocol. Total RNA included in the conditioned medium was isolated as previously described ([11, 13]).

Real-time quantitative polymerase chain reaction (qPCR) of mature miRNAs

Reverse transcription was performed using an NCode VILO miRNA cDNA Synthesis kit (Life Technologies). Real-time qPCR was performed using Express SYBR GreenER qPCR Supermix and an Applied Biosystems 7500 Thermocycler (both from Life Technologies) with standard plasmids generated as previously described ([11, 13]) or synthetic first-strand complementary DNA (cDNA) with the anticipated sequences. The forward primers were designed as previously described ([11]). The primer sequences were as follows: for U6, 5′-GCGGATTGGAACGATACAGAGAAGA-3′; for snoRNA202, 5′-GGCGCTGTACTGACTTGATGAAAG-3′; and for miR-451, 5′-CGGGAAACCGTTACCATTACTGAGTT-3′. The data were analyzed with SDS Relative Quantification Software version 2.06 (Life Technologies). The absolute concentration of miRNA in each sample was calculated as previously described ([11]).

Real-time qPCR of mRNA

Reverse transcription was performed using a Transcriptor High Fidelity cDNA Synthesis kit or Transcriptor Universal cDNA Master (Roche Applied Science). Real-time qPCR was performed using FastStart Universal SYBR Green Master Mix (Roche Applied Science) on an Applied Biosystems 7500 Thermocycler according to the manufacturer's protocol. The primer sequences were as follows: for GAPDH, 5′-TCTCGCTCCTGGAAGATGGT-3′ (forward) and 5′-GGAAGGTGAAGGTCGGAGTC-3′ (reverse); for CPNE3, 5′-GTCAGACCCTTTATGTGTGTTGT-3′ (forward) and 5′-CGCTCAACCTCATACCACTGT-3′ (reverse); for Rab5a, 5′-AGACCCAACGGGCCAAATAC-3′ (forward) and 5′-TGGCTGCTTGTGCTCCTCTGTAG-3′ (reverse); and for 14-3-3ζ, 5′-GCCCGTAGGTCATCTTGGAG-3′ (forward) and 5′-TGTGAAGCATTGGGGATCAA-3′ (reverse).

Intravenous injection of double-stranded miR-451 or negative control

Double-stranded miR-451, Cy5-conjugated double-stranded miR-451, and nonspecific negative control were synthesized by Fasmac. The sequences were as follows: for the small interfering RNA (siRNA) control, 5′-AUCCGCGCGAUAGUACGUAUU-3′ (sense) and 5′-UACGUACUAUCGCGCGGAUUU-3′ (antisense); for miR-451, 5′-AAACCGUUACCAUUACUGAGUU-3′ (sense) and 5′-UAGUAAUGGUAAUGGUUCUC-3′ (antisense). Equal volumes of atelocollagen (Koken) and miRNA (20 μg/25 μl) were combined and mixed by rotation at 4°C for 20 minutes. Mice were injected in the tail vein with atelocollagen mixed with double-stranded miRNA.

Murine air-pouch model

The air-pouch model of local inflammation was induced in BALB/cCrSlc mice according to the method described by Chalaris et al ([20]). Briefly, mice were anesthetized with pentobarbital, and subcutaneous dorsal pouches were created by injecting 6 ml of sterile air. After 4 days, the pouches were reinjected with 4 ml of air. On day 6, 1 ml of 1% carrageenan (Sigma-Aldrich) in sterile PBS was injected into the pouches. The animals were anesthetized and the pouches were washed with 3 ml of PBS. The lavage fluid was immediately cooled on ice and then analyzed by flow cytometry.

Under-agarose assay

For the under-agarose assay, neutrophils were isolated from spleens using a discontinuous Percoll gradient (GE Healthcare) comprising a stock Percoll solution (90 ml Percoll, 10 ml 10× Hanks' balanced salt solution [HBSS]) diluted to 72%, 64%, and 52% in PBS as described ([21]). The neutrophil band was removed, then cells were washed in PBS, treated with red blood cell lysis buffer to lyse the contaminating RBCs, washed in PBS, and suspended in HBSS plus 10% murine plasma at 1.0 × 107 cells/ml.

