Molecular tools for cryptic Candida species identification with applications in a clinical laboratory

Authors

  • Soledad Gamarra,

    1. Laboratorio de Micología y Diagnóstico Molecular, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, CONICET, Santa Fe (CP 3000), Argentina
    2. Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina
    Search for more papers by this author
  • Catiana Dudiuk,

    1. Laboratorio de Micología y Diagnóstico Molecular, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, CONICET, Santa Fe (CP 3000), Argentina
    Search for more papers by this author
  • Estefanía Mancilla,

    1. Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina
    Search for more papers by this author
  • María Verónica Vera Garate,

    1. Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina
    Search for more papers by this author
  • Sergio Guerrero,

    1. Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina
    2. Laboratorio de Bioquímica Microbiana, Instituto de Agrobiotecnología del Litoral, Universidad Nacional del Litoral, CONICET, Santa Fe (CP 3000), Argentina
    Search for more papers by this author
  • Guillermo Garcia-Effron

    Corresponding author
    1. Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina
    • Laboratorio de Micología y Diagnóstico Molecular, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, CONICET, Santa Fe (CP 3000), Argentina
    Search for more papers by this author

Address for correspondence to: Laboratorio de Micología y Diagnóstico Molecular, CONICET, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Ciudad Universitaria UNL (Ruta 168), C.C. 242-S3000ZAA, Santa Fe (Santa Fe), Argentina. E-mail: ggarcia@unl.edu.ar

Abstract

Candida spp. includes more than 160 species but only 20 species pose clinical problems. C. albicans and C. parapsilosis account for more than 75% of all the fungemias worldwide. In 1995 and 2005, one C. albicans and two C. parapsilosis-related species were described, respectively. Using phenotypic traits, the identification of these newly described species is inconclusive or impossible. Thus, molecular-based procedures are mandatory. In the proposed educational experiment we have adapted different basic molecular biology techniques designed to identify these species including PCR, multiplex PCR, PCR-based restriction endonuclease analysis and nuclear ribosomal RNA amplification. During the classes, students acquired the ability to search and align gene sequences, design primers, and use bioinformatics software. Also, in the performed experiments, fungal molecular taxonomy concepts were introduced and the obtained results demonstrated that classic identification (phenotypic) in some cases needs to be complemented with molecular-based techniques. As a conclusion we can state that we present an inexpensive and well accepted group of classes involving important concepts that can be recreated in any laboratory. © 2013 by The International Union of Biochemistry and Molecular Biology, 41(3):180–186, 2013

Introduction

Candida spp. is the most common fungal pathogen and the fourth most common cause of hospital acquired blood stream infections [1]. The genus Candida (Berkhout) includes more than 160 species but only 20 species pose clinical problems [2-5]. Out of these species C. albicans and C. parapsilosis account for more than 75% of all the fungemias worldwide. In 1995, Sullivan et al. described a C. albicans-related species named C. dubliniensis [6]. More recently, Tavanti et al. demonstrated that the three groups of C. parapsilosis were in fact three different related species (C. parapsilosis sensu stricto, C. orthopsilosis, and C. metapsilosis) [7]. Since then, an increased interest in studying the epidemiology of these newly described species has arisen based on the observed antifungal susceptibilities and virulence differences [6, 8-18].

Candida spp. identification has relied largely on phenotypical traits such as carbon auxotrophy and on microscopic examination (e.g., chlamydoconidia formation). However, the identification of these newly described species by phenotypic methods is frequently inconclusive or impossible. Thus, molecular-based procedures are mandatory for the taxonomic differentiation between C. albicans and C. dubliniensis and between C. parapsilosis sensu lato species [6, 7, 19].

