SEARCH

SEARCH BY CITATION

Keywords:

  • animal models;
  • developmental neurobiology;
  • neuroanatomy

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Candidate risk genes for autism spectrum disorder (ASD) have been identified, but the challenge of determining their contribution to pathogenesis remains. We previously identified two ASD risk genes encoding the receptor tyrosine kinase MET and the urokinase plasminogen activator receptor (PLAUR), which is thought to modulate availability of the MET ligand. We also reported a role for Met signaling in cortical interneuron development in vitro and a reduction of these neurons in uPAR (mouse ortholog of PLAUR) null mice, suggesting that disruption of either gene impacts cortical development similarly. Here, we modify this conclusion, reporting that interneuron numbers are unchanged in the neocortex of Metfx/fx/ Dlx5/6cre mice, in which Met is ablated from cells arising from the ventral telencephalon (VTel). Consistent with this, Met transcript is not detected in the VTel during interneuron genesis and migration; furthermore, during the postnatal period of interneuron maturation, Met is co-expressed in glutamatergic projection neurons, but not interneurons. Low levels of Met protein are expressed in the VTel at E12.5 and E14.5, likely reflecting the arrival of Met containing corticofugal axons. Met expression, however, is induced in E12.5 VTel cells after 2 days in vitro, perhaps underlying discrepancies between observations in vitro and in Metfx/fx/ Dlx5/6cre mice. We suggest that, in vivo, Met impacts the development of cortical projection neurons, whereas uPAR influences interneuron maturation. An altered balance between excitation and inhibition has been postulated as a biological mechanism for ASD; this imbalance could arise from different risk genes differentially affecting either or both elements.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Over the past decade, there has been rapid progress in identifying putative risk genes for autism spectrum disorder (ASD) and related neurodevelopmental disorders [Abrahams & Geschwind, 2008; Bill & Geschwind, 2009; El-Fishawy & State, 2010]. Thus far, however, much less is known about the mechanisms through which these genes impact brain development and, when disrupted, how they contribute to disorder pathogenesis. We identified a common functional polymorphism in the MET gene promoter, which leads to decreased transcription of MET and significantly increases the risk for developing ASD [Campbell et al., 2006]. This finding has been replicated by our own [Campbell, Li, Sutcliffe, Persico, & Levitt, 2008] and other groups [Jackson et al., 2009; Sousa et al., 2009]. The subsequent identification of copy number variants [Marshall et al., 2008] and rare functional mutations [Campbell et al., 2006] in the MET gene lends further support to the idea that alterations in MET signaling contribute to ASD risk. Consistent with these genetic data, MET transcript and MET protein expression are decreased in the temporal cortex of ASD cases compared to controls [Campbell et al., 2007].

MET is a receptor tyrosine kinase, which, when activated, can induce multiple cellular responses, including proliferation, migration, differentiation and survival, depending on the cell and environmental context [for e.g., Beilmann, Vande Woude, Dienes, & Schirmacher, 2000; Birchmeier, Birchmeier, Gherardi, & Vande Woude, 2003; Bladt, Riethmacher, Isenmann, Aguzzi, & Birchmeier, 1995; Ebens et al., 1996; Giacobini et al., 2007; Okunishi et al., 2005]. Binding of the only known endogenous ligand, hepatocyte growth factor (HGF), results in MET receptor dimerization and autophosphorylation that ultimately activates key intracellular signaling pathways, such as the PI3-kinase and ERK systems [Longati, Bardelli, Ponzetto, Naldini, & Comoglio, 1994; Ponzetto et al., 1994; Stefan et al., 2001; Xiao et al., 2001]. HGF is secreted as a single-chain pro-form that is devoid of signaling activity; pro-HGF requires proteolytic cleavage by a serine protease to acquire biological activity [Kirchhofer et al., 2004; Lokker et al., 1992]. Several such proteases have been reported to activate HGF in vitro, including the urokinase-like plasminogen activator (uPA), whose potency is increased when bound to the urokinase-like plasminogen activator receptor (uPAR) [Blasi, 1993; Mars, Zarnegar, & Michalopoulos, 1993; Naldini et al., 1992]. A recent study, however, suggests that uPA/uPAR may not contribute to HGF activation under physiological conditions [Owen et al., 2010]. Thus, our original hypothesis [Powell, Mars, & Levitt, 2001] connecting the bioavailability of activated HGF ligand through an intact uPA and uPAR system, which in turn modulates MET signaling in vivo, may not be accurate. Yet both uPA and uPAR are expressed in the forebrain [Bahi, Boyer, Kafri, & Dreyer, 2006; Del Bigio, Hosain, & Altumbabic, 1999; Dent, Sumi, Morris, & Seeley, 1993; Lahtinen et al., 2009; Masos & Miskin, 1996; Yoshida & Shiosaka, 1999] and genetic disruption leads to neurodevelopment perturbations [Del Bigio et al., 1999; Eagleson et al., 2010; Eagleson, Bonnin, & Levitt, 2005; Meiri, Masos, Rosenblum, Miskin, & Dudai, 1994; Powell et al., 2001, 2003a]. Moreover, functional polymorphisms in the plasminogen activator, urokinase receptor (PLAUR) gene, the human homolog of the mouse uPAR gene, like those found in MET, increase the risk for ASD [Campbell et al., 2008].

Animal model systems provide a useful experimental tool for investigating potential links between ASD susceptibility genes and alterations in brain architecture, including insights into spatial and temporal dynamics of altered developmental trajectories. In vitro model systems are also used to address important issues regarding the impact of altered signaling and/or environmental conditions on basic cellular processes. Our initial attempts to delineate the role of Met in cortical development utilized an in vitro model system. We demonstrated that HGF stimulates the migration of GABAergic interneurons that arise from cultures of explants of the ventral telencephalon (VTel, [Powell et al., 2001]), presumably through the activation of the Met receptor that is expressed on migrating VTel neurons in vitro. In vivo, consistent with our initial proposal, there is a disruption of cortical interneuron development in a region- and cell-type specific manner in adult uPAR−/− mice [Eagleson et al., 2005; Powell et al., 2001, 2003a]. Specifically, frontal and parietal cortical areas exhibit reduced numbers of parvalbumin (PV)-positive GABAergic neurons, while in the hippocampus, there is a loss of the somatostatin population of interneurons in the CA1 and dentate gyrus subfields. Based on these observations, we suggested that alterations in Met signaling directly impact interneuron migration, leading to alterations in the interneuron profile in the adult cortex.

More recent observations suggest a discrepancy between our initial reports and hypotheses regarding direct action of Met signaling on interneuron migration in the developing mouse forebrain. For example, detailed molecular neuroanatomical analysis of gene and protein expression indicates that the Met receptor protein is expressed at low levels in vivo in the developing VTel that includes the proliferative ganglionic eminences (GE) and the postmitotic neurons of the developing striatum, and that detection of protein by the western blot method is due to receptor transport by neurons projecting from the cortex into the striatum [Judson, Bergman, Campbell, Eagleson, & Levitt, 2009]. Furthermore, a recent study reported normal numbers of GABAergic neurons in the hippocampus when Met is deleted in cells arising from the GE, suggesting that interneuron migration to the hippocampus is unaffected in the absence of Met [Martins, Plachez, & Powell, 2007]. Finally, a recent report suggests that pro-HGF is not activated by uPA under biologically relevant conditions [Owen et al., 2010]. In the current study, we use conditional disruption of Met signaling to examine directly the influence of Met function on neocortical interneuron development. We also use radiolabel and fluorescent double-label in situ hybridization to clarify Met expression by cortical interneurons throughout key prenatal periods of development. In addition, we examine the influence of tissue culture environments on Met receptor expression to decipher possible differences in the roles for Met in vitro and in vivo.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

C57Bl/6 mice were purchased from the Jackson Laboratory (Bar Harbor, ME). Conditional Met mutant mice (Metfx/fx/Dlx5/6cre) were generated by mating mice homozygous for a Met allele (Metfx/fx), in which exon 16 is flanked by loxP sites (courtesy of Dr. Snorri Thorgeirsson, NIH/Center for Cancer Research, Bethesda, MD; [Huh et al., 2004]), to Dlx5/6cre mice (courtesy of Dr. K. Campbell, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio; [Stenman, Toresson, & Campbell, 2003]) that were also heterozygous for the floxed allele (Metfx/+/Dlx5/6cre). Both breeding lines were back-crossed on the C57Bl/6 background for greater than ten generations. The mice were genotyped via polymerase chain reaction (PCR), using the same Met and cre primers as previously described [Judson et al., 2009]. PCR amplification of the unique DNA sequence that results from the Cre-mediated excision of the Metfx/fx allele verified excision of exon 16 in the VTel isolated from Metfx/fx/Dlx5/6cre mice (Supplementary Fig.1). Specifically, a deletion-specific 650 bp fragment could be amplified using the following primers: 5′-CCAGGTGGCTTCAAATTCTAAGG-3′ and 5′-CAGCCGTCAGACAATTGGCAC-3′; the amplicon is absent in control mice, which lack the Dlx5/6cre allele. Conversely, primers directed to the intact floxed Met exon 16 (5′-CCAGGTGGCTTCAAATTCTAAGG-3′ and 5′-TTAGGCAATGAGGTGTCCCAC-3′) amplified a 380 bp fragment in Metfx/fx mice lacking the Dlx5/6cre allele, but failed to generate a PCR product in genomic DNA isolated from telencephalon of Metfx/fx/Dlx5/6cre mice (Supplementary Fig1). Animals were provided free access to food and water and were housed in a 12 hr light:dark cycle. All research procedures using mice were approved by the Institutional Animal Care and Use Committee at Vanderbilt University or at the University of Southern California, and conform to NIH guidelines.

thumbnail image

Figure 1. Brightfield photomicrographs illustrate GAD-67 (A,B) and PV (C,D) immunoreactivity in coronal sections through the hippocampus of adult wild type (A,C) and Metfx/fx/Dlx5/6cre (B,D) mice. Quantitative analysis reveals no significant difference (P>0.05) in the number of GAD-67- (E) and PV- (F) immunoreactive cells in any subfield of the hippocampus examined. Black histograms, wild type; gray histograms, Metfx/fx/Dlx5/6cre. Scale bar = 500 µm.