The under-agarose assay was performed as previously described ([21, 22]). Briefly, 35 mm culture dishes were filled with 3 ml of a 1.2% agarose solution containing 50% H2CO3-buffered HBSS and 50% RPMI 1640 culture medium supplemented with 20% heat-inactivated fetal bovine serum. After the agarose solidified, 3 holes (3.5 mm in diameter and 2.4 mm apart) were cut into a straight line in the gel. The gels were allowed to equilibrate for 1 hour in a 37°C/5% CO2 incubator. The central well was loaded with 10 μl of purified neutrophils, and the outer wells were loaded with chemoattractant. Gels were incubated for 4 hours in a 37°C/5% CO2 incubator.

Flow cytometry

Neutrophils were stained for Gr-1, CD11b, annexin V, and 7-AAD, and analyzed on a BD FACSCanto II (BD Biosciences). To quantify phospho-p38 MAPK, neutrophils from the spleens of mice were stained for Gr-1, CD11b, and phospho-p38 MAPK according to the manufacturer's instructions.

Plasmid construction

The miR-451 overexpression vector (pcDNA6.2/miR-451) was generated by ligating annealed oligonucleotides into a pcDNA6.2-GW/EmGFP-miR vector, using Block-It Pol II miR RNAi Expression Vector kits (both from Life Technologies). A construct inserted with oligonucleotides synthesized in reference to the nonspecific negative control of miCentury OX miNatural (Cosmo Bio) was used for the pcDNA6.2/mock vector, and oligonucleotides of anti–miR-451 sequences were used for pcDNA6.2/anti–miR-451. The sequences of inserted oligonucleotides were as follows: for mock, 5′-TGCTGAAATCCGCGCGATAGTACGTAGTTTTGGCCACTGACTGACTACGTACTCGCGCGGATTT-3′ (sense) and 5′-CCTGAAATCCGCGCGAGTACGTAGTCAGTCAGTGGCCAAAACTACGTACTATCGCGCGGATTTC-3′ (antisense); for miR-451, 5′-TGCTGAAACCGTTACCATTACTGAGTTGTTTTGGCCACTGACTGACAACTCAGTTGGTAACGGTTT-3′ (sense) and 5′-CCTGAAACCGTTACCAACTGAGTTGTCAGTCAGTGGCCAAAACAACTCA GTAATGGTAACGGTTTC-3′ (antisense); and for anti–miR-451, 5′-TGCTGAACTCAGTAATGGTAACGGTTTTGGCCACTGACTGAACCGTTAATTACTGAGTT-3′ (sense) and 5′-GGCCAAAACCGTTACCATTACTGAGTTC-3′ (antisense).

To construct the luciferase reporter vector, we inserted a 3′-untranslated region (3′-UTR) fragment containing putative binding sites for miR-451 into the Nhe I–Sa lI fragment of the pmirGLO vector (Promega). The sequences of inserted oligonucleotides were as follows: for CPNE3 3′-UTR wild type, 5′-CTAGCTAGCGGCCGCTAGTAATTGAGATTTGTTAAAACGGTTAG-3′ (sense) and 5′-TCGACTAACCGTTTTAACAAATCTCAATTACTAGCGGCCGCTAG-3′ (antisense); for CPNE3 3′-UTR mutant, 5′-CTAGCTAGCGGCCGCTAGTAATTGAGATTTGTTAAGGAAACCAG-3′ (sense) and 5′-TCGACTGGTTTCCTTAACAAATCTCAATTACTAGCGGCCGCTAG-3′ (antisense); for Rab5a 3′-UTR wild type, 5′-CTAGCTAGCGGCCGCTAGTAATGCAGAATTAGGAAAACGGTTCG-3′ (sense) and 5′-TCGACGAACCGTTTTCCTAATTCTGCATTACTAGCGGCCGCTAG-3′ (antisense); and for Rab5a 3′-UTR mutant, 5′-CTAGCTAGCGGCCGCTAGTAATGCAGAATTACCAAATGCCTTCG-3′ (sense) and 5′-TCGACGAAGGCATTTGGTAATTCTGCATTACTAGCGGCCGCTAG-3′ (antisense).

