SEARCH

SEARCH BY CITATION

Keywords:

  • hepatocellular carcinoma;
  • osteopontin;
  • early tumor recurrence;
  • portal vein invasion;
  • metastasis;
  • prognosis

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

BACKGROUND

Intrahepatic metastasis via portal vein spread is an important feature and a crucial unfavorable prognostic factor of hepatocellular carcinoma (HCC). To identify the molecular factors for tumor progression, the authors used differential display (DD) to analyze aberrant gene expression in HCC. The goal of the current study was to elucidate the clinicopathologic and prognostic significance of osteopontin (OPN) in HCC progression.

METHODS

OPN mRNA levels, which were increased preferentially in HCC in a DD assay and verified with Northern blotting, were measured in 240 surgically removed, unifocal, primary HCCs using the reverse transcription–polymerase chain reaction at the exponential phase. OPN mRNA expression was correlated with clinicopathologic features, particularly portal vein invasion, early tumor recurrence, and prognosis.

RESULTS

Osteopontin mRNA was overexpressed in 133 tumors (55%). The OPN overexpression was associated closely with α-fetoprotein elevation (P = 0.001), p53 mutation (P = 0.021), larger tumors (P = 0.002), high-grade HCC (P < 0.001), late-stage HCC (P < 0.001), early tumor recurrence and/or metastasis (P = 0.003), and a lower 10-year survival rate (P = 0.00013). Multivariate analysis revealed that tumor stage and early tumor recurrence were crucial prognostic factors. In early-stage HCC, which has no vascular invasion and a lower early tumor recurrence than late-stage HCC, OPN mRNA overexpression predicted a higher early recurrence rate (P = 0.003).

CONCLUSIONS

OPN mRNA overexpression was correlated closely with high-grade, late-stage, and early tumor recurrence, which lead to poorer prognosis. Osteopontin overexpression might serve as an unfavorable prognostic factor and a useful marker for predicting early recurrence in early-stage HCC. Cancer 2003;98:119–27. © 2003 American Cancer Society.

DOI 10.1002/cncr.11487

Osteopontin (OPN), an acidic, highly phosphorylated and glycosylated calcium-binding secretory protein, is expressed widely and has a diverse range of functions.1, 2 These include cell adhesion and migration,3, 4 immune and inflammatory response,5 antiapoptosis,6 suppression of nitric oxide synthase,7 and bone calcification.1, 2 Human OPN contains an integrin-binding GRGDS domain.8, 9 It binds to cells via the GRGDS cell adhesion sequence that recognizes the αvβ3 integrin and to extracellular matrix.3, 4 The GRGDS motif is found in proteins that play a role in cell adhesion and metastasis.10, 11 Osteopontin is expressed in excessive amounts by many transformed cell lines, and this overexpression is correlated with metastatic potential in the murine model.9, 12–14 Antisense OPN can decrease OPN levels and suppress metastatic potential.15, 16 Osteopontin is overexpressed in most human carcinomas.17 Its overexpression is correlated with advanced stage in gastric carcinoma,18 but not in lung, breast, and esophageal carcinomas.19–21 Despite the strong association of OPN expression with tumor metastasis in vitro and in animal studies,22 the role of OPN in human carcinoma, including hepatocellular carcinoma (HCC), is less clear.

Hepatocellular carcinoma is one of the most common malignancies in Taiwan and in many other countries. It has a grave prognosis, particularly in advanced stage, because it spreads throughout the liver via the intrahepatic portal vein. With the improvements in early diagnosis, evaluation of hepatic functional reserve, surgical techniques and perioperative management, long-term survival has been achieved in some patients who undergo surgical resection. However, even when curative resection is performed at a relatively early stage of disease, a considerable number of patients develop early intrahepatic and/or extrahepatic recurrence postoperatively. In addition, molecular factors related to the tumor progression and portal vein invasion of HCC have not been well characterized. Although these patients had adequate liver function at the time of surgery, the outcome of HCC after tumor resection still was unsatisfactory, mostly due to the late tumor stage23–25 and the intrahepatic tumor recurrence rate.26–28 Early tumor recurrences (≤ 1 year) arise mainly from intrahepatic metastases and have a significantly worse prognosis.28 Several clinicopathologic risk factors are associated with early tumor recurrence, particularly portal vein invasion.26–28 Some molecular factors are related to tumor recurrence after hepatic resection, including telomerase activity.29 However, molecular markers that predict early tumor recurrence, particularly for early-stage HCC, remain limited.

To identify potential molecular factors associated with tumor progression of HCC, we used the differential display (DD) method to analyze aberrant gene expression in HCC. We identified a cDNA clone identical to OPN, which was expressed preferentially in tumors. In the current report, we analyzed the expression of OPN mRNA in surgically resected HCC and correlated OPN mRNA expression with clinicopathologic features. We also showed that OPN mRNA overexpression in HCC was associated more often with high-grade, late-stage tumors, early tumor recurrence, and poor prognosis.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Patients

Between 1987 and 1997, 240 unifocal primary HCCs,26–28 which had undergone complete histopathologic assessment at the National Taiwan University Hospital, frozen tissue samples stored at − 70 °C, and RNA samples were selected for the study. The definition of unifocal HCC was based on combined analyses of pathologic features, hepatitis B virus (HBV) DNA integration pattern, α-fetoprotein (AFP) mRNA expression, and mutation patterns of tumor suppressor p53 and β-catenin genes, as previously described.23–28 The 240 patients included 185 males and 55 females, with a mean age of 55.86 years (range, 14–88 years). All patients had adequate liver function reserve at the time of surgery, and all tumors were surgically resectable. Liver function had a Child classification of A in 225 patients (94%) and B in 15. Patients with liver function with a Child C classification were excluded from surgery.30 Cirrhosis was present in 97 patients (40%), including 22 patients with incomplete septal (early) cirrhosis, whereas 143 patients (60%) had no cirrhosis due to patient selection bias. None of these patients had received transhepatic arterial embolization (TAE) or chemotherapy before surgery. Chronic HBV and/or hepatitis C virus (HCV) infections were detected in 230 patients (96%), including 6 patients who were negative for hepatitis B surface antigen (HBsAg) and anti-HCV. However, Southern blotting and polymerase chain reaction (PCR) detected HBV DNA in HCC in these six patients. Ten patients, with mean age of 66.6 years, were negative for serum HBsAg and anti-HCV. One had primary biliary cirrhosis, whereas nine did not have cirrhosis or chronic alcoholic liver disease. Forty-two patients were heavy drinkers, and all 42 had either chronic HBV and/or HCV infection. No alcoholic cirrhosis was found in this series.

Early Tumor Recurrence and Metastasis

The diagnosis of intrahepatic tumor recurrence and distant metastasis was based on ultrasonography and/or computed tomography scanning, supplemented with detection of serum AFP elevation. Because metastasis was a crucial unfavorable prognostic factor and might be detected earlier than liver recurrence, we also included distant metastasis in the evaluation of tumor recurrence. Until the end of June 2002, 225 patients were eligible for the evaluation of early intrahepatic tumor recurrence or metastasis. Tumor recurrence was detected in 179 patients, including 60 patients with distant metastases. Among them, 59 received a second resection and 52 received TAE for recurrent HCCs.26 Fifteen patients were excluded because they died within 12 months, 11 patients had no evidence of tumor recurrence or metastasis, and 4 patients did not have available information about tumor recurrence. Intrahepatic tumor recurrences or distant metastases detected ≤ 12 months after tumor removal were regarded as early tumor recurrences,30–32 whereas those detected after 12 months were regarded as late recurrences.

Histologic Study and TNM Staging

Tumor grade was divided into three groups: well-differentiated (Grade I), moderately differentiated (Grade II), and poorly differentiated (Grades III and IV). The resected HCC was staged as Stages I, II, IIIA, IIIB, and IV, as previously described.23, 24 For surgically resected HCC with adequate liver function reserve and low frequency of cirrhosis, pathologic staging was correlated closely with survival.23–25 In the current study, tumor staging was based on the International Union Against Cancer criteria,33 with slight modification. Stage I HCC included tumors that were 2 cm or smaller and showed no evidence of liver and vascular invasion. These tumors were either encapsulated with no liver invasion (Stage IA) or unencapsulated with liver invasion (Stage IB). Stage II HCCs included tumors that were 2 cm or smaller for which vascular invasion was limited to small vessels in the tumor capsule as well as encapsulated tumors larger than 2 cm with no evidence of liver or vascular invasion (noninvasive large HCC). Stage IIIA HCCs included invasive tumors larger than 2 cm with invasion of small vessels in the tumor capsule and/or satellites near the tumor, but no portal vein invasion. Stage IIIB HCCs included tumors with invasion of the portal vein branch near the tumor, but not of the distant portal vein in the liver parenchyma. Stage IV included tumors with involvement of major portal vein branches, satellites extending deeply into the surrounding liver, tumor rupture, or invasion of the surrounding organs. Involvement of major portal vein branches was encountered at the time of surgical resection. Sixteen, 73, 57, 32, and 47 tumor specimens were classified as Stage I, II, IIIA, IIIB, and IV HCC, respectively.

Differential Display Analysis

Differential display was performed according to the recommendation of the manufacturer using the RNAimage kit (GenHunter, Nashville, TN), as previously described.24 Twenty-three paired tumor and nontumor liver RNA samples, including adenoma, early and late-stage HCCs, hepatoblastoma, and HepG2 cells, were used routinely to minimize individual variation. Total RNA (0.2 μg) was reverse transcribed in a mixture containing 100 units (U) MMLV reverse transcriptase, 20 μM dNTP, and 0.2 μM anchor primer H-T11A (5′-AAGCT11A-3′). The reverse transcription (RT) products (2 μL) were subjected to PCR amplification in a mixture containing 2 μM dNTP, 0.2 μM H-T11A (5′-AAGCT11A′), 25 millicuries/mmol [α-33P]dATP (Amersham, Buckinghamshire, UK), 1 U Vent DNA polymerase (New England Biolabs, Inc., Beverly, MA), and 0.2 μM arbitrary primer HAP54 (5′-AAGCTTTTGAGGT-3′). PCR was performed using a Perkin-Elmer Cetus (Norwalk, CT) 9600 thermocyclerA (94 °C for 30 seconds, 40 °C for 2 minutes, 72 °C for 1 minute for 40 cycles, and a final elongation at 72 °C for 5 minutes). The amplification products were separated with 6% denaturing polyacrylamide gel electrophoresis. The dried gel then was exposed using film autoradiography. More than 100 bands were displayed in each reaction. The differentially expressed band was cut, eluted, and sequenced.

Northern Blot and Reverse Transcription Polymerase Chain Reaction (RT-PCR)

After verification with Northern blot, we used RT-PCR assays for large-scale study, as is described elsewhere.24 S26 ribosomal protein mRNA was used as the internal control.34 Briefly, 2 μL RT product, 1.25 U Pro Taq polymerase (Protech Technology Enterprise, Taipei, Taiwan), Pro Taq buffer, and 200 μM (each) dATP, dTTP, dGTP, and dCTP were mixed with primer pairs for OPN and S26 in a total volume of 30 μL. PCR was performed in an automated DNA thermal cycler 480 (Perkin-Elmer Cetus), with initial heating at 94 °C for 2 minutes, followed by the Touchdown PCR: 22 cycles of 94 °C for 30 seconds, annealing for 1 minute (the annealing temperature is reduced by 1 °C per 2 cycles from 65 °C to 55 °C), 72 °C for 1 minute, and final 72 °C for 10 minutes. Osteopontin cDNA was amplified using OPN-A (CCCTTCCAAGTAAGTCCAACGAAAGCC) and OPN-F (GCTGACTCGTTTCATAACTGTCCTTCCC) oligonucleotides. The primers for S26 are S26F (CCGTGCCTCCAAGATGACAAAG) and S26R (GTTCGGTCCTTGCGGGCTTCAC). PCR was stopped at the exponential phase of the amplified gene, 22 cycles for both OPN and S26. The products were electrophoresed on a 2% agarose gel. The concentrations of the PCR fragments were determined with the IS-1000 digital imaging system (Alpha Innotech, Sanleando, CA). The OPN mRNA levels were determined by the ratio of signal intensity of OPN to that of S26 measured by 1D Image Analysis software (Kodak Digital Science, Rochester, NY) and scored as high (ratio ≥ 1.5), moderate (0.6 ≤ ratio < 1.5), trace (ratio < 0.6), or negative. The OPN mRNA level of nontumor livers rarely exceeded a ratio of 0.6. An OPN-to-S26 ratio > 0.6 was regarded as OPN mRNA overexpression, whereas a ratio < 0.6 was not.

RNA In Situ Hybridization

A 359 N base pair (bp) riboprobe spanning exons 6 and 7 of OPN mRNA was used to hybridize tumor cells on formalin-fixed and deparaffinized sections, as described elsewhere.33 Briefly, the riboprobe was prepared using the Dig RNA labeling kit (Boehriger Mannheim GmbH, Biochemica, Mannheim, Germany). The synthesized riboprobe was purified by gel elution to enhance the signal of specific reaction. The Dig nucleic acid detection kit (Boehriger Mannheim) was used to detect the OPN mRNA in situ according to the recommendations of the manufacturer.

Analysis of p53 Mutation

Mutations of the p53 tumor suppressor gene, spanning exon 2 to exon 11, were detected by DNA sequencing as described previously.28, 35 Cases with incomplete study were excluded.

Follow-Up Observation

During the follow-up period of 175 months, 193 patients (80%) patient had been followed for more than 10 years or until death. At the end of this follow-up, 62 patients remained alive, 15 of whom had survived for more than 12 years. The endpoint for follow-up was set at the 10th year.

Statistical Analysis

The statistical significance of differences in selected clinicopathologic features between tumor specimens with and without OPN mRNA overexpression was assessed by unconditional logistic regression. Estimates of parameters in the model were computed by maximum likelihood techniques and 95% confidence intervals (CIs) were based on the standard error of the coefficients and the normal approximation. For the analysis of early tumor recurrence, person-months for each participant were calculated from the date of tumor resection to the date of tumor recurrence, death, or 12 months after resection, whichever came first. For the 10-year survival analysis, survival was calculated from the date of resection to the date of death; survival was set at 120 months for those who survived for more than 10 years.

Multivariate-adjusted relative risks (RR) and 95% CIs were estimated by Cox proportional hazards regression models.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Cloning and Expression of Osteopontin mRNA in Hepatocellular Carcinoma and Liver

Using DD analysis, we identified a 468 bp cDNA fragment that frequently was overexpressed in HCC (Fig. 1) and identical to OPN.8 Overexpression of OPN mRNA in HCC was verified by Northern blotting, which showed a single 1.8-kilobase mRNA band similar to OPN mRNA (Fig. 2). RNA in situ hybridization using a gel elution-purified OPN-specific riboprobe revealed OPN mRNA in tumor cells, but not in nontumor cells (Fig. 3). The sense riboprobe gave a negative signal.

thumbnail image

Figure 1. Differential display analysis. Among two paired hepatocellular adenomas, nine paired early-stage and eight late-stage hepatocellular carcinomas (HCC), four paired hepatoblastomas, and HepG2 cells, a candidate band (arrow) was expressed preferentially in the tumor (T) of late-stage HCCs and HepG2 cells, but not in the paired nontumor livers (L).

Download figure to PowerPoint

thumbnail image

Figure 2. Northern blot analysis of osteopontin (OPN) from six paired hepatocellular carcinoma (T) and liver (L) tissue specimens. A 1.8-kilobase mRNA sample was expressed in abundance in 5 tumors and in very low to negative levels in the nontumor liver. 28S rRNA samples were used to evaluate the quality and quantity of RNA loading. Hepatoblastoma cells (HepG2) were used as a positive control.

Download figure to PowerPoint

thumbnail image

Figure 3. RNA in situ analysis of osteopontin in hepatocellular carcinoma (HCC). Using an antisense riboprobe (A), a positive signal was detected in HCC (H) but not in the nontumor liver (L). A positive signal was detected in the cytoplasm of the majority of the tumor cells. A sense probe (B) gave a negative result. Original magnification ×46.

Download figure to PowerPoint

After the verification of its preferential overexpression in tumor cells by Northern blot, we used RT-PCR for large-scale analysis of OPN mRNA expression in HCC (Fig. 4). Among 240 unifocal primary HCCs, OPN mRNA expression was abundant in 99 tumor specimens, moderate in 34, trace in 52, and negative in 55. We evaluated 271 nontumor livers, including 244 livers bearing HCC, 10 with cholangiocarcinoma, 10 with metastatic carcinoma, 4 with hepatoblastoma, and 3 with benign tumors. In the nontumor livers, OPN mRNA was expressed abundantly in 17, moderately in 16, trace in 85, and negative in 144. Therefore, OPN mRNA was overexpressed in 55% of HCC and in 12.1% of the liver specimens. In HCC-bearing livers, 94 had cirrhosis and OPN overexpression was more frequent in livers bearing late-stage HCC with vascular invasion (15% or 17 or 112 vs. 7% or 9 of 122, P = 0.058).

thumbnail image

Figure 4. Osteopontin (OPN) mRNA expression in paired hepatocellular carcinoma (HCC; T) and liver (L). Quantitative reverse transcription–polymerase chain reaction (RT-PCR) measurements of OPN mRNA during the exponential phase of RT-PCR amplication of mRNA showed OPN overexpression (*) in 12 of 20 HCC specimens (T). bp: base pairs. M: molecular weight marker.

Download figure to PowerPoint

Clinicopathologic Correlation of Osteopontin mRNA Expression in Unifocal Primary Hepatocellular Carcinoma

To eucidate its biologic significance, we correlated the OPN mRNA expression with clinicopathologic features of HCC. As shown in Table 1, OPN mRNA overexpression in HCC was associated with serum AFP elevation (P = 0.001) but not with age, gender, chronic HBV infection, and Child–Pugh grade.

Table 1. Osteopontin mRNA Expression Status in Relation to Selected Clinicopathologic Features in 240 Patients with Resected Unifocal Primary Hepatocellular Carcinoma
FactorOsteopontin mRNA overexpressionP value
Yesa (%)Nob (%)OR (95% CI)
  • OR: odds ratio; CI: confidence interval; HBsAg: hepatitis B virus surface antigen; AFP: α-fetoprotein.

  • a

    n = 133.

  • b

    n = 107.

  • c

    Early tumor recurrence; P for trend = 0.002.

  • d

    Early tumor recurrence; P for trend < 0.001.

Gender    
 Male100 (75) 85 (79)1.00 
 Female 33 (25) 22 (21)1.26 (0.68–2.33)0.463
HBsAg    
 Negative 36 (27) 84 (32)1.00 
 Positive 97 (73) 73 (68)1.13 (0.60–2.13)0.696
Child grade    
 A124 (93)101 (94)1.00 
 B  9 (7)  6 (6)1.34 (0.46–3.92)0.594
AFP (ng/mL)    
 < 400 61 (46) 75 (70)1.00 
 ≥ 400 72 (54) 32 (30)2.71 (1.54–4.79)0.001
p53 mutation    
 No 44 (42) 51 (59)1.00 
 Yes 62 (58) 36 (41)1.97 (1.11–3.52)0.021
Cirrhosis    
 No 84 (63) 58 (54)1.00 
 Yes 49 (37) 49 (46)0.65 (0.38–1.10)0.107
Tumor size (cm)c    
 ≤ 3 22 (17) 35 (33)1.00 
 3.1–5 28 (21) 26 (24)1.73 (0.81–3.68)0.156
 > 5 83 (62) 46 (43)2.79 (1.46–5.32)0.002
Tumor graded    
 I 16 (12) 37 (35)1.00 
 II 57 (43) 45 (42)2.84 (1.39–5.79)0.004
 III–IV 60 (45) 25 (23)5.34 (2.49–11.5)< 0.001
Tumor stage    
 I–II 31 (23) 60 (56)1.00 
 IIIA 31 (23) 29 (27)2.08 (1.07–4.07)0.031
 IIIB–IV 71 (53) 18 (17)7.90 (3.91–16.0)< 0.001
Early recurrence    
 No 20 (16) 26 (26)1.00 
 Yes 75 (67) 31 (30)3.02 (1.46–6.25)0.003

Histologically, HCC tumors with OPN mRNA overexpression were larger (P = 0.002) and were more frequently, Grade II–IV than were HCC tumors without OPN overexpression (P < 0.001). Osteopontin mRNA overexpression was associated closely with portal vein tumor invasion (Stage IIIB and IV HCC; P < 0.001 [Table 1]). In addition, HCC with OPN overexpression was associated more frequently with p53 mutation than was HCC without OPN overexpression (P = 0.021). Osteopontin mRNA overexpression in HCC was not correlated with cirrhosis.

Correlation of Osteopontin Overexpression with Early Tumor Recurrence

Of the 225 eligible patients, 179 (79.6%) had tumor recurrence and/or distant metastases. One hundred and six patients (59.2%) had tumor recurrence within 1 year (early tumor recurrence), and 26, 19, 9, 8, and 5 patients had tumor recurrences in the 2nd, 3rd, 4th, 5th, and 6th year, respectively. Six more patients developed tumor recurrences after 6 years. Early tumor recurrence was correlated closely with tumor stage: 1 of 16 (6.3%), 17 of 73 (23.3%), 25 of 57 (43.9%), 22 of 32 (68.8%), and 41 of 48 (85.4%) patients with Stage I, II, IIIA, IIIB, and IV HCC, respectively, experienced recurrences.

In addition to the close correlation with tumor stage, HCC with OPN overexpression was associated with a higher early tumor recurrence rate than was HCC without OPN overexpression (P = 0.003, Table 1). To elucidate the role of OPN overexpression in the prediction of early tumor recurrence, we correlated OPN overexpression with tumor stage. We showed that early-stage (Stage I and II) HCC with OPN overexpression was associated with an early tumor recurrence rate three times higher than the rate for HCCs without OPN overexpression (37% vs. 12%, P = 0.0025, Table 2).

Table 2. Osteopontin mRNA Overexpression in Relation to Early Tumor Recurrence after Resection of Primary Hepatocellular Carcinoma
Tumor stageOPN mRNA overexpressionNo. of person-months at riskNo. of early recurrencesaOR (95% CI)P value
  • OPN: osteopontin; OR: odds ratio; CI: confidence interval.

  • a

    Early tumor recurrences include intrahepatic tumor recurrences and/or distant metastases detected ≤ 12 months after removal of primary hepatocellular carcinoma.

I–IINo (n = 59)232471.00 
 Yes (n = 30)1238113.42 (1.32–8.81)0.0025
IIIANo (n = 26)782101.00 
 Yes (n = 31)1031151.50 (0.67–3.34)0.325
IIIB–IVNo (n = 17)155141.00 
 Yes (n = 62)966491.01 (0.55–1.83)0.984

Prognostic Significance of Osteopontin mRNA Expression

Hepatocellular carcinoma with OPN mRNA overexpression was associated with a significantly lower 10-year survival rate than was HCC without OPN overexpression (P = 0.00013, Fig. 5). In surgically resected HCC, tumor stage and early tumor recurrence were strongly correlated with the 10-year survival rate of the patients (Figs. 6, 7). Age- and gender-adjusted RRs were used to evaluate the prognostic effects of OPN overexpression, as well as other major clinicopathologic prognostic factors (Table 3). Elevated AFP levels, high-grade tumor, OPN overexpression, early tumor recurrence, tumor size, and tumor stage were important predictors for poor prognosis. However, when we modeled all these important predictors together, the effect of OPN overexpression was not observed, due to the strong correlation between tumor stage and OPN overexpression (data not shown).

thumbnail image

Figure 5. Cumulative survival curve for 240 patients with primary unifocal hepatocellular carcinoma (HCC). HCC with osteopontin (OPN) mRNA overexpression, designated OPN (+), had a significantly worse 10-year survival rate than HCC without OPN mRNA overexpression (n = 107), designated OPN (−) (P = 0.00013; log rank test).

Download figure to PowerPoint