Download figure to PowerPoint

Immunostaining and Cell Counting

The tissue processing, immunostaining and cell counting procedures were performed using previously published protocols [Eagleson et al., 2005]. Briefly, animals were anesthetized with sodium pentobarbital (60 mg/kg i.p.) and perfused transcardially with 4% paraformaldehyde in phosphate buffered saline (pH 7.2). Brains were equilibrated in 30% sucrose, frozen and sectioned in the coronal plane. GABAergic interneurons in the cortex and hippocampus were visualized by the immunocytochemical detection of glutamic acid decarboxylase-67 (GAD-67) in the adult (>P90) and at P21, using a mouse anti-GAD67 antibody (1:2,000; MAB5406, Chemicon, Temecula, CA). Subpopulations of GABAergic interneurons were analyzed using a mouse anti-PV antibody (1:500; clone Parv-19, Sigma, St. Louis, MO). Profiles of GAD-67- or PV-immunoreactive cells were counted in three areas of the neocortex: frontal (at Bregma levels +2.0, +1.5, and +0.5), parietal (at Bregma levels −0.5, −1.0, and −1.5 mm) and occipital (at Bregma levels −2.5, −3.0, and −3.5 mm), using stereotaxic coordinates in wild type (n = 4 at each age) and Metfx/fx/Dlx5/6cre (n = 4 at each age) mice. For each area at each level, a 440 µm strip of cortex, from the white–gray matter interface to the pial surface, was analyzed. Within the hippocampus, the number of immunoreactive cells contained within a box (440 µm×660 µm) was counted at Bregma levels −2.2 and −2.7 mm for CA1, CA3 and dentate gyrus. All counts were done on a Zeiss Axioplan 2 microscope using brightfield illumination. The average number of immunoreactive cells at each level in a given cortical region or hippocampal subfield was obtained from bilateral counts in a single section and the estimated number of cells calculated according to Abercrombie's formula [Abercrombie, 1946]. For each region analyzed, the number of immunoreactive cells at each Bregma level was summed to give a single value for each animal. The individual counting the anatomical material was blind to genotype. Counting accuracy in the laboratory revealed <3% variance between individuals performing quantitative analysis.

Morphometric Analyses

The volume of selected regions in the forebrain was determined from images of histological sections from the same adult (>P90) mice used for cell counting. Images were acquired with a Zeiss AxioCam HRc camera, using Zeiss Axiovision 4.1 software, and imported into the public domain program ImageJ, version 1.42q for analysis. Each region of interest (neocortex, hippocampus and striatum) was outlined in every fifth section through the prosencephalon. Digital segmentation was performed manually, using cytoarchitectural criteria to delineate structure boundaries. The volume in each slice, and the total volume of the region of interest represented by the sum of all volumes multiplied by five, was determined.

In Situ Hybridization

The tissue processing, probe synthesis and hybridization procedures for radiolabeled single-label and fluorescent double-label in situ hybridization were performed using previously published protocols [Judson et al., 2009; Thompson, Stanwood, & Levitt, 2010]. Briefly, brains were harvested from embryonic (E12.5–E16.5) or postnatal (P14) mice and immediately frozen using ice-cold 2-methylbutane. Twenty micrometers sections were cut in the coronal plane through the entire telencephalon with a cryostat and collected on Superfrost Plus glass slides (VWR, West Chester, PA).

Embryonic brains were processed with a radiolabeled probe for Met. Following pretreatment, each slide was hybridized with 4.2 ng of probe incorporated with 35[S]-CTP, transcribed from a DNA probe template (corresponding to nucleotides 2665–4051 of NM_008591) at 55°C overnight, followed by a series of buffer washes. Slides were dipped in Kodak autoradiography emulsion (Type NTB; Carestream Health Inc, Rochester, NY) and exposed for 8 days prior to development with Kodak Developer D19 (Ted Pella Inc, Redding, CA). Slides treated with negative-control sense strand probes (transcribed from the same DNA probe template as the experimental antisense strand probe) demonstrated hybridization specificity (Supplementary Fig2).

thumbnail image

Figure 2. Brightfield photomicrographs illustrate GAD-67 (A,B) and PV (D,E) immunoreactivity in coronal sections through the parietal cortex of adult wild type (A,D) and Metfx/fx/Dlx5/6cre (B,E) mice. Quantitative analysis reveals no significant difference (P>0.05) in the number of GAD-67- (C) and PV- (F) immunoreactive cells in frontal, parietal or occipital cortex. Black histograms, wild type; gray histograms, Metfx/fx/Dlx5/6cre. Scale bar = 500 µm.

Download figure to PowerPoint

To determine which sub-populations of cells in the postnatal cortex express Met, P14 brains were processed for fluorescent double-label in situ hybridization of Met with probes for glutamatergic projection neurons (VGlut1), interneurons (Gad1), glia (Slc1a2) or oligodendrocytes (Plp1). Met probe synthesis and sequence was as described above. Mouse probe templates were made by RT-PCR amplification of adult mouse cortex cDNA, using probe sequence obtained from the Allen Brain Atlas (VGlut1, Slc1a2 and Plp1). The following mouse sequences were amplified: Slc1a2, nucleotides 873–1627 (754 base pairs) of NM_011393.2; VGlut1, nucleotides 1655–2375 (720 base pairs) of NM_182993.2; Plp1, nucleotides 712–1682 (970 base pairs) of NM_011123.2; and Gad1, nucleotides 1860–2299 (440 bp) of NM_008077.3. Custom primers (Integrated DNA Technologies, Coralville, IA) were designed for each probe: Plp1 forward (GGGGATGCCTGAGAAGGT), reverse (TGTGATGCTTTCTGCCCA); VGlut1 forward (CAGAGCCGGAGGAGATGA), reverse (TTCCCTCAGAAACGCTGG); Slc1a2 forward (ATGATCATGTGGTACTCCCCTC), reverse (TAGAGTTGCTTTCCCTGTGGTT); and Gad1 forward (GCTCTGATGATGGAGTCAGG), reverse (GGTCTAGGACTAAGCCACAG). Following successful PCR amplification of the mouse-derived probe targets, the DNA fragments were TA-cloned into pSTBlue-1 (Novagen Cat. No 70573, Gibbstown, NJ). Direct re-sequencing of probe templates confirmed cloning of transcript. Probes were transcribed and incorporated with digoxigenin-UTP nucleotides into Met antisense, or fluorescein-UTP nucleotides into VGlut1, Plp1, Slc1a2 or Gad1 antisense. Each slide was hybridized with ∼200 ng/ml of probe overnight at 55°C, followed by a series of buffer washes. Each set of experiments included slides treated with negative-control sense strand probes (transcribed from the same DNA probe template as the experimental antisense strand probe) to ensure hybridization specificity.

Explant Cultures and Western Blot Detection of Met

Explant cultures were established from the VTel dissected from E12.5 mice, using a similar protocol to that previously published [Powell et al., 2001]. At this age, most of the isolated tissue is composed of the GE and a relatively small mantle zone of postmitotic neurons. The tissue was embedded in a collagen gel (BD, Franklin Lakes, NJ) in Neurobasal medium supplemented with B27 (Invitrogen, Carlsbad, CA). HGF (10 ng/ml; R&D Systems, Minneapolis, MN) was added to both the culture medium and the collagen gel. After 48 hr in culture, explants were harvested, with those derived from the same litter pooled, frozen immediately in liquid nitrogen and stored at −80°C. In addition, VTel tissue was dissected from E12.5 and E14.5 mice, with tissue from the same litter pooled and snap-frozen in liquid nitrogen for later biochemical analyses.