Transfection

HeLa cells were seeded in 12-well, 24-well, or 96-well plates as appropriate and transfected with the precursor miR-451–expressing vector or the mock vector with or without the luciferase reporter vector using FuGene HD (Roche Applied Science). Double-stranded miRNA (miCentury OX miNatural) and nonspecific negative control siRNA were purchased from Cosmo Bio. The siRNA sequences specific for 14-3-3ζ, Rab5a, and CPNE3 have been described ([23-25]). Transfection of siRNA with or without the luciferase reporter vector was performed using an X-tremeGene siRNA transfection reagent (Roche Applied Science).

FLS were seeded in 96-well plates as appropriate and transfected with double-stranded miRNA or siRNA using a TransIt-TKO transfection reagent (Mirus).

Luciferase assay

Luciferase activity was measured 24 hours after transfection using a dual-luciferase reporter assay system according to the instructions of the manufacturer (Promega).

Western blot analysis

Western blot analysis was performed as previously described ([26]). Briefly, 10–20 ng of cell lysate was subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane (Schleicher & Schuell). After blocking with 1% skim milk or 2% bovine serum albumin, the membrane was probed with anti–β-actin (1:4,000), anti-Rab5a (1:1,000), anti-CPNE3 (1:1,000), anti-p38 (1:1,000), or anti–phospho-p38 (1:1,000), incubated with horseradish peroxidase–conjugated second antibody, and visualized using a Pierce ECL Western blotting substrate (Thermo Fisher Scientific) or an ECL Plus Western blotting detection reagent or ECL Prime Western blotting detection reagent (both from GE Healthcare UK), as appropriate.

Enzyme-linked immunosorbent assay (ELISA).

The quantification of p38 and phospho-p38 MAPK was performed using a cell-based p38 MAPK (Thr180/Tyr182) ELISA (RayBiotech). IL-6 concentrations in the FLS culture medium were quantified with Human IL-6 ELISA MAX (BioLegend).

Clinical assessment of arthritis scores and histologic analysis

Arthritis scores was assessed as previously described ([27]). Ankle joint specimens from the mice were processed as 5-μm–thick paraffin-embedded sections and stained with hematoxylin and eosin.

Statistical analysis

In vivo joint scores were analyzed by Mann-Whitney U test. Student's t-test was used for statistical analysis. P values less than 0.05 were considered significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

MicroRNA-451 expression in neutrophils is significantly lower in RA patients

We analyzed miR-451 expression in human blood cells. Expression of miR-451 was most abundant in RBCs, with expression next most abundant in platelets and neutrophils (Figure 1A). MicroRNA-451 expression in neutrophils was significantly lower in RA patients than in healthy controls (Figure 1B). To examine whether proinflammatory signals induce down-regulation of miR-451 in neutrophils, cells were stimulated with LPS, TNFα, IL-1β, IFNγ, or GM-CSF. Although stimulation with LPS, TNFα, or IL-1β did not change miR-451 expression, IFNγ and GM-CSF each induced the down-regulation of miR-451 in neutrophils (P < 0.05 and P < 0.01, respectively) (Figure 1C). A combination of IFNγ and GM-CSF did not enhance the down-regulation of miR-451. These data suggest that the expression of miR-451 in neutrophils from RA patients might be decreased in response to cytokine stimuli and that the change in miR-451 has potential roles in neutrophil function.

image

Figure 1. MicroRNA-451 (miR-451) expression is significantly reduced in neutrophils from patients with rheumatoid arthritis (RA). A and B, Expression of miR-451 in the blood cells of 14 healthy controls (HCs) (A) and in the neutrophils of 7 RA patients and 10 healthy controls (B) was measured by real-time quantitative polymerase chain reaction (qPCR). Values in A are the mean ± SD. In B, each circle represents an individual subject. Bars show the mean ± SD. RBC = red blood cell; MNC = mononuclear cell. C, Human neutrophils were cultured for 18 hours in medium alone or in the presence of lipopolysaccharide (LPS) (30 ng/ml), tumor necrosis factor α (TNFα) (2 ng/ml), interleukin-1β (IL-1β) (2 ng/ml), interferon-γ (IFNγ) (5 ng/ml), and/or granulocyte–macrophage colony-stimulating factor (GM-CSF) (30 pM), and expression of miR-451 (normalized to the expression of U6) was measured by real-time qPCR. Values are the mean ± SEM of quadruplicate experiments. ∗ = P < 0.05; ∗∗ = P < 0.01 versus controls.