The differentiation between C. albicans and C. dubliniensis using molecular techniques can be performed by different procedures [6, 20-24]. The one used by us in these classes is the method proposed by Donnelly et al. [20]. It is based on the sequence differences between the C. dubliniensis actin 1 gene (CdACT1) and the C. albicans actin 1 gene (CaACT1). The intron and exon sequences of these genes are 83.4 and 97.9% identical, respectively. These sequence differences reflect the differential evolutionary pressure that introns and exons suffer. The method is a multiplexed PCR that uses two pair of primers [20]. One of the pairs (DUBF/DUBR) is designed to hybridize the CdACT1 gene. The sense primer (DUBF) hybridizes one conserved region of both CaACT1 and CdACT1 exon I. On the other hand, the antisense primer (DUBR) was designed to hybridize specifically with the CdACT1 gene intron. Thus, using these primers, a 288 bp. PCR product should be obtained only if a C. dubliniensis DNA is used as a template. The second pair of oligonucleotides (RNAF/RNAR) primes a conserved sequence from fungal nuclear ribosomal RNA used for fungal molecular identification [25]. The PCR product obtained using these primers (of 610 bp. approximately for Candida spp.) serve as an internal positive control. When both primers pairs were combined in a single PCR reaction (multiplexing), all Candida spp. should yield the ≈610 bp. amplimer while only C. dubliniensis strains should produce both the ≈610 bp. and the 288 bp. bands.

Turning to the molecular differentiation between the C. parapsilosis sensu lato species, multiple molecular-based methodologies have been proposed [26-31]. In our teaching experiment we decided to use a two-step method that include a PCR amplification of a C. parapsilosis sensu lato FKS1 gene fragment followed by an EcoRI digestion [19]. The oligonucleotide pair REAF/REAR primes a conserved region of the C. parapsilosis sensu stricto FKS1 (CpFKS1), C. metapsilosis FKS1 (CmFKS1) and C. orthopsilosis FKS1 (CoFKS1) genes. The PCR amplification would produce a 1032 bp. fragment that yield none, one and two EcoRI restriction sites for CpFKS1, CmFKS1 and CoFKS1, respectively. These EcoRI digestions allow the differentiation between these species.

What is described herein are laboratory practice classes aimed to introduce the students to fungal molecular taxonomy and to show that classic fungal taxonomy (phenotypic identification) in some cases needs to be complemented with molecular-based.

Material and Methods

Classes and Students

The classes described here are named “molecular taxonomy” and are part of the courses “clinical mycology” and “molecular biology techniques applied to the study of fungi and parasites.” These courses are offered to the undergraduate students of Biochemistry and to the postgraduate students of the Biological Sciences PhD program, respectively. The Molecular taxonomy classes followed two classes named “classic yeast taxonomy” were students received the training for yeast phenotypic identification (e.g., carbon- and nitrogen-source assimilation techniques, germ tube induction, etc.). One week before the laboratory classes, a 2 days 3-h meetings were scheduled. In the first one, a concise explanation of the molecular-based methodologies for differentiation between C. albicans and C. dubliniensis and between the C. parapsilosis sensu lato species was given. Moreover, a description of the general aspect of the laboratory classes was imparted with emphasis in the methodologies to be used. Also, a brief reminder of how to use a freeware bioinformatics software named BioEdit Sequence Aligment Editor [32] and the GenBank nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore) was given. In the second 3-h meeting, the mentioned software and database were used by the students to obtain the ACT1 and FKS1 genes nucleotide sequences and to design oligonucleotides. We recommended students to read the paper by Donnelly et al. and by Garcia-Effron et al. were equivalent experiments were firstly described [19, 20]. Afterwards, with the assistance of laboratory teachers, the students compared their designed primers and the ones used by these authors and a discussion was stimulated [19, 20].

The experiments and result analysis were completed in a 2 days 5-h laboratory sessions. The students were asked to study a class guide which included a brief theoretical introduction and detailed protocols. Both classes started with a brief explanation of the main concept, the steps of the protocols to be used that day and how to analyze the results. Each laboratory group typically has 12 students which were divided into four groups (named group 1 to 4).

Experimental Procedures

The first laboratory class, each group received three Candida spp. strains grown overnight in YPD broth (2% yeast extract, 4% Bacto peptone, 4% dextrose). These strains were phenotypically identified by students in the “classic yeast taxonomy” classes as: C. albicans/C. dubliniensis, C. parapsilosis sensu lato or C. tropicalis strain (Table 1).

Table 1. Fungal strains and activities given to each laboratory group
 Group 1Group 2Group 3Group 4
  1. aDEK: DNA extraction Kit (Accuprep), PB: Phenol-based extraction procedure, EKD+P: DNA Extraction Kit (Accuprep) with a physical disruption step (with glass beads).
StrainsC. dubliniensis NCPF 3949C. albicans ATCC 90028C. albicans ATCC 90028C. dubliniensis NCPF 3949
 C. parapsilosis sensu stricto ATCC 22019C. parapsilosis sensu stricto ATCC 22019C. orthopsilosis ATCC 96139C. orthopsilosis ATCC 96139
 C. tropicalis ATCC 750C. metapsilosis ATCC 96144C. tropicalis ATCC 750C. metapsilosis
DNA extractionaDEKDEKDEK+PDEK+P
 PBPBPBPB

To stimulate a discussion about the different quantity and quality of the fungal genomic DNA obtained, each group extracted yeast genomic DNAs by different procedures. All the groups used a phenol-based DNA purification [33]. Moreover, groups 1 and 2 extracted the DNA using the Accuprep Genomic DNA Purification Kit (Bioneer-Genbiotech, Buenos Aires, Argentina) following manufacturer's instructions. On the other hand, groups 3 and 4 were asked to extract the yeast DNAs using the Accuprep kit with a previous glass beads disruption step (Table 1). Extracted genomic DNAs were subjected to electrophoresis and spectroscopy analysis. At the end of the first laboratory class, students set two PCR reactions per strain. The first (named PCR1) is the reaction proposed by Donelly et al. to differentiate C. dubliniensis from C. albicans [20]. The PCR2 is the PCR reaction used as the first step of the C. parapsilosis sensu lato species identification [19] (Table 2). Students were guided by a laboratory teacher to know how to program the thermocycler and they run the PCR reaction. After the PCR program finished, the PCR tubes where frozen until the next class. At the beginning of class 2, each group of students received one agarose gel ready to be seeded and the frozen PCR reactions were subjected to electrophoresis analysis. The groups would obtain the results showed in Table 2. A result's discussion was stimulated to help the students to select the PCR tube in which the 1-h EcoRI digestion would be performed. The selection was performed based in the PCR band size. The restriction enzyme digestion was performed following the manufacturer's instructions. Digestion products were analyzed by electrophoresis on agarose gels and results were discussed. At the end of the second laboratory class the students answered a questionnaire in which their evaluation was based and filled out two poll forms which evaluated the quality of the classes and teachers. Objectives of each of the questions are listed in Table 3.

Table 2. PCR reactions
StrainsPCR1aPCR2b
  1. aDesigned to differentiate C. albicans and C. dubliniensis [20].
  2. bUsed to identify C. parapsilosis sensu lato species [19].
  3. cSequence (5′ to 3′) [19, 20, 25].
  4. dY represent a degenerate sequence (C or T).
C. albicans+ (one band: ≈ 600 pb.)
C. dubliniensis+ (two bands: ≈ 600 pb. and a 288 pb.)
C. parapsilosis sensu lato+ (one band: ≈ 600 pb.)+ (one band: 1032 pb.)
C. tropicalis+ (one band: ≈ 600 pb.)
Oligonucleotide primerscDUBF: GTATTTGTCGTTCCCCTTTCREA-F: GATGACCAATTYTCAAGAGTd
 DUBR: GTGTTGTGTGCACTAACGTC 
 RNAF: GCATATCAATAAGCGGAGGAAAAG
 RNAR: GGTCCGTGTTTCAAGACGREA-R: GTCAACATAAATGTAGCATTCTAGAAATC
Table 3. Evaluation questions
  1. aStudents have to circle one of the options.
  2. bStudents rated teachers using a 1–5 scale (1: very good and 5: very poor)
A) Student's evaluation (Average points obtained, maximum of 10).
1) Name the limitations of the phenotypic methods designed to differentiate C. albicans from C. dubliniensis? (9.0)
2) Which tests are available to identify C. orthopsilosis and C. metapsilosis? (9.5)
3) Why did the C. albicans ACT1 and C. dubliniensis ACT1 exons share a higher homology than the observed in introns? (9.0)
4) How many bands do you expect to observe in an agarose gel after a multiplex PCR reaction using primers DUBF/DUBR and RNAF/RNAR and the DNA obtained from: C. dubliniensis, C. albicans, C. parapsilosis, Aspergillus fumigatus, Cryptococcus neoformans, Rhodotorula mucilaginosa and C. tropicalis? Why? (6.5)
Objectives:
Questions 1 and 2: Know if the students understand the limitations of classical and molecular identification procedures.
Question 3: Know if the students understand the concept of differential evolutionary pressure.
Questions 4: Know if the students understand the difference between specific (DUBF and DUBR/REAF and REAR) and panfungal (RNAF and RNAR) primers.
B) Laboratory class' evaluationa (Modified from [34, 35])
1) The laboratory equipment and material were:
Available Easy to find Hard to find Unavailable
2) The help received from the laboratory staff was:
Ample Limited Insufficient Minimal
3) The time allotted for the experiments was:
Too short Adequate Rather Long Long
4) The work load was:
Heavy Reasonable Light Very light
5) The lab work taught me some basic skils:
Agree Neutral Disagree
6) The purpose of each experiment was clear:
Agree Neutral Disagree
7) The lab class trained me to interpret the data:
Agree Neutral Disagree
8) In the experiments I was only following instructions (like a cooking recipe):
Agree Neutral Disagree
9) The lab manual was easy to follow and organised
Agree Neutral Disagree
10) I understand each step of the protocols.
Agree Neutral Disagree
11) I found easy to make deductions from my observations.
Agree Neutral Disagree
12) The class content makes me feel near the reality of a research laboratory.
Agree Neutral Disagree
13) The class motivate me to check the results.
Agree Neutral Disagree
14) Overall evaluation of the classes:
Very Good Good Satisfactory Poor Very Poor
C) Teacher's evaluationb:
1) Organization of the theoretical content ().
2) Clarity of the explanations ().
3) Teaching staff overall availability to answer questions ().
4) Stimulation for student's participation ().
D) Self-evaluationb.
1) Interest in the experiments.
2) Participation in the laboratory class.
3) Acquired knowledge:
•Theoretical:
•Practical:
•Psychomotor (pipetting, handling, etc.):
4) Overall score:

PCR Reactions

PCRs were carried out in a 50 μl volume containing 1X PCR buffer; 2 mM MgCl2; 250 μM each of dATP, dGTP, dCTP, and dTTP; 0.5 μM of each primers for PCR1 (DUBF, DUBR, RNAF, and RNAR) and 1 μM of each primers for PCR2 (REA-F and REA-R) (primer sequences are displayed in Table 2); 2.5 U of Taq DNA polymerase; and 25 to 50 ng of Candida spp. genomic DNA. PCR1 and PCR2 experiments were performed using a thermal cycler for one cycle of 5 min at 95°C followed by 35 cycles of 30 s at 95°C, 45 s at 58°C, and 90 s at 72°C, followed by one final cycle of 10 min at 72°C.

Equipment

During this laboratory exercise the following equipment was used: microcentrifuges, vortex mixers, thermocycler, gel electrophoresis equipment, heating block, pipets, microspectrophotometer and a gel documentation system.

Laboratory Supplies

Each group of three students received: gloves, lab glasses, disponsable lab coats, sterile pipette tips, ice boxes, sterile tubes (1.5 ml and 0.2-mL PCR tubes) and different aliquots of enzymes and solutions. The aliquots were provided to avoid cross contamination and enzyme degradation since students have little or no experience in handling these solutions.

Results and Discussion

Bioinformatics

Using BioEdit software and the GenBank nucleotide database, students were able to easily find the CaACT1, CdACT1, and FKS1 genes sequences. Moreover, the primers for CaACT1 and CdACT1 were designed by the students and were consistent or very similar with those designed by Donnelly et al. [20]. On the other hand, the C. parapsilosis sensu lato FKS1 primers designed by students showed important discrepancies with the published primers [19]. Students aligned CpFKS1, CoFKS1 and CmFKS1 sequences using the bioedit software and choose conserved regions to design the primers. However, they did not consider that FKS genes are conserved among fungal species [36]. Thus, student's primers would hybridize different fungal species FKS1 genes and not only C. parapsilosis sensu lato species FKS1 genes.

Experimental Results

DNA extractions qualities and quantities were better when using the phenol-based procedures. However, interesting conclusions were obtained. Students realized the biohazard inconvenience due to the phenol. Moreover, the majority thought that the phenol-base protocol was more laborious than the commercial kit. The extractions performed with the glass beads pretreatment (Groups 3 and 4) yielded better DNA quantities and qualities. The reasons for these results were discussed with the students. The conclusion was that a physical disruption step followed by chemical disruption is better to break the fungal cell wall than the one disruption step (chemical) used by the commercial kit (Fig. 1).

Figure 1.

Electrophoresis in A 1% Agarose Gel. Line M, molecular size marker; Lanes 1 To 3, C. dubliniensis DNA extracted using different procedures (Line 1: phenol-based DNA extraction, line 2: The Accuprep DNA extraction kit, Lane 3: Accuprep DNA extraction kit with A previous physical disruption step). Lanes 4 To 6, Pcr 1 using as template the DNA extracted from C. dubliniensis (Lane 4), C. tropicalis (Lane 5) and C. parapsilosis Sensu Stricto (Lane 6). Lanes 7 To 9, Pcr 2 using DNA obtained from C. dubliniensis (Lane 7), C. tropicalis (Lane 8) and C. parapsilosis Sensu Stricto (Lane 9).

The PCR1 and PCR2 experiments from all the groups achieved the awaited results, as can be seen in Fig. 1. As expected, students choose the PCR tubes containing the biggest band (1032 bp) to perform the EcoRI digestion. The restriction enzyme digestions were performed correctly and students were able to discriminate between the C. parapsilosis sensu lato species (Fig. 2).

Figure 2.

2% Agarose gel electrophoresis of the C. parapsislosis Sensu Lato Fks1 fragment digested by Ecor1. Lane M, 100-Bp molecular size marker; Lane 1, C. Metapsilosis; Lane 2, C. Parapsilosis Sensu Stricto.

Learning Results and Discipline Achievements

The answers to the questionnaire showed that the students meet the objectives of the laboratory class (Table 3). Students learned that there is no phenotypic method able to differentiate C. albicans from C. dubliniensis and C. parapsilsosis sensu stricto from C. metapsilosis and c. orthopsilosis. Thus, using a molecular method is mandatory (questions 1 and 2). Moreover, 11 out of 12 answered that it is necessary to first use a classical method to identify C. parapsilosis sensu lato complex. These answers demostrate that students undestood that clasical and molecular-based identification are complementary and both are essential to arrive to a definitive identification. The second objective of the classes was to understand the concept of differential evolutionary pressure in introns and exons. The answers to question three demonstrate that this objective was also achieved by students. With their answers, students confirmed that they have a clear notion that exons could not mutate freely while introns have no such restriction. Moreover, the students understand how molecular taxonomy uses these concepts considering that two related species has to have higher homology in exons than in introns. Analyzing the answers to question 4 it was clear that the majority of the students understand the panfungal nature of the PCR2 (RNAF/RNAR primers). However, 3 out of the 12 students thought that this PCR was in fact a pancandida reaction (positive for all Candida spp. but negative for Aspergillus spp. Cryptococcus spp. and Rhodotorula spp.) while 2 believed that the PCR was only positive for C. albicans and/or C. dubliniensis. Therefore, in future classes, we will dwell on the panfungal nature of the RNAF and RNAR primers.

The evaluation of student's participation was performed in two ways: by a self-evaluation test (Table 3) and by following the attitude of the students by taking notes of the questions raised along the laboratory exercises and the answers given to open questions. Also, the way students handle samples and followed the protocols were evaluated. The class and teachers were evaluated by the questions listed in Table 3.

As a conclusion we can state that we present an inexpensive and well accepted group of classes involving important concepts that can be recreated in any laboratory.

Ancillary