Western blot analysis was performed using previously published protocols [Judson et al., 2009]. Briefly, tissue was sonicated in ice-cold homogenization buffer containing a protease inhibitor cocktail (Sigma). Tissue homogenates were then cleared and protein concentrations determined using the Dc protein assay (Bio-Rad, Hercules, CA). Protein samples (35 µg protein per lane) were fractionated by SDS-PAGE and transferred to supported nitrocellulose membranes. For each blot, three independent samples were prepared from (a) E12.5 fetuses, (b) E14.5 fetuses and (c) E12.5 fetuses grown for two days in vitro prior to harvesting. This was replicated with three additional independent samples, to give n = 6 for each condition. Membranes were probed with a mouse anti-Met (1:500; sc8057, Santa Cruz Biotechnology, Santa Cruz, CA) and a mouse anti-alpha-tubulin loading control (1:100,000; Oncogene Research Products, San Diego, CA) antibody, followed by a horseradish peroxidase-conjugated anti-mouse secondary antibody (Jackson Immunoresearch, West Grove, PA). Immunoreactive bands were visualized with enhanced chemiluminescence reagents (GE/Amersham ECL, Arlington Heights, IL) and detected with autoradiography film (GE/Amersham). Films were imaged with a high-resolution scanner and subjected to densitometric quantification using IMAGE-J (NIH, Bethesda, MD).

Statistical Analysis

Data are provided as means±SEM. For the analysis of volume and interneuron development in Metfx/fx/Dlx5/6cre mice, each animal is considered a separate sample. For each brain region analyzed, a two-tailed t-test was used to determine significance, with the α level set at 0.05. To examine potential differences in Met expression in vivo and in vitro, the total optical density of the Met immunoreactive band was determined and a ratio was calculated based on the density of the alpha-tubulin band. Tissue isolated from one litter is considered an independent sample. A one-way ANOVA was used to determine significance, with the α level set to 0.05. When a significant difference was observed, this analysis was complemented with a pairwise test, using a two-tailed t-test to identify the source of possible interactions. All analyses were implemented in Statview, version 5.0.1 (SAS Institute, Inc., Cary, NC).

Digital Illustrations

Micrographs of tissue processed for immunocytochemistry or radiolabeled in situ hybridization were acquired with an AxioCam HRc camera (Zeiss, Jena, Germany) attached to an Axioplan II microscope (Zeiss), using Axiovision 4.1 software (Zeiss), using brightfield or dark field illumination, respectively. Micrographs of tissue processed for fluorescent double-label in situ hybridization were acquired using an Olympus FluoView FV1000 confocal microscope, with a pixel size of 0.31 µm×0.31 µm. Images were adjusted for contrast and resizing. The image of the Western blot was acquired using a CCD camera coupled to a UVP BioImaging System using UVP Imager software (UVP, Upland, CA). Figures were prepared digitally in SigmaPlot 7.0 (SPSS Incorporated, Chicago, IL) and Adobe Photoshop 6.01 (Adobe Systems Incorporated, San Jose, CA).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Interneuron Numbers in the Adult Neocortex are Unaltered in the Absence of Met Receptor Signaling

We previously described a reduction in the number of GABAergic interneurons in the adult uPAR−/− cortex and hippocampus [Eagleson et al., 2005; Powell et al., 2003a]. In our original studies, we proposed, based on in vitro observations and the reported role of uPA/uPAR in the activation of HGF, that reduced signaling through the Met receptor underlies the altered interneuron phenotype observed in this mouse. To test this directly, we examined interneuron numbers in Metfx/fx/Dlx5/6cre mice, in which the targeted deletion preferentially ablates exon 16 of the Met gene [Huh et al., 2004], an experimental design that will greatly reduce the processed, membrane-bound form of the Met receptor [Huh et al., 2004; Judson et al., 2009] from all postmitotic cells arising from the VTel [Stenman et al., 2003]. Using this Metfx/fx line, we and others have shown that, when exon 16 is deleted, the Met receptor is unable to signal [Huh et al., 2004; Judson et al., 2009], and is thus considered kinase-dead. Examination of sections through the forebrain of Metfx/fx/Dlx5/6cre mice revealed no gross alterations in cytoarchitecture or in cortical lamination and thickness. Moreover, there are no significant changes in the volumes of three structures that are populated by neurons arising from the VTel: neocortex (wild type: 68.88±3.72 mm3, Metfx/fx/Dlx5/6cre: 65.60±2.61 mm3, t(1,6) = 0.72, P>0.05), hippocampus (wild type: 16.49±1.50 mm3, Metfx/fx/Dlx5/6cre: 15.78±1.79 mm3, t(1,6) = 0.31, P>0.05) and striatum (wild type: 16.30±0.55 mm3, Metfx/fx/Dlx5/6cre: 15.02±1.56 mm3, t(1,6) = 0.78, P>0.05).

Our observations on the number of GAD-67 immunoreactive neurons in the Metfx/fx/Dlx5/6cre hippocampus (Fig. 1A and B) were consistent with a previous report that used GABA immunoreactivity to visualize interneurons in a mouse line using the same deletion strategy [Martins et al., 2007]. Specifically, we found no significant changes in the number GAD-67 immunoreactive cells in any region of the hippocampus (Fig. 1E; CA1 (t(1,6) = 0.49, P>0.05), CA3 (t(1,6) = −0.25, P>0.05) and dentate gyrus (t(1,6) = −0.26, P>0.05)). We then extended our observations to the neocortex. As has been reported previously, GAD-67 immunoreactive cells can be observed in all layers of frontal, parietal and occipital cortices in wild type mice (Fig. 2A) and this pattern is preserved in the conditional null mice (Fig. 2B). In contrast to the uPAR−/− cortex, where significantly fewer GAD-67 positive cells are present in more rostral neocortical regions [Eagleson et al., 2005], there are statistically indistinguishable numbers of immunolabeled cells in frontal (t(1,6) = 0.42, P>0.05), parietal (t(1,6) = 1.84, P>0.05) and occipital cortices (t(1,6) = 0.18, P>0.05) of wild type and Metfx/fx/Dlx5/6cre mice (Fig. 2C). To confirm that there was not a delay in the maturation of this cell population, we performed the same analysis at P21, a stage when deficits in GAD-67 immunolabeled cells could first be observed in the uPAR−/− mouse cortex [Eagleson et al., 2005]. We found no significant changes in the number of GAD-67-positive cells in the regions of hippocampus (CA1 (wild type: 85.88±4.42, Metfx/fx/Dlx5/6cre: 83.31±3.89, t(1,6) = 0.43, P>0.05), CA3 (wild type: 52.88±4.39, Metfx/fx/Dlx5/6cre: 46.06±2.90, t(1,6) = 2.12, P>0.05) and dentate gyrus (wild type: 62.25±3.99, Metfx/fx/Dlx5/6cre: 65.5±5.57, t(1,6) = −0.47, P>0.05)) and neocortex (frontal (wild type: 559.13±24.42, Metfx/fx/Dlx5/6cre: 535.63±22.06, t(1,6) = 0.72, P>0.05), parietal (wild type: 554.69±26.63, Metfx/fx/Dlx5/6cre: 533.69±29.01, t(1,6) = 0.53, P>0.05) and occipital (wild type: 480.81±25.58, Metfx/fx/Dlx5/6cre: 507.25±20.04, t(1,6) = −0.81, P>0.05) examined in Metfx/fx/Dlx5/6cre mice compared to wild type. These data indicate that should signaling through the Met receptor occur in the VTel, it has no direct effect on interneuron migration to and differentiation in the neocortex and hippocampus.

It has previously been reported that there is a decrease in PV-immunoreactive neurons in the CA3 hippocampal subfield in adult Metfx/fx/Dlx5/6cre mice [Martins et al., 2007], while other hippocampal subfields are unaffected. We failed to replicate this finding, observing no significant change in the number of PV-positive cells in any region of the hippocampus examined (Fig. 1C,D,F; CA1 (t(1,6) = −0.13, P>0.05), CA3 (t(1,6) = −0.20, P>0.05) and dentate gyrus (t(1,6) = −2.38, P>0.05)). In addition, there were statistically indistinguishable numbers of PV cells in frontal (t(1,6) = 0.09, P>0.05), parietal (t(1,6) = 0.24, P>0.05) and occipital cortices (t(1,6) = 1.19, P>0.05) cortices of wild type and Metfx/fx/Dlx5/6cre mice (Fig. 2D–F). Similar to the observations for GAD-67-immunopositive cells described above, counts of PV-positive cells at P21 indicate that there is not a delay in the maturation of this subpopulation of interneurons in Metfx/fx/Dlx5/6cre mice. Thus, there are no significant changes in the number of PV-positive cells in the regions of hippocampus (CA1 (wild type: 16.75±2.00, Metfx/fx/Dlx5/6cre: 16.81±2.66, t(1,6) = −0.02, P>0.05), CA3 (wild type: 16.81±1.84, Metfx/fx/Dlx5/6cre: 15.81±2.48, t(1,6) = 0.32, P>0.05) and dentate gyrus (wild type: 10.06±0.97, Metfx/fx/Dlx5/6cre: 9.88±1.47, t(1,6) = 0.12, P>0.05)) and neocortex (frontal (wild type: 326.06±18.87, Metfx/fx/Dlx5/6cre: 312.81±26.16, t(1,6) = 0.72, P>0.05), parietal (wild type: 296.13±6.50, Metfx/fx/Dlx5/6cre: 283.19±26.26, t(1,6) = 0.48, P>0.05) and occipital (wild type: 181.44±8.07, Metfx/fx/Dlx5/6cre: 149.19±14.73, t(1,6) = 1.92, P>0.05)) examined in Metfx/fx/Dlx5/6cre mice compared to wild type. These data indicate that eliminating Met signaling from cells arising in the VTel had no affect on the differentiation or survival of this subpopulation of interneurons that migrates to dorsal pallial structures.