Download figure to PowerPoint

MicroRNA-451 suppresses neutrophil chemotaxis

To investigate the relevance of miR-451 to neutrophil function, we used an air-pouch model, a reliable experimental approach for studying inflammatory mechanisms such as neutrophil chemotaxis ([28]). After the air pouch was generated, double-stranded miR-451 or control RNA was administered intravenously to BALB/c mice, followed by local injection of carrageenan into the air pouch. Twenty-four hours later, the number of cells and neutrophils in the air pouch was counted by flow cytometry (Figure 2A). We confirmed the effective in vivo transfection (∼45%) of the Cy5-conjugated double-stranded miR-451 into Gr-1+CD11b+ neutrophils and that the expression of miR-451 in neutrophils from mice transfected with double-stranded miR-451 was 1.8 times as high as that in neutrophils from control mice (Figures 2B and C).

image

Figure 2. Overexpression of microRNA-451 (miR-451) decreases chemotaxis ability. A, The air-pouch model of local inflammation in BALB/c mice is shown (see Materials and Methods for details). Double-stranded miR-451 or small interfering RNA (siRNA) (as a control) was injected into the tail vein 24 hours before the carrageenan injection. B, Cy5+ or Cy5− miR-451 with atelocollagen was administered intravenously, and the uptake of miRNA by neutrophils in the peripheral blood was assessed by flow cytometry 24 hours later. The percentage of Cy5+ cells is indicated. C, Neutrophils were obtained from spleens of mice that had been treated with double-stranded miR-451 or control siRNA 24 hours before isolation. Expression of miR-451 (normalized to the expression of snoRNA202) in neutrophils was measured by real-time quantitative polymerase chain reaction. Each circle represents an individual mouse (n = 8 per group). Bars show the mean ± SD. D, The pellet obtained from the air-pouch lavage fluid is shown. E–I, Cells that had infiltrated into the lavage fluid were stained for Gr-1, CD11b, annexin V, and 7-aminoactinomycin D (7-AAD), and counted by flow cytometry. Representative flow cytometric results (E) and mean ± SEM cell counts (FI) are shown. J, An under-agarose assay was used to evaluate migration of neutrophils to gradients of the chemoattractant. Neutrophils were obtained from spleens of mice that had been treated with double-stranded miR-451 or control siRNA 24 hours before isolation. Ten microliters of 0.1 μM fMLP was loaded into the outer wells of the gel. Values are the mean ± SEM of 5 independent experiments. = P < 0.05. NS = not significant.

Download figure to PowerPoint

Administration of miR-451 significantly decreased infiltration by cells overall (Figures 2D–F) and by Gr-1+CD11b+ neutrophils (Figure 2G). It has been reported that miR-451 induces apoptosis via Rab14 in human non–small cell lung cancer ([17]). However, apoptosis did not increase in the accumulated neutrophils of miR-451–treated mice (Figures 2H and I), indicating that apoptosis was not involved in the decreased infiltration by neutrophils. There were no significant differences in the number of neutrophils in peripheral blood or in the mean fluorescence intensity of Gr-1 in the accumulated neutrophils (data not shown).

To exclude the influence of the capsule cells of the air pouch, neutrophils obtained from miR-451–treated mice or control mice were conducted into an under-agarose assay ([21]). Figure 2J shows that miR-451 overexpression decreased neutrophil migration toward fMLP. These data indicate that overexpression of miR-451 in neutrophils decreases chemotaxis to the site of inflammation.

MicroRNA-451 directly targets CPNE3 and Rab5a genes

MicroRNA-451 is known to suppress Rab14 ([17]), 14-3-3ζ ([29, 30]), and CUGBP2 ([31]) directly. To investigate the role of miR-451 in neutrophils, we sought new target genes of miR-451. We generated a miR-451 expression vector, which up-regulated miR-451 expression by 8- and 15-fold, 24 hours (data not shown) and 48 hours (Figure 3A) after transfection, respectively.

image

Figure 3. MicroRNA-451 (miR-451) directly targets CPNE3 and Rab5a genes. A, HeLa cells were transfected with pcDNA6.2/miR-mock (pc/mock) vector or pcDNA6.2/miR-451 (pc/miR-451) vector. Expression of miR-451 (normalized to U6 expression) in HeLa cells was measured by real-time quantitative polymerase chain reaction (qPCR) 48 hours after transfection (n = 6). B, The putative miR-451–binding sequence in the 3′-untranslated region (3′-UTR) of CPNE3 and RAB5a mRNA is shown. Human CPNE3 or Rab5a 3′-UTR fragments containing a wild-type (WT) or mutant (mt) miR-451–binding sequence were inserted downstream of the luciferase reporter gene. Seed sequences complementary to the target sequences are indicated in boldface. C and D, The wild-type or mutant reporter plasmid containing a 3′-UTR fragment of CPNE3 (C) or Rab5a (D) was cotransfected into HeLa cells with the pcDNA6.2/miR-mock, pcDNA6.2/miR-451, or pcDNA6.2/anti–miR-451 (pc/anti–miR-451) vectors (n = 6), and relative luciferase activity was measured. E, The wild-type reporter plasmid containing a 3′-UTR fragment of CPNE3 or Rab5a was cotransfected into HeLa cells with double-stranded miR-451 (ds-miR-451) or negative control (NC) siRNA (n = 3). F and G, HeLa cells were transfected with the pcDNA6.2/miR-mock, pcDNA6.2/miR-451, or pcDNA6.2/anti–miR-451 vectors. Expression of the CPNE3 and Rab5a proteins was analyzed by Western blot assay (F) (results shown are representative of 4 experiments), and expression of CPNE3 and Rab5a mRNA relative to GAPDH was analyzed by real-time qPCR (n = 6) (G). H, The correlation between the expression of miR-451 and the expression of CPNE3 or Rab5a in neutrophils from patients with rheumatoid arthritis (n = 7) was analyzed. The relative expression levels of miR-451, CPNE3, and Rab5a (normalized to the expression of U6 or GAPDH) are shown. Values in A, C, D, E, and G are the mean ± SEM. = P < 0.05; ∗∗ = P < 0.01, versus pcDNA6.2/miR-mock in A, C, D, and G and versus controls in E.

Download figure to PowerPoint

Open-access software (including TargetScan [32] and miRanda [33]), which was used to screen for target genes that have complementary sites for miR-451 in their 3′-UTR, predicted >1,600 putative target genes. We selected 12 candidate genes that were expected to be involved in neutrophil function, and we inserted the 3′-UTR sequences of each candidate gene downstream of the firefly luciferase reporter gene of the pmirGLO vector. The pmirGLO vector and the miR-451–overexpressing vector, control vector, or anti–miR-451–overexpressing vector were cotransfected into HeLa cells, and luciferase activity was measured (Figures 3B–D).

Overexpression of miR-451 down-regulated luciferase activity with the target sequences of CPNE3 and Rab5a downstream of the firefly luciferase gene, while suppression of miR-451 up-regulated luciferase activity (Figures 3C and D). Although, luciferase with mutated 3′-UTR sequences of Rab5a was paradoxically influenced by the miR-451 vector, luciferase with mutated 3′-UTR sequences of CPNE3 was not influenced by overexpression or down-regulation of miR-451 as expected. Transfection of synthesized double-stranded miR-451 also decreased luciferase activity in each pmirGLO vector (Figure 3E). Overexpression of miR-451 also significantly down-regulated the expression of protein and mRNA for native CPNE3 and Rab5a in HeLa cells (Figures 3F and G). In contrast, down-regulation of miR-451 increased these expression levels (Figures 3F and G). These data suggest that miR-451 affects the expression of CPNE3 and Rab5a at both the transcriptional and translational levels.

Previous reports have detailed the expression of CPNE3 and Rab5a in human neutrophils ([34, 35]). We also analyzed the expression of CPNE3 and Rab5a in neutrophils from RA patients and healthy controls, and there were no significant differences in expression (data not shown). However, the expression of Rab5a was negatively correlated with the expression of miR-451 in RA patients (R = −0.83, P < 0.05) (Figure 3H), indicating that Rab5a is regulated by miR-451 in RA neutrophils.

MicroRNA-451 down-regulates the p38 MAPK signaling pathway via 14-3-3ζ and Rab5a

During the host response to bacterial infection or tissue injury, neutrophils respond to multiple chemoattractants. However, neutrophils must ultimately disengage from some chemoattractants and migrate unidirectionally toward the bacteria-derived chemoattractants ([21]). Neutrophils prioritize chemotactic signals by distinguishing “intermediary” (leukotriene B4, CXCL8, and platelet-activating factor) and “end-target” (fMLP and C5a) chemoattractants through distinct intracellular signaling pathways. Although the phosphoinositide 3-kinase pathway is important in the intermediary chemoattractant pathway, p38 MAPK plays an important role in migration of neutrophils toward the end-target chemoattractant.

To evaluate the effect of miR-451 on p38 MAPK, we prepared siRNAs for Rab5a, CPNE3, and 14-3-3ζ (because 14-3-3ζ is thought to associate with p38 MAPK) ([30]). Messenger RNA for 14-3-3ζ, Rab5a, and CPNE3 was degraded when HeLa cells were transfected with siRNA for each gene (Figures 4A–C). Transfection of double-stranded miR-451 also significantly decreased 14-3-3ζ, Rab5a, and CPNE3 mRNA levels (Figures 4A–C).

image

Figure 4. Overexpression of microRNA-451 (miR-451) inactivates the p38 MAPK signaling pathway via 14-3-3ζ and Rab5a. AC, Expression of mRNA for 14-3-3ζ (A), Rab5a (B), and CPNE3 (C) relative to GAPDH in HeLa cells transfected with small interfering RNA (siRNA) (as a negative control), double-stranded miR-451, or siRNA for 14-3-3ζ, Rab5a, or CPNE3 (n = 6 experiments) was analyzed by real-time quantitative polymerase chain reaction (qPCR). D, Levels of p38 MAPK and phospho-p38 MAPK in whole-cell extracts from negative control siRNA, double-stranded miR-451, and siRNA-transfected 14-3-3ζ, Rab5a, or CPNE3 HeLa cells were assessed by Western blotting, with β-actin used as a control. Images are representative of 3 independent experiments. E and F, The amount of p38 MAPK (E) and phospho-p38 MAPK (F) was quantified by enzyme-linked immunosorbent assay (ELISA) (n = 6 experiments). G, Phospho-p38 MAPK in Gr-1+CD11b+ neutrophils was detected by flow cytometry. Neutrophils were harvested from spleens of mice 24 hours after intravenous administration of double-stranded miR-451 or control siRNA. H, The percentage of phospho-p38+ cells and the mean fluorescence intensity (MFI) of phospho-p38 MAPK were quantified (n = 5 mice per group). I, Expression of mRNA for 14-3-3ζ, Rab5a, and CPNE3 relative to GAPDH in fibroblast-like synoviocytes (FLS) 48 hours after transfection with negative control siRNA or double-stranded miR-451 (n = 4 experiments) was analyzed by real-time qPCR. J, After transfection with negative control siRNA, double-stranded miR-451, or siRNAs for 14-3-3ζ, Rab5a, and CPNE3 for 48 hours, FLS were cultured in serum-free Dulbecco's modified Eagle's medium with 10 ng/ml tumor necrosis factor α for 48 hours. The concentration of interleukin-6 (IL-6) in the conditioned medium was quantified by ELISA (n = 5). Values in A–C, E, F, and H–J are the mean ± SEM. = P < 0.05; ∗∗ = P < 0.01 versus controls.

Download figure to PowerPoint

Western blot analysis showed that the expression of p38 MAPK was not affected in cells transfected with double-stranded miR-451 or with siRNA for 14-3-3ζ, Rab5a, or CPNE3, whereas the phosphorylation of p38 MAPK was down-regulated (Figure 4D). The amount of p38 or phospho-p38 MAPK was quantified by ELISA (Figures 4E and F). Phospho-p38 MAPK content decreased in cells transfected with double-stranded miR-451, 14-3-3ζ siRNA, or Rab5a siRNA. These data suggest that up-regulation of miR-451 expression inhibited the phosphorylation of p38 MAPK via 14-3-3ζ and Rab5a but not CPNE3. No significant effect on the phosphorylation of Akt, a downstream molecule of the phosphoinositide 3-kinase pathway, was observed in cells transfected with double-stranded miR-451 (data not shown).

Next, we harvested neutrophils from the spleens of mice that had received double-stranded miR-451 or control siRNA intravenously. Flow cytometric analysis showed that miR-451 overexpression decreased phospho-p38 MAPK in Gr-1+CD11b+ neutrophils (Figures 4G and H). These data suggest that overexpression of miR-451 decreases phospho-p38 MAPK in murine neutrophils as well.

To further determine the role of miR-451 and its target genes, including Rab5a and CPNE3, we investigated IL-6 production in RA FLS. We confirmed that transfection of double-stranded miR-451 significantly decreased 14-3-3ζ, Rab5a, and CPNE3 mRNA levels, even in FLS from RA patients (Figure 4I). While transfection of 14-3-3ζ siRNA enhanced the production of IL-6 (P < 0.01), overexpression of miR-451 and knockdown of Rab5a or CPNE3 down-regulated the production of IL-6 (P < 0.01, P < 0.05, and P = 0.09, respectively) (Figure 4J), implying involvement of miR-451 in the pathogenesis of RA (including in the priming of neutrophils via IL-6) ([36]).

Administration of double-stranded miR-451 ameliorates autoimmune arthritis

We demonstrated that administration of miR-451 markedly decreased the infiltration of neutrophils in an air-pouch model. However, various types of immune cells are also involved in the pathogenesis of RA. SKG mice, which harbor a mutation of the gene encoding ZAP-70 on a BALB/c background, develop self-sustained arthritis after a single injection of mannan ([37]). To examine the involvement of miR-451 in the development of autoimmune arthritis, we injected double-stranded miR-451 intravenously twice a week into mannan-treated SKG mice.

Intravenous administration of miR-451 reduced the severity of arthritis significantly (Figures 5A and B) and reduced the incidence slightly (Figure 5C). Histologic analysis indicated that synovitis was suppressed and that the number of cells infiltrating the synovium was reduced significantly in mice treated with double-stranded miR-451 (Figures 5D and E). Attenuation of arthritis by administration of miR-451 suggests that down-regulation of miR-451 expression might lead to exacerbation of autoimmune arthritis partly by dysregulation of the chemotaxis of infiltrating cells. It also indicates that administration of miR-451 is a potential treatment for RA.

image

Figure 5. Administration of double-stranded microRNA-451 (miR-451) ameliorates autoimmune arthritis in SKG mice. Female SKG mice (8–12 weeks old) were injected intraperitoneally with 20 mg of mannan. Double-stranded miR-451 or control small interfering RNA (n = 6 mice per group) was administered intravenously on days 0, 4, 7, and 11. AC, Representative joint swelling (A), mean ± SEM arthritis scores (B), and incidence of arthritis (C) in SKG mice at 1, 2, and 3 weeks after mannan treatment. D, Representative histologic findings in SKG mice 3 weeks after mannan treatment. Hematoxylin and eosin stained; bars = 200 μm. E, Number of cells infiltrating into the synovial tissue per high-power field (hpf) (n = 6 mice per group). Values are the mean ± SEM. = P < 0.05 versus controls.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

MicroRNAs are of interest because of their critical role as fine regulators of gene expression at the posttranscriptional level within cells in many diseases, and because they are potential targets in the treatment of disease. The abnormal pattern of miRNA expression has been reported in various diseases, and the suppression of overexpressed miRNAs or reconstitution of the expression by restoration of silenced miRNAs is a therapeutic target in many fields ([4]).

MicroRNA-451 has been shown to play an important role in erythropoiesis ([38]) and in suppressing tumor growth by regulating cell proliferation and apoptosis ([16, 17]). It has also been suggested that miR-451 contributes to CD4+ T cell function ([39]). Thus, we assumed that miR-451 was relevant to autoimmune arthritis and that reduced expression of miR-451 in neutrophils implied that miR-451 was possibly crucial to neutrophil function.

Transcriptional regulation of miR-451 is largely unknown; however, miR-451 was shown to be transcriptionally activated by transcription factor 3 in T cells ([40]). E2A activity is inhibited by a Ras/ERK/MAPK pathway ([41]), which is activated by GM-CSF stimulation ([42]). Early growth response 1, an inhibitory factor of transcription factor 3, is stimulated by IFNγ independently of STAT-1 ([43]). Stimulation with GM-CSF or IFNγ might down-regulate the expression of miR-451 in neutrophils via this pathway.

Neutrophil chemotaxis driven by the complement pathway has an important function in animal models of arthritis ([44]), and the possible contribution of neutrophils to RA pathology, even in the early phases, has been reported ([1]). Neutrophils are the first cell type to arrive at sites of inflammation. They secrete immune mediators that can activate neutrophils and other immune cells, triggering positive regulatory feedback that may lead to acute and persistent inflammation. Neutrophils live longer in inflammatory sites, where they augment the release of powerful destructive enzymes. These cells are also thought to be involved in bone remodeling and bone resorption through membrane-bound RANKL, which activates monocyte fusion into fully functional osteoclasts ([45]). Neutrophils can interact with other cells, such as antigen-presenting cells and osteoclast-like cells, and can regulate their function. Thus, neutrophils are considered to be more than simple final effectors.

Rab5a and CPNE3 are newly identified direct targets of miR-451. Rab5a is a small GTPase, and it is essential for endosome formation and trafficking in neutrophils and macrophages ([46, 47]). CPNE3 exists in the cytosol of neutrophils and is expressed in immature neutrophil precursors ([34]). However, the true function of CPNE3 in neutrophils is unknown because the short lifespan of neutrophils limits the ability to investigate this using transfection or in vivo microinjection studies.

Systemic administration of miR-451 suppressed arthritis in SKG mice. Although the reduced chemotaxis of neutrophils by miR-451 explains this suppression at least in part, the contribution of other cells may also be assumed. Via Rab5a and CPNE3, miR-451 down-regulated the production of IL-6 from FLS, which play a fundamental role in driving the inflammation associated with RA at both the local and systemic levels. We also confirmed that miR-451 down-regulated the proliferation of FLS independent of Rab5a and CPNE3 (data not shown). A recent study demonstrated that inhibition of miR-451 in dendritic cells increased the production of IL-6, TNF, CCL3, CCL5, and IFNβ via 14-3-3ζ when cells were transfected with influenza ([18]). Proinflammatory mediators, including TNFα, IL-1β, and cyclooxygenase 2, are downstream of p38 MAPK ([48]). Systemic administration of miR-451 might relieve inflammation in autoimmune arthritis via these mechanisms.

The present study has a few limitations. It is difficult to deliver precursor miR-451 specifically to neutrophils. We confirmed that the expression of miR-451 in neutrophils from mice transfected with double-stranded miR-451 was 1.8 times as high as in neutrophils from control mice. However, surrounding cells, which were also transfected with miR-451, might prime the condition of neutrophils in vivo prior to isolation. More efficient direct methods to deliver miRNA are needed for the clinical use of small RNAs. Although we showed that miR-451 inhibits the phosphorylation of p38 MAPK via 14-3-3ζ and Rab5a, it remains to be determined how crucial these genes are for the regulation of p38 MAPK by miR-451.

Another limitation of this study is that we could not identify the function of CPNE3 in neutrophils, and we could not elucidate fully the mechanism by which miR-451 suppresses autoimmune arthritis. The function of CPNE3 in neutrophils and the role of miR-451 in other cells including T cells, B cells, and synovial cells should be investigated in the future. Nevertheless, this study shows for the first time the obvious suppressive function of miR-451 in neutrophil chemotaxis and in autoimmune arthritis.

In conclusion, we demonstrated that miR-451 suppressed neutrophil chemotaxis via p38 MAPK in vitro and in vivo and ameliorated autoimmune arthritis, and our analysis identified new direct targets of miR-451. These findings suggest that miR-451 is a potential target in the treatment of RA.

AUTHOR CONTRIBUTIONS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. Yoshitomi had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study conception and design. Murata, Yoshitomi.

Acquisition of data. Murata, Yoshitomi, Furu, Ishikawa, Shibuya, Ito.

Analysis and interpretation of data. Murata, Yoshitomi, Matsuda.

Acknowledgments

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES

We gratefully acknowledge the patients and volunteers who consented to blood collection for use in this study. We thank Koji Yamamoto, Motomu Hashimoto, Yoshinaga Ito, and Ryoko Nakanishi (Kyoto University) for their excellent help. We also thank Associate Professor Tomoki Aoyama (Kyoto University) for permission to use the Applied Biosystems 7500 Thermocycler for real-time quantitative polymerase chain reaction and the BD FACSCanto II.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. AUTHOR CONTRIBUTIONS
  7. Acknowledgments
  8. REFERENCES