Blackboard electrophoresis

An Inexpensive Exercise on the Principles of DNA Restriction Analysis

Authors

  • M. J. Costa

    Corresponding author
    1. Life and Health Sciences Research Institute, School of Health Sciences, University of Minho, Braga, Portugal
    • Life and Health Sciences Research Institute, School of Health Sciences, University of Minho, Braga, Portugal
    Search for more papers by this author

Abstract

Undergraduates with little training on molecular biology may find the technical level of the typical introductory restriction laboratory too challenging and have problems with mastering the underlying concepts and processes. Blackboard electrophoresis is an active learning exercise, which focuses student attention on the sequences and principles of DNA restriction. Students convert short strings of letters of A, C, G, and Ts into blackboard electrophoresis profiles analogous to gel electrophoresis of restriction digests. Students work in teams to i) invent short strings of letters representing polynucleotides; ii) identify and count the number of specific restriction sequences in each string; iii) fractionate the strings in restriction fragments and count their size; and iv) predict blackboard electrophoretic patterns in which fragments are represented by sizes. The exercise is inexpensive, since it does not require laboratory equipment or supplies and accommodates a plethora of introductory contexts that can be explored to bring in relevance to students. The exercise has been used with high school and university audiences with very positive outcomes. Blackboard electrophoresis is a valuable complement or alternative to other instructional approaches to teach restriction analysis and DNA diversity.

“The discovery of restriction enzymes started of an avalanche in molecular genetics”—Peter Richard (presentation speech of the Nobel prize for physiology and medicine, 1978, www.nobel.se).

Twenty-first century citizens should be able to reflect critically on current applications of molecular biology such as genetic-modified organisms or therapeutic cloning. This requires a sound understanding of fundamental concepts related to genetic information and biotechnological manipulations. Restriction analysis, a milestone in the history of genetic engineering [1], is often used in undergraduate molecular life science courses to illustrate the concepts related to the diversity and laboratory exploration of DNA. Restriction analysis is listed in the recommendations for undergraduate biochemistry and molecular biology curricula issued by international scientific [2–4] and professional societies [5]. The digestion of DNA with restriction enzymes is covered in most textbooks of general biochemistry and cell or molecular biology.

Laboratory exercises are essential to develop student technical expertise on DNA restriction and electrophoresis. Nowadays, many introductory biochemistry and molecular biology courses include restriction laboratories, which, as a rule, require the preparation of restriction mixtures and the loading and separation of the resulting fragments by agarose gel electrophoresis [2,6,7]. The technical level of such classes may be too advanced for students with little laboratory training in molecular biology [8,9]. As a consequence, students may focus more on performing the technical manipulations correctly than on understanding the principles and processes underlying the laboratory experiments [8]. Because traditional restriction laboratories tend to capture student intellectual engagement late, when gels are stained, there is little time for feedback or remediation of misconceptions in class. Complementary approaches that would hone in student attention to the principles behind electrophoresis and restriction earlier in class would be valuable.

Active learning methods are well known for their positive instructional and motivational effects [10–14]. This article presents an active learning exercise to teach the concepts of diversity and restriction of DNA: the blackboard electrophoresis. It is a simulation in which students work with nonintimidating materials to predict results and produce blackboard electrophoresis profiles. The exercise complements DNA restriction wet labs and also works well in an introductory “dry” event (a workshop or a lecture) on electrophoresis, DNA restriction, or genetic engineering. It is inexpensive and works with any sample DNAs or restriction sequences.

BLACKBOARD ELECTROPHORESIS: DESCRIPTION AND MATERIALS

Along four sequential steps, starting with strings of letters representing the four nucleotides (Fig. 1), students generate blackboard electrophoresis fingerprints, just as gel-electrophoresis profiles would result from the separation of DNA fragments generated from restriction digestions. Guided by a facilitator, students discuss and predict outcomes of the molecular events underlying the generation, proofreading, digestion, and separation of fragments by sizes.

Figure 1.

Flow chart of the blackboard electrophoresis

The blackboard is used to 1) jot down (invented) original strings of the A, C, G, and Ts representing DNA fragments and restriction sequences (Table I); 2) represent letter counts (Table II); and 3) represent fragment sizes on a diagram (Fig. 2). The only material required is a large blackboard or other editable surface to write on—such as a computer with onscreen projection—which makes this exercise particularly inexpensive. A step-by-step illustration is presented in the accompanying tables and figure.

Figure 2.

Graphic profiles resulting from the blackboard electrophoresis of the strings in Table I.

Table I. Blackboard electrophoresis: illustration of the exercise with five strings of letters and four restriction sites (TGC, ATG, GCTA, TCGA)
StepWhat the blackboard may look like
InventionAAATGCGATGGCTAGATCGCGCTGATCGATGGCTGGGTAGACTAACGTTGACAGGCTGGTAGTCGATCGATGCCCGAGTTACACAGATGAGCTCGCTAAACGACCGATTACGAACTGTCGCAAATGGTCACTGCTATGCTCGCTACTAGT
ProofreadingAAATGCGATGGCTAGATCGCGCTGATCGATGGCTGGGTAGACTAACGTTGACAGGCTGGTAGTCGATCGGTGCCCGAGTTACACAGATGAGCTCGCTAAACGACCGATTACGAACTGTCGCAAATGGTCACTGCTATGCTCGCTACTAGT
RestrictionAAAT*GCGA*TGGC*TAGATCGCGCTGAT*CGATGGCTGGGTAGACTAACGTTGACAGGCTGGTAGT*CGATCGGT*GCCCGAGTTACACAGA*TGAGCTCGC*TAAACGACCGATTACGAACTGTCGCAAA*TGGTCACT*GCTA*TGCTCGC*TACTAGT
Table II. Counts of restriction sites and fragment length for each string of letters in Table I
STEP/playerProofreadingRestriction
StringTGCATGGCTATCGAFragmentsn (sizes)
A11115 − (4/4/4/14/4)
B00001 − (30)
C11014 − (3/8/16/3)
D00102 − (6/24)
E12105 − (4/8/4/7/7)

IMPLEMENTATION

The exercise has been presented to classes with up to 24 people by one facilitator. The audience works through the exercise in teams with no prior information on the exercise (in fact, the element of surprise might be a motivational aid). Although the students work in teams, every individual is accountable. It is not essential for the students to know the chemistry of DNA in advance.

Introduction to the exercise is anticipated by a general discussion on DNA diversity in the context of a biological question or issue, rather than by lectures on the principles that underlie DNA restriction. The issue should be of relevance to the students and call for some kind of DNA sequence variability analysis to be addressed. The intention is to induce the necessary awareness on the biological importance of DNA laboratory differentiations and the will to understand how they are accomplished in the molecular biology laboratory. The context can be collected from the general press with scientific publications as supporting materials. For example, a story on marine mammal biodiversity and conservation based on a research paper on the population genetics of sperm whales [15] has been very successful with biology students.

To do the exercise, students are divided into teams and are instructed to designate individual members to play the roles of an inventor, a proofreader, a restrictor, and a gel loader (the duties of each role are presented as the exercise progresses) corresponding to the invention, proofreading, restriction, and size separation steps of the exercise (a flow chart is provided in Fig. 1). The first step is the invention of a string of letters made from ACGTs by each team, with a length dictated by the facilitator (experience shows that in ∼1 h, six teams can conclude the blackboard electrophoresis with sequences of 30–40 letters and five restriction sequences [3–4] letters long). Then, the teams proofread and cleave the sequences into fragments based on restriction sequences suggested by the facilitator (sequences with a length of around 10% of the original string of letters invented on the spot work well). The facilitator draws the tables to register the counts resulting from the proofreading and restriction steps, and, at the entrance of the “size separation” step, the horizontal lines representing gel slots and the size references—as many as there are teams plus one to be used with size references.

The pace should allow enough time for all the teams to inspect all sequences in every step of the exercise. For example, at the end of the “restriction” step, after marking restriction sites in all strings of letters, teams should have the opportunity to analyze and eventually correct each other's markings. Team results should always be registered on the board, so that every step is concluded with a small general discussion.

Throughout the general discussions, students are asked to compare the original letter strings based on the results of the individual steps. Letters will have been transformed into blackboard electrophoresis profiles, and conclusions will be drawn on the principles of restriction analysis.

At closure, there is a general discussion on the process and principles of restriction as well as the limits of the exercise. With the help of commercial wall charts with restriction sequences, student attention is directed to the fact that the natural restriction sequences are double-stranded palindromes. The facilitator recaptures the initial story and reviews it under the lenses provided by what has been learned. As an illustrative example, the outcomes of the four steps are illustrated in Tables I and II and in Figure 2 for five strings of letters and four restriction sites.

OBSERVATIONS AND OUTCOMES

Blackboard electrophoresis has been used by the author in six undergraduate biochemistry courses for nonmajors and in two outreach lectures in high schools. The following observations and impressions sustain the positive instructional impact of the exercise. First, it has been found very simple to implement. All audiences—undergraduates and high school students—have succeeded in predicting and contributing to the discussions around blackboard electrophoresis profiles. Commonly, students have commented on similarities between the vertical patterns of lines on the board with gel electrophoresis profiles in textbooks or in the media. Second, the author's impressions on the impact of the exercise on student motivation and conceptual learning are very positive. Several teaching experiences revealed to the author that at closure of a traditional restriction laboratory class, numerous students remained unable to describe what is in a gel band, how restriction works or how gel profiles may reflect differences in sample DNA sequences. When compared with the traditional restriction labs, the use of the blackboard electrophoresis achieves better development of the essential expertise to interpret the experimental electrophoretic profiles. Students are able to predict some otherwise difficult learning issues, such as understanding that one band, regardless of sequences, corresponds to the fragments of the same size or that intensities of the bands are related to the amount of DNA of the same size. A very important benefit is that the exercise helps both the instructor and the students in diagnosing of learning difficulties in time they can be addressed in class. Finally, the complementation of wet restriction laboratories with the blackboard electrophoresis increases individual engagement in class. In general discussions, there is wide participation of students who raise more questions at the conceptual level comparatively to scenarios of traditional restriction laboratories. The beneficial effects of questioning to learning biochemistry [16,17], and the positive effects on student motivation of active pedagogies have been described earlier [10–14].

DISCUSSION

DNA digestion and electrophoresis are standard techniques in molecular life science courses [6, 7]. In the introductory courses attended by nonmajors, who might never take another course in molecular life sciences, the effectiveness of educational strategies that aim at student conceptual understanding is particularly important. Active learning experiences are known to enhance student learning [10–14]. The blackboard electrophoresis instills restriction analysis as a way of knowing, rather than a body of complete knowledge. It converges to “Scientific teaching” [18]. Students become actively involved in the process of learning [10–14, 18,19] and work in teams [20]. The blackboard electrophoresis is easily integrated in restriction labs during gel runs. This exercise can be used in exciting contexts [19,21] fitting nicely in Guided Discovery, which, as opposed to Cookbook learning, is known to be beneficial to student attitudes and achievements in science courses [22].

Recently, in physics education, it has been shown that classroom demonstrations may fail to have a significant effect on student learning [14]. When learning gains were compared between demonstrations that did not require any prediction in any instance with those that did, making predictions was found key in promoting increased learning [14]. The observations made with the blackboard electrophoresis are in line with this thesis, for example, as students are responsible for predicting the graphic representations of the fragments, they might learn better how to interpret gels. Nevertheless, a quantitative analysis of the learning gains is needed to document this hypothesis.

Like other important laboratory techniques, wet restriction laboratories on electrophoresis are expensive. The use of the blackboard electrophoresis as an alternative to wet restriction labs may be a good choice in scenarios of large classes, in which money, time, or manpower may hold students from performing DNA digests or running gel electrophoresis. The advantages would be i) cutting costs substantially; ii) saving class time consumed in individual manipulations and incubations; and iii) making concept experimentation possible—the exercise will include as many enzymes or original DNAs as necessary. The characteristics of the blackboard electrophoresis make it also a suitable high school classroom activity, complementing the many already existing [23,24]. The blackboard electrophoresis is an exercise that should be considered at the introductory level wherever learning of DNA variability is intended.

Acknowledgements

I am grateful to Dr. Joana Almeida Palha for reviewing and discussing the manuscript and to the journal reviewers for comments and suggestions.

Ancillary