Interneurons do not Express the Met Receptor

Given the negative findings regarding interneuron development using the Metfx/fx/Dlx5/6cre line, we re-examined the putative expression of the Met receptor in the early developing VTel and in interneuron populations in the postnatal neocortex. We previously described in detail Met transcript and protein expression in the developing telencephalon from late fetal ages (E18.5) to adulthood [Judson et al., 2009]. In the forebrain, Met transcript expression is observed in the neocortex, hippocampus, amygdala and lateral septum, but not in the GE and striatum, throughout late prenatal and postnatal development. However, by E18.5, the majority of interneurons destined to populate the cortex and hippocampus have migrated from the subpallium [Anderson, Marin, Horn, Jennings, & Rubenstein, 2001; Pleasure et al., 2000]. Thus, we focused our current analysis of Met expression to an earlier fetal period during which cortical interneurons are being generated and beginning their migration to the overlying dorsal pallium. We did not detect Met transcript expression in the developing forebrain at E12.5 and E14.5 (Fig. 3A), although expression already is abundant in peripheral and brainstem structures, as well as the spinal cord, at this time in sections from the same embryos (Fig. 3B). By E16.5, expression of the transcript in the lateral cortex and subplate is relatively high, but expression in other telencephalic structures, including the GE and mantle zone of the VTel, containing postmitotic neurons, is notably absent (Fig. 3C–E). Together with our previous observations, these data indicate that Met is not expressed by proliferating progenitor cells or postmitotic neurons arising from the GE during the period of migration out of the VTel.

thumbnail image

Figure 3. Darkfield photomicrographs of coronal sections from wild type mice after processing for autoradiography and emulsion dipping. At E14.5 (A) Met transcript can be detected in the olfactory epithelium (oe), but is absent from the telencephalon (tel). Even as early as E12.5 (B) a prominent Met signal can be observed in multiple peripheral structures, including the ventral horn of the spinal cord (sc) and developing limb muscle (lm). By E16.5, Met transcript can be readily observed in the cortical plate (CP) at both rostral (C) and caudal (D) levels, but is absent from the ventral telencephalon (VTel) at both levels. At more caudal levels, the signal is particularly intense in the cortical plate laterally, while the subplate (SP) is more prominent medially. The boxed area in D is shown at higher magnification in E. Scale bar = 1 mm (A–D), 250 µm (E).

Download figure to PowerPoint

Our previous analysis of uPAR−/− mice indicated that, when maintained on the congenic C57BL/6 strain, there are normal numbers of interneurons in the neocortex and hippocampus at birth [Eagleson et al., 2005], but statistically significant reductions in immunodetectable cells later postnatally. These data are consistent with the notion that maturation, rather than proliferation or migration, of interneurons may be impacted in the uPAR−/− mouse. During the period of interneuron maturation that occurs over the first 3 postnatal weeks in the mouse, Met transcript and protein expression increases dramatically in the neocortex and hippocampus [Judson et al., 2009]. To explore the possibility that interneurons are included in the cortical Met-expressing population, we performed double-label in situ hybridization analyses using a variety of cell-type specific markers together with Met. Although we could reliably detect Met transcript during the early postnatal period (Fig. 4), none of these cells co-expressed Met with the interneuron marker Gad1 (Fig. 4A). In contrast, co-expression of Met and VGlut1 reveals that the majority of glutamatergic projection neurons express this receptor (Fig. 4B), consistent with our recent report of Met protein expression in the axons of these cells [Judson et al., 2009]. Finally, Met expression has previously been observed in glial cells after brain trauma or in vitro [Kitamura et al., 2007; Lalive et al., 2005; Nagayama et al., 2004; Shimazaki et al., 2003]. Expression in this population under normal physiological conditions during development has not been determined. We found that none of the cells co-express Met and Plp1 or Met and Slc1a2 (Fig. 4CandD). Thus, taken together, our current and previous analyses demonstrate that cortical projection neurons, but not interneurons or forebrain glia, express Met. These data are consistent with our anatomical analyses showing normal interneuron development in the Metfx/fx/Dlx5/6cre mouse.

thumbnail image

Figure 4. Confocal photomicrographs of coronal sections from the medial frontal cortex of postnatal day 14 wild type mice after processing for fluorescent in situ hybridization, illustrating double-labeling for Met and Gad1 (A–C), Met and Plp1 (D–F), Met and Slc1a2 (G–I), or Met and VGlut1 (J–L). Full arrows indicate cells with only a single label of Met, Gad1, Plp1, or Slc1a2. Arrowheads indicate cells that co-express Met and VGlut1 (L). While there is double labeling of Met and VGlut1, Met is not co-localized with Gad1, Plp1, or Slc1a2. Accumulated punctate labeling over cellular profiles is readily distinguishable from more diffuse background puncta, which is similar to background labeling using the sense strand. Scale bar in panel J represents 50 µm.

Download figure to PowerPoint

Expression of the Met Receptor is Upregulated in VTel Cells In Vitro

Based on our observations in the Metfx/fx/Dlx5/6cre mouse and the absence of Met expression in cortical interneurons, we decided to re-assess our original in vitro studies. There is now evidence that expression of the Met receptor is upregulated under a variety of environmental challenges, including hypoxia and following injury, in both the central nervous system and in peripheral organs [Hara et al., 2006a; Hayashi et al., 2005; Joannidis, Spokes, Nakamura, Faletto, & Cantley, 1994; Kitamura et al., 2007; Nakamura et al., 2000; Okura et al., 1999; Pennacchietti et al., 2003; Rabkin et al., 2001]. We reasoned that environmental conditions conducive to inducing Met expression might occur as the VTel explants are being established. We therefore compared relative levels of Met expression under three conditions: VTel dissected at E12.5 and E14.5 and immediately snap frozen for subsequent immunoblot analysis, and those dissected at E12.5 and grown as explants for 2 days in vitro prior to harvesting and freezing. There was a significant effect of the source of VTel tissue on the level of Met protein expression detected by Western blot (F(1, 14) = 53.93, P<0.05; Fig. 5). There was a 1.8-fold increase in Met protein expression in the VTel between E12.5 and E14.5 in vivo (P<0.05, df = 10). It should be noted that the level of Met protein expression in the embryonic VTel is much less than observed at the peak of Met expression during the early postnatal period (Fig. 5). Moreover, as there is no detectable Met transcript expression at these ages, Met protein detection likely reflects early arrival of axons, arising from Met-expressing populations from the dorsal pallium that project through the anterior commissure and internal capsule to the contralateral cortex and ipsilateral thalamus and brainstem. In contrast, there is a 4.0-fold increase in Met expression in VTel explants maintained for two days in vitro compared to the E12.5 VTel (P<0.05, df = 10). As there are no contributions from axons arising from the Met-expressing dorsal pallium in the explants, this increase in Met expression indicates that subpallial cells are capable of expressing Met in vitro under these culture conditions.

thumbnail image

Figure 5. Western blotting analysis of Met protein expression in the ventral telencephalon in wild type mice. Lane 1, E12.5; Lane 2, E14.5; Lane 3, E12.5+2 days in vitro (DIV); Lane 4, P7. Protein levels are low embryonically in vivo, although there is an increase in levels between E12.5 and E14.5. A more robust increase is observed when explants of E12.5 ventral telencephalon are maintained for 2 DIV. None-the-less, this expression is modest compared to that observed during the peak of Met expression at P7. A one-way ANOVA reveals a significant effect of the source of the tissue on the relative level of Met expression (P<0.05).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The present study reveals that two ASD risk genes, MET and PLAUR, have distinct effects on cortical development, with MET impacting the development of excitatory projection neurons [Judson et al., 2009; Judson, Eagleson, Wang, & Levitt, 2010] and PLAUR influencing the maturation of inhibitory interneurons [Eagleson et al., 2005; Powell et al., 2003a]. ASD is a highly heritable disorder that presents with heterogeneity in both the core triad of symptoms and co-occurring medical conditions [Geschwind, 2009; Jyonouchi, Geng, Ruby, & Zimmerman-Bier, 2005; Levitt & Campbell, 2009; Tuchman & Rapin, 2002; Valicenti-McDermott et al., 2006]. There has been remarkable progress in identifying genes that increase the risk of developing ASD [Abrahams & Geschwind, 2008; Bill & Geschwind, 2009; El-Fishawy & State, 2010], but identifying the link between genetic risk and underlying biological etiologies of the disorder has proven more elusive. Even less attention has been paid to understanding this relationship in the context of ASD heterogeneity. Converging evidence from clinical and animal studies indicate that aberrant formation of neural circuits during development may represent a common feature of developmental disorders, including ASD [Courchesne & Pierce, 2005; Frith, 2004; Geschwind & Levitt, 2007; Just, Cherkassky, Keller, Kana, & Minshew, 2007; Minshew & Williams, 2007]. Heterogeneity would then arise, in part, as a consequence of distinct genetic etiologies impacting circuit development in the brain differentially, by influencing this process at distinct temporal windows, by impacting distinct components of the circuit, or both. The present data are consistent with this hypothesis.

Met Expression in Cortical Development

Met is a receptor tyrosine kinase with known roles in multiple cellular processes, including proliferation, migration and survival (for example, [Beilmann et al., 2000; Birchmeier et al., 2003; Bladt et al., 1995; Ebens et al., 1996; Giacobini et al., 2007; Okunishi et al., 2005]). In the forebrain, cell culture studies pointed to a key role for Met signaling in the migration of cortical interneurons from the GE to the overlying pallium [Powell et al., 2001]. It was somewhat surprising, therefore, when a comprehensive analysis of Met protein and transcript expression during late embryonic and postnatal development in the rodent revealed patterns consistent with Met being expressed specifically in neocortical and hippocampal (CA1) projection neurons, with preferential localization of the protein to the axons, during the peak period of axon outgrowth and synapse formation [Judson et al., 2009]. In contrast to the intense expression observed in the cerebral cortex, Met transcript could not be detected in the GE, the primary source of neocortical and hippocampal interneurons [Anderson et al., 2001; Anderson, Eisenstat, Shi, & Rubenstein, 1997; Lavdas, Grigoriou, Pachnis, & Parnavelas, 1999; Pleasure et al., 2000; Sussel, Marin, Kimura, & Rubenstein, 1999; Wichterle, Garcia-Verdugo, Herrera, & Alvarez-Buylla, 1999], nor in the developing mantle zone of the striatum at any time [Judson et al., 2009]. The current study extends these findings, demonstrating that even during earlier stages of embryonic development, when interneurons are first being generated and migrating out of the GE, Met transcript is absent in the GE. The lack of detection is not a technical issue, as other embryonic structures, such as the spinal cord, express detectable levels of Met in tissue from the same embryos. Furthermore, co-labeling analyses confirmed that, during the period when Met expression peaks in the neocortex, the transcript is expressed solely in glutamatergic projection neurons, but not GABAergic interneurons or glia. The data from this study complement our previous observations in the Metfx/fx/Emxcre mice. In these mice, Met is deleted from all progenitor cells arising from the dorsal pallium, and Met protein expression can no longer be detected in subcortical and cortico-cortical projecting axons [Judson et al., 2009], suggesting that the vast majority of cortical projection neurons express Met during the period of peak expression.

Reconciling the Cellular Targets of Met Signaling

In contrast to our initial conclusions concerning a role for Met in interneuron development, the expression patterns of the Met receptor described above suggest that disruption in Met signaling in vivo would impact the development of cortical projection neurons rather than interneurons. Animal models in which Met signaling is compromised allow us to examine this prediction directly. Because deletion of either Met or HGF is embryonic lethal [Bladt et al., 1995; Uehara et al., 1995], we employed a conditional deletion strategy using the loxp/cre approach. As reported here, mice in which Met is deleted from all postmitotic cells arising from the GE (Metfx/fx/Dlx5/6cre mice) have comparable interneuron numbers in the neocortex and hippocampus as wild types, indicating that even if there were low levels of Met expression in VTel neurons, the generation, migration and survival of this cell population is not compromised in the absence of Met signaling. This is consistent with a previous report that focused on interneuron development in the hippocampus of the same mouse line [Martins et al., 2007]. In that report, however, a reduction in the number of cells expressing PV was observed in the CA3 region of the mutant hippocampus. In contrast, the present study demonstrates normal numbers of PV-positive cells in the Metfx/fx/Dlx5/6cre hippocampus, as well as in all neocortical regions examined. The reason for this discrepancy is not clear, but it should be noted that the data reported here are consistent with the absence of Met expression in interneurons at any stage of development. Parallel analyses in another mouse model of compromised Met signaling, in which Met is deleted from progenitor cells arising from the dorsal pallium (Metfx/fx/Emxcre mice), revealed altered dendritic and spine development in layer II–III and V pyramidal neurons [Judson et al., 2010]. Combined with preliminary electrophysiological analysis of altered excitatory input onto pyramidal cells (S. Qiu, C. Anderson, P. Levitt, G. Shepherd, unpublished observations), the phenotypes resulting from deficient Met signaling in the neocortex are consistent with altered development of excitatory circuits.

Our original studies demonstrated that cells arising from the GE initiate a motogenic response to HGF in vitro [Powell et al., 2001], even though Met transcript cannot be detected in this population in vivo. Similarly, process outgrowth from cultured dorsal thalamic neurons, which also do not express Met transcript in vivo [Judson et al., 2009], is altered in the presence of HGF [Powell, Muhlfriedel, Bolz, & Levitt, 2003b]. Although Met protein can be detected in these structures in vivo, this is due to subcortical projections of Met-expressing cells residing in the dorsal pallium [Judson et al., 2009]. Thus, it appears that tissue culture conditions provide a permissible environment for ectopic expression of the Met receptor in cells that normally do not have either the transcript or protein during development. The detection of Met protein in explants of GE after 2 days in vitro by Western blot (present study) and immunocytochemically [Powell et al., 2001], even in the absence of cortical axons, is consistent with this proposal and addresses the apparent discrepancies between our anatomical observations in vivo and the conclusions drawn from our in vitro data.

It is now evident that Met expression can be readily induced or upregulated in multiple cell types under a variety of environmental conditions. For example, Met expression is upregulated in the brain following a hypoxic event, such as occurs during an ischemic insult [Nagayama et al., 2004], or in response to injury [Kitamura et al., 2007; Okura et al., 1999]. Additional evidence for hypoxia/ischemia inducing Met expression comes from studies in peripheral tissues, including trophoblasts [Hayashi et al., 2005], cardiac myocytes [Nakamura et al., 2000], kidney [Rabkin et al., 2001], mesenchymal stem cells [Rosova, Dao, Capoccia, Link, & Nolta, 2008] and endothelial cells [Colombo, Menicucci, McGuire, & Das, 2007], and in cancer, where hypoxia increases the metastatic potential of many tumors by upregulating Met expression [Eckerich et al., 2007; Hara et al., 2006b; Ide et al., 2006, 2007; Koga, Tsutsumi, & Neckers, 2007; Orzechowski, 2007; Pennacchietti et al., 2003; Scarpino et al., 2004]. Thus, although we suggest that Met does not play a direct role in interneuron development under normal physiological conditions in vivo, Met signaling may none-the-less impact this population should environmental stressors, which could induce aberrant Met expression, be encountered. Such conditions may occur in utero or during parturition, leading to an atypical developmental trajectory of cells that do not normally express this receptor. While speculative, the combination of prenatal or perinatal environmental factors that are reported to increase ASD risk [Glasson et al., 2004; Kinney, Munir, Crowley, & Miller, 2008; Kolevzon, Gross, & Reichenberg, 2007; Larsson et al., 2005; Mann, McDermott, Bao, Hardin, & Gregg, 2010; van Handel, Swaab, de Vries, & Jongmans, 2007; Wilkerson, Volpe, Dean, & Titus, 2002], combined with having the functional MET risk allele, is a testable gene×environment pathogenic mechanism that would alter the balance of MET expression in different cell populations relevant to ASD pathogenesis.

uPAR Signaling

Our initial hypotheses of compromised Met signaling in the uPAR−/− mouse were based on the requirement of activation of pro-HGF by serine proteases for biological activity [Kirchhofer et al., 2004; Lokker et al., 1992]. It had been proposed, based on in vitro assays, that uPA is an important activator of HGF, particularly when it is bound to its receptor, uPAR [Blasi, 1993; Mars et al., 1993; Naldini et al., 1992]. However, a recent study provides evidence that under physiologically relevant conditions, uPA is not a significant activator of pro-HGF [Owen et al., 2010]; under the same conditions, other candidate serine proteases, including matriptase and hepsin, are able to activate pro-HGF efficiently. This suggests that Met signaling may not be compromised in uPAR−/− mice. Rather, we propose that uPAR signaling may directly impact interneuron development. Several studies have demonstrated roles for uPA/uPAR signaling independent of uPA's protease activity. Upon binding of uPA, uPAR interacts with other proteins, including integrins and G-protein coupled receptors, to modulate cell migration, adhesion, proliferation and differentiation (reviewed in [Binder, Mihaly, & Prager, 2007; Tang & Wei, 2008]). Given our proposal that the interneuron deficits observed in uPAR−/− mice are not a consequence of reduced Met signaling, a recent report that increasing HGF levels in the uPAR−/− mouse brain, starting in the postnatal period, restores normal numbers of PV-positive cells in the adult orbitofrontal cortex [Bissonette, Bae, Suresh, Jaffe, & Powell, 2010] at first appears contradictory, but can be reconciled. Specifically, because the HGF receptor, Met, is expressed in projection neurons and not interneurons, we suggest that the restorative effect of HGF supplementation on interneurons is indirect, likely through a direct influence on projection neuron development. The importance of proper projection neuron development to interneuron maturation, particularly with respect to PV expression, has been demonstrated. In this context, the availability of BDNF, provided by projection neurons, is a key modulator of PV expression by cortical interneurons [Berghuis et al., 2004; Cellerino, Maffei, & Domenici, 1996; Gorba & Wahle, 1999; Huang et al., 1999; Patz, Grabert, Gorba, Wirth, & Wahle, 2004].

Several authors have postulated that an altered balance between excitation and inhibition contributes to the etiology of ASD [Casanova, Buxhoeveden, & Gomez, 2003; Levitt, Eagleson, & Powell, 2004; Rubenstein, 2010; Rubenstein & Merzenich, 2003; Vaccarino, Grigorenko, Smith, & Stevens, 2009]. Such an imbalance could arise from an altered developmental trajectory in either of the two major neuron populations in the neocortex, the glutamatergic projection neurons or the GABAergic interneurons, or both. The differential cellular targets of uPAR and Met in the developing forebrain provide a plausible biological link between genetic vulnerability and variability in key developmental processes that may none-the-less lead to a final common path in ASD etiology. Moreover, there is a significant gene–gene interaction between MET and PLAUR with respect to ASD risk [Campbell et al., 2008]. This may reflect a greater compromised ability in those individuals with an “ASD polymorphism” in both genes to compensate adequately for disrupting both excitatory and inhibitory developmental processes. Human genetic studies focused on ASD subpopulations stratified by endophenotype will inform future development of even more sophisticated animal models, thus allowing for the exploration of further links between genetic vulnerability and ASD heterogeneity.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Deborah Gregory, Lisa McFadyen-Ketchum, Donte Smith and Andrew McFadyen-Ketchum for excellent technical assistance. We also thank Dr. Matthew Judson for helpful comments on an early draft of the article. This work was supported by National Institutes of Health/National Institute of Mental Health; Grant numbers: R01 MH067842 (P.L.) and F30 MH083474 (M.Y.B.)

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abercrombie, M. (1946). Estimation of nuclear population from microtome sections. Anatomical Record, 94, 239247.
  • Abrahams, B.S., & Geschwind, D.H. (2008). Advances in autism genetics: On the threshold of a new neurobiology. Nature Reviews Genetics, 9, 341355.
  • Anderson, S.A., Eisenstat, D.D., Shi, L., & Rubenstein, J.L. (1997). Interneuron migration from basal forebrain to neocortex: Dependence on Dlx genes. Science, 278, 474476.
  • Anderson, S.A., Marin, O., Horn, C., Jennings, K., & Rubenstein, J.L. (2001). Distinct cortical migrations from the medial and lateral ganglionic eminences. Development, 128, 353363.
  • Bahi, A., Boyer, F., Kafri, T., & Dreyer, J.L. (2006). Silencing urokinase in the ventral tegmental area in vivo induces changes in cocaine-induced hyperlocomotion. Journal of Neurochemistry, 98, 16191631.
  • Beilmann, M., Vande Woude, G.F., Dienes, H.P., & Schirmacher, P. (2000). Hepatocyte growth factor-stimulated invasiveness of monocytes. Blood, 95, 39643969.
  • Berghuis, P., Dobszay, M.B., Sousa, K.M., Schulte, G., Mager, P.P., et al. (2004). Brain-derived neurotrophic factor controls functional differentiation and microcircuit formation of selectively isolated fast-spiking GABAergic interneurons. European Journal of Neuroscience, 20, 12901306.
  • Bill, B.R., & Geschwind, D.H. (2009). Genetic advances in autism: Heterogeneity and convergence on shared pathways. Current Opinion in Genetics & Development, 19, 271278.
  • Binder, B.R., Mihaly, J., & Prager, G.W. (2007). uPAR-uPA-PAI-1 interactions and signaling: A vascular biologist's view. Thrombosis & Haemostasis, 97, 336342.
  • Birchmeier, C., Birchmeier, W., Gherardi, E., & Vande Woude, G.F. (2003). Met, metastasis, motility and more. Nature Reviews Molecular Cell Biology, 4, 915925.
  • Bissonette, G.B., Bae, M.H., Suresh, T., Jaffe, D.E., & Powell, E.M. (2010). Astrocyte-mediated hepatocyte growth factor/scatter factor supplementation restores GABAergic interneurons and corrects reversal learning deficits in mice. Journal of Neuroscience, 30, 29182923.
  • Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., & Birchmeier, C. (1995). Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature, 376, 768771.
  • Blasi, F. (1993). Urokinase and urokinase receptor: A paracrine/autocrine system regulating cell migration and invasiveness. Bioessays, 15, 105111.
  • Campbell, D.B., Sutcliffe, J.S., Ebert, P.J., Militerni, R., Bravaccio, C., et al. (2006). A genetic variant that disrupts MET transcription is associated with autism. Proceedings of the National Academy of Sciences, USA, 103, 1683416839.
  • Campbell, D.B., D'Oronzio, R., Garbett, K., Ebert, P.J., Mirnics, K., et al. (2007). Disruption of cerebral cortex MET signaling in autism spectrum disorder. Annals of Neurology, 62, 243250.
  • Campbell, D.B., Li, C., Sutcliffe, J.S., Persico, A.M., & Levitt, P. (2008). Genetic evidence implicating multiple genes in the MET receptor tyrosine kinase pathway in autism spectrum disorder. Autism Research, 1, 159168.
  • Casanova, M.F., Buxhoeveden, D., & Gomez, J. (2003). Disruption in the inhibitory architecture of the cell minicolumn: Implications for autisim. Neuroscientist, 9, 496507.
  • Cellerino, A., Maffei, L., & Domenici, L. (1996). The distribution of brain-derived neurotrophic factor and its receptor trkB in parvalbumin-containing neurons of the rat visual cortex. European Journal of Neuroscience, 8, 11901197.
  • Colombo, E.S., Menicucci, G., McGuire, P.G., & Das, A. (2007). Hepatocyte growth factor/scatter factor promotes retinal angiogenesis through increased urokinase expression. Investigative Ophthalmology & Visual Science, 48, 17931800.
  • Courchesne, E., & Pierce, K. (2005). Why the frontal cortex in autism might be talking only to itself: Local over-connectivity but long-distance disconnection. Current Opinion in Neurobiology, 15, 225230.
  • Del Bigio, M.R., Hosain, S., & Altumbabic, M. (1999). Localization of urokinase-type plasminogen activator, its receptor, and inhibitors in mouse forebrain during postnatal development. International Journal of Developmental Neuroscience, 17, 387399.
  • Dent, M.A., Sumi, Y., Morris, R.J., & Seeley, P.J. (1993). Urokinase-type plasminogen activator expression by neurons and oligodendrocytes during process outgrowth in developing rat brain. European Journal of Neuroscience, 5, 633647.
  • Eagleson, K.L., Bonnin, A., & Levitt, P. (2005). Region- and age-specific deficits in gamma-aminobutyric acidergic neuron development in the telencephalon of the uPAR(−/−) mouse. Journal of Comparative Neurology, 489, 449466.
  • Eagleson, K.L., Gravielle, M.C., Schlueter McFadyen-Ketchum, L.J., Russek, S.J., Farb, D.H., & Levitt, P. (2010). Genetic disruption of the autism spectrum disorder risk gene PLAUR induces GABAA receptor subunit changes. Neuroscience, 168, 797810.
  • Ebens, A., Brose, K., Leonardo, E.D., Hanson, Jr., M.G., Bladt, F., et al. (1996). Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons. Neuron, 17, 11571172.
  • Eckerich, C., Zapf, S., Fillbrandt, R., Loges, S., Westphal, M., & Lamszus, K. (2007). Hypoxia can induce c-Met expression in glioma cells and enhance SF/HGF-induced cell migration. International Journal of Cancer, 121, 276283.
  • El-Fishawy, P., & State, M.W. (2010). The genetics of autism: Key issues, recent findings, and clinical implications. The Psychiatric Clinics of North America, 33, 83105.
  • Frith, C. (2004). Is autism a disconnection disorder? Lancet Neurology, 3, 577.
  • Geschwind, D.H. (2009). Advances in autism. Annual Review of Medicine, 60, 367380.
  • Geschwind, D.H., & Levitt, P. (2007). Autism spectrum disorders: Developmental disconnection syndromes. Current Opinions in Neurobiology, 17, 103111.
  • Giacobini, P., Messina, A., Wray, S., Giampietro, C., Crepaldi, T., et al. (2007). Hepatocyte growth factor acts as a motogen and guidance signal for gonadotropin hormone-releasing hormone-1 neuronal migration. Journal of Neuroscience, 27, 431445.
  • Glasson, E.J., Bower, C., Petterson, B., de Klerk, N., Chaney, G., & Hallmayer, J.F. (2004). Perinatal factors and the development of autism: A population study. Archives of General Psychiatry, 61, 618627.
  • Gorba, T., & Wahle, P. (1999). Expression of TrkB and TrkC but not BDNF mRNA in neurochemically identified interneurons in rat visual cortex in vivo and in organotypic cultures. European Journal of Neuroscience, 11, 11791190.
  • Hara, S., Nakashiro, K., Klosek, S.K., Ishikawa, T., Shintani, S., & Hamakawa, H. (2006a). Hypoxia enhances c-Met/HGF receptor expression and signaling by activating HIF-1alpha in human salivary gland cancer cells. Oral Oncology, 42, 593598.
  • Hara, S., Nakashiro, K., Klosek, S.K., Ishikawa, T., Shintani, S., & Hamakawa, H. (2006b). Hypoxia enhances c-Met/HGF receptor expression and signaling by activating HIF-1alpha in human salivary gland cancer cells. Oral Oncolology, 42, 593598.
  • Hayashi, M., Sakata, M., Takeda, T., Tahara, M., Yamamoto, T., et al. (2005). Up-regulation of c-met protooncogene product expression through hypoxia-inducible factor-1alpha is involved in trophoblast invasion under low-oxygen tension. Endocrinology, 146, 46824689.
  • Huang, Z.J., Kirkwood, A., Pizzorusso, T., Porciatti, V., Morales, B., et al. (1999). BDNF regulates the maturation of inhibition and the critical period of plasticity in mouse visual cortex. Cell, 98, 739755.
  • Huh, C.G., Factor, V.M., Sanchez, A., Uchida, K., Conner, E.A., & Thorgeirsson, S.S. (2004). Hepatocyte growth factor/c-met signaling pathway is required for efficient liver regeneration and repair. Proceedings National Academy of Sciences, USA, 101, 44774482.
  • Ide, T., Kitajima, Y., Miyoshi, A., Ohtsuka, T., Mitsuno, M., et al. (2006). Tumor-stromal cell interaction under hypoxia increases the invasiveness of pancreatic cancer cells through the hepatocyte growth factor/c-Met pathway. International Journal of Cancer, 119, 27502759.
  • Ide, T., Kitajima, Y., Miyoshi, A., Ohtsuka, T., Mitsuno, M., et al. (2007). The hypoxic environment in tumor-stromal cells accelerates pancreatic cancer progression via the activation of paracrine hepatocyte growth factor/c-Met signaling. Annals of Surgical Oncology, 14, 26002607.
  • Jackson, P.B., Boccuto, L., Skinner, C., Collins, J.S., Neri, G., et al. (2009). Further evidence that the rs1858830 C variant in the promoter region of the MET gene is associated with autistic disorder. Autism Research, 2, 232236.
  • Joannidis, M., Spokes, K., Nakamura, T., Faletto, D., & Cantley, L.G. (1994). Regional expression of hepatocyte growth factor/c-met in experimental renal hypertrophy and hyperplasia. American Journal of Physiology, 267, F231F236.
  • Judson, M.C., Bergman, M.Y., Campbell, D.B., Eagleson, K.L., & Levitt, P. (2009). Dynamic gene and protein expression patterns of the autism-associated met receptor tyrosine kinase in the developing mouse forebrain. Journal of Comparative Neurology, 513, 511531.
  • Judson, M.C., Eagleson, K.L., Wang, L., & Levitt, P. (2010). Evidence of cell-nonautonomous changes in dendrite and dendritic spine morphology in the Met-signaling deficient mouse forebrain. Journal of Comparative Neurology, 518, 44634478.
  • Just, M.A., Cherkassky, V.L., Keller, T.A., Kana, R.K., & Minshew, N.J. (2007). Functional and anatomical cortical underconnectivity in autism: Evidence from an FMRI study of an executive function task and corpus callosum morphometry. Cerebral Cortex, 17, 951961.
  • Jyonouchi, H., Geng, L., Ruby, A., & Zimmerman-Bier, B. (2005). Dysregulated innate immune responses in young children with autism spectrum disorders: Their relationship to gastrointestinal symptoms and dietary intervention. Neuropsychobiology, 51, 7785.
  • Kinney, D.K., Munir, K.M., Crowley, D.J., & Miller, A.M. (2008). Prenatal stress and risk for autism. Neuroscience & Biobehavioral Reviews, 32, 15191532.
  • Kirchhofer, D., Yao, X., Peek, M., Eigenbrot, C., Lipari, M.T., et al. (2004). Structural and functional basis of the serine protease-like hepatocyte growth factor beta-chain in Met binding and signaling. Journal of Biological Chemistry, 279, 3991539924.
  • Kitamura, K., Iwanami, A., Nakamura, M., Yamane, J., Watanabe, K., et al. (2007). Hepatocyte growth factor promotes endogenous repair and functional recovery after spinal cord injury. Journal of Neuroscience Research, 85, 23322342.
  • Koga, F., Tsutsumi, S., & Neckers, L.M. (2007). Low dose geldanamycin inhibits hepatocyte growth factor and hypoxia-stimulated invasion of cancer cells. Cell Cycle, 6, 13931402.
  • Kolevzon, A., Gross, R., & Reichenberg, A. (2007). Prenatal and perinatal risk factors for autism: A review and integration of findings. Archives of Pediatric & Adolescent Medicine, 161, 326333.
  • Lahtinen, L., Huusko, N., Myohanen, H., Lehtivarjo, A.K., Pellinen, R., et al. (2009). Expression of urokinase-type plasminogen activator receptor is increased during epileptogenesis in the rat hippocampus. Neuroscience, 163, 316328.
  • Lalive, P.H., Paglinawan, R., Biollaz, G., Kappos, E.A., Leone, D.P., et al. (2005). TGF-beta-treated microglia induce oligodendrocyte precursor cell chemotaxis through the HGF-c-Met pathway. European Journal of Immunology, 35, 727737.
  • Larsson, H.J., Eaton, W.W., Madsen, K.M., Vestergaard, M., Olesen, A.V., et al. (2005). Risk factors for autism: Perinatal factors, parental psychiatric history, and socioeconomic status. American Journal of Epidemiology, 161, 916925; discussion 926–918.
  • Lavdas, A.A., Grigoriou, M., Pachnis, V., & Parnavelas, J.G. (1999). The medial ganglionic eminence gives rise to a population of early neurons in the developing cerebral cortex. Journal of Neuroscience, 19, 78817888.
  • Levitt, P., & Campbell, D.B. (2009). The genetic and neurobiologic compass points toward common signaling dysfunctions in autism spectrum disorders. Journal of Clinical Investigations, 119, 747754.
  • Levitt, P., Eagleson, K.L., & Powell, E.M. (2004). Regulation of neocortical interneuron development and the implications for neurodevelopmental disorders. Trends in Neuroscience, 27, 400406.
  • Lokker, N.A., Mark, M.R., Luis, E.A., Bennett, G.L., Robbins, K.A., et al. (1992). Structure-function analysis of hepatocyte growth factor: Identification of variants that lack mitogenic activity yet retain high affinity receptor binding. European Molecular Biology Organization Journal, 11, 25032510.
  • Longati, P., Bardelli, A., Ponzetto, C., Naldini, L., & Comoglio, P.M. (1994). Tyrosines1234-1235 are critical for activation of the tyrosine kinase encoded by the MET proto-oncogene (HGF receptor). Oncogene, 9, 4957.
  • Mann, J.R., McDermott, S., Bao, H., Hardin, J., & Gregg, A. (2010). Pre-eclampsia, birth weight, and autism spectrum disorders. Journal of Autism and Developmental Disorders, 40, 548554.
  • Mars, W.M., Zarnegar, R., & Michalopoulos, G.K. (1993). Activation of hepatocyte growth factor by the plasminogen activators uPA and tPA. American Journal of Pathology, 143, 949958.
  • Marshall, C.R., Noor, A., Vincent, J.B., Lionel, A.C., Feuk, L., et al. (2008). Structural variation of chromosomes in autism spectrum disorder. American Journal of Human Genetics, 82, 477488.
  • Martins, G.J., Plachez, C., & Powell, E.M. (2007). Loss of embryonic MET signaling alters profiles of hippocampal interneurons. Developmental Neuroscience, 29, 143158.
  • Masos, T., & Miskin, R. (1996). Localization of urokinase-type plasminogen activator mRNA in the adult mouse brain. Molecular Brain Research, 35, 139148.
  • Meiri, N., Masos, T., Rosenblum, K., Miskin, R., & Dudai, Y. (1994). Overexpression of urokinase-type plasminogen activator in transgenic mice is correlated with impaired learning. Proceedings National Academy of Sciences, USA, 91, 31963200.
  • Minshew, N.J., & Williams, D.L. (2007). The new neurobiology of autism: Cortex, connectivity, and neuronal organization. Archives of Neurology, 64, 945950.
  • Nagayama, T., Nagayama, M., Kohara, S., Kamiguchi, H., Shibuya, M., et al. (2004). Post-ischemic delayed expression of hepatocyte growth factor and c-Met in mouse brain following focal cerebral ischemia. Brain Research, 999, 155166.
  • Nakamura, T., Mizuno, S., Matsumoto, K., Sawa, Y., Matsuda, H., & Nakamura, T. (2000). Myocardial protection from ischemia/reperfusion injury by endogenous and exogenous HGF. Journal of Clinical Investigations, 106, 15111519.
  • Naldini, L., Tamagnone, L., Vigna, E., Sachs, M., Hartmann, G., et al. (1992). Extracellular proteolytic cleavage by urokinase is required for activation of hepatocyte growth factor/scatter factor. European Molecular Biology Organization Journal, 11, 48254833.
  • Okunishi, K., Dohi, M., Nakagome, K., Tanaka, R., Mizuno, S., et al. (2005). A novel role of hepatocyte growth factor as an immune regulator through suppressing dendritic cell function. Journal of Immunology, 175, 47454753.
  • Okura, Y., Arimoto, H., Tanuma, N., Matsumoto, K., Nakamura, T., et al. (1999). Analysis of neurotrophic effects of hepatocyte growth factor in the adult hypoglossal nerve axotomy model. European Journal of Neuroscience, 11, 41394144.
  • Orzechowski, A. (2007). Possible implications of redox-sensitive tumour cell transformation; lessons from cell culture studies. Polish Journal of Veterinary Sciences, 10, 123126.
  • Owen, K.A., Qiu, D., Alves, J., Schumacher, A.M., Kilpatrick, L.M., et al. (2010). Pericellular activation of hepatocyte growth factor by the transmembrane serine proteases matriptase and hepsin, but not by the membrane-associated protease uPA. Biochemistry Journal, 426, 219228.
  • Patz, S., Grabert, J., Gorba, T., Wirth, M.J., & Wahle, P. (2004). Parvalbumin expression in visual cortical interneurons depends on neuronal activity and TrkB ligands during an Early period of postnatal development. Cerebral Cortex, 14, 342351.
  • Pennacchietti, S., Michieli, P., Galluzzo, M., Mazzone, M., Giordano, S., & Comoglio, P.M. (2003). Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell, 3, 347361.
  • Pleasure, S.J., Anderson, S., Hevner, R., Bagri, A., Marin, O., et al. (2000). Cell migration from the ganglionic eminences is required for the development of hippocampal GABAergic interneurons. Neuron, 28, 727740.
  • Ponzetto, C., Bardelli, A., Zhen, Z., Maina, F., dalla Zonca, P., et al. (1994). A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter factor receptor family. Cell, 77, 261271.
  • Powell, E.M., Mars, W.M., & Levitt, P. (2001). Hepatocyte growth factor/scatter factor is a motogen for interneurons migrating from the ventral to dorsal telencephalon. Neuron, 30, 7989.
  • Powell, E.M., Campbell, D.B., Stanwood, G.D., Davis, C., Noebels, J.L., & Levitt, P. (2003a). Genetic disruption of cortical interneuron development causes region- and GABA cell type-specific deficits, epilepsy, and behavioral dysfunction. Journal of Neuroscience, 23, 622631.
  • Powell, E.M., Muhlfriedel, S., Bolz, J., & Levitt, P. (2003b). Differential regulation of thalamic and cortical axonal growth by hepatocyte growth factor/scatter factor. Developmental Neuroscience, 25, 197206.
  • Rabkin, R., Fervenza, F., Tsao, T., Sibley, R., Friedlaender, M., et al. (2001). Hepatocyte growth factor receptor in acute tubular necrosis. Journal of the American Society of Nephrology, 12, 531540.
  • Rosova, I., Dao, M., Capoccia, B., Link, D., & Nolta, J.A. (2008). Hypoxic preconditioning results in increased motility and improved therapeutic potential of human mesenchymal stem cells. Stem Cells, 26, 21732182.
  • Rubenstein, J.L. (2010). Three hypotheses for developmental defects that may underlie some forms of autism spectrum disorder. Current Opinion in Neurology, 23, 118123.
  • Rubenstein, J.L., & Merzenich, M.M. (2003). Model of autism: Increased ratio of excitation/inhibition in key neural systems. Genes Brain & Behavior, 2, 255267.
  • Scarpino, S., Cancellario d'Alena, F., Di Napoli, A., Pasquini, A., Marzullo, A., & Ruco, L.P. (2004). Increased expression of Met protein is associated with up-regulation of hypoxia inducible factor-1 (HIF-1) in tumour cells in papillary carcinoma of the thyroid. Journal of Pathology, 202, 352358.
  • Shimazaki, K., Yoshida, K., Hirose, Y., Ishimori, H., Katayama, M., & Kawase, T. (2003). Cytokines regulate c-Met expression in cultured astrocytes. Brain Research, 962, 105110.
  • Sousa, I., Clark, T.G., Toma, C., Kobayashi, K., Choma, M., et al. (2009). MET and autism susceptibility: Family and case-control studies. European Journal of Human Genetics, 17, 749758.
  • Stefan, M., Koch, A., Mancini, A., Mohr, A., Weidner, K.M., et al. (2001). Src homology 2-containing inositol 5-phosphatase 1 binds to the multifunctional docking site of c-Met and potentiates hepatocyte growth factor-induced branching tubulogenesis. Journal of Biological Chemistry, 276, 30173023.
  • Stenman, J., Toresson, H., & Campbell, K. (2003). Identification of two distinct progenitor populations in the lateral ganglionic eminence: Implications for striatal and olfactory bulb neurogenesis. Journal of Neuroscience, 23, 167174.
  • Sussel, L., Marin, O., Kimura, S., & Rubenstein, J.L. (1999). Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: Evidence for a transformation of the pallidum into the striatum. Development, 126, 33593370.
  • Tang, C.H., & Wei, Y. (2008). The urokinase receptor and integrins in cancer progression. Cellular & Molecular Life Sciences, 65, 19161932.
  • Thompson, B.L., Stanwood, G.D., & Levitt, P. (2010). Specificity of prenatal cocaine exposure effects on cortical interneurons is independent from dopamine D1 receptor co-localization. Journal of Chemical Neuroanatomy, 39, 228234.
  • Tuchman, R., & Rapin, I. (2002). Epilepsy in autism. Lancet Neurology, 1, 352358.
  • Uehara, Y., Minowa, O., Mori, C., Shiota, K., Kuno, J., et al. (1995). Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor. Nature, 373, 702705.
  • Vaccarino, F.M., Grigorenko, E.L., Smith, K.M., & Stevens, H.E. (2009). Regulation of cerebral cortical size and neuron number by fibroblast growth factors: Implications for autism. Journal of Autism and Developmental Disorders, 39, 511520.
  • Valicenti-McDermott, M., McVicar, K., Rapin, I., Wershil, B.K., Cohen, H., & Shinnar, S. (2006). Frequency of gastrointestinal symptoms in children with autistic spectrum disorders and association with family history of autoimmune disease. Journal of Developmental and Behavioral Pediatrics, 27, S128136.
  • van Handel, M., Swaab, H., de Vries, L.S., & Jongmans, M.J. (2007). Long-term cognitive and behavioral consequences of neonatal encephalopathy following perinatal asphyxia: A review. European Journal of Pediatrics, 166, 645654.
  • Wichterle, H., Garcia-Verdugo, J.M., Herrera, D.G., & Alvarez-Buylla, A. (1999). Young neurons from medial ganglionic eminence disperse in adult and embryonic brain. Nature Neuroscience, 2, 461466.
  • Wilkerson, D.S., Volpe, A.G., Dean, R.S., & Titus, J.B. (2002). Perinatal complications as predictors of infantile autism. International Journal of Neuroscience, 112, 10851098.
  • Xiao, G.H., Jeffers, M., Bellacosa, A., Mitsuuchi, Y., Vande Woude, G.F., & Testa, J.R. (2001). Anti-apoptotic signaling by hepatocyte growth factor/Met via the phosphatidylinositol 3-kinase/Akt and mitogen-activated protein kinase pathways. Proceedings of the National Academy of Sciences, USA, 98, 247252.
  • Yoshida, S., & Shiosaka, S. (1999). Plasticity-related serine proteases in the brain (review). International Journal of Molecular Medicine, 3, 405409.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Additional Supporting information may be found in the online version of this article

FilenameFormatSizeDescription
aur_172_sm_SuppInfo.pdf85KSupplementary Materials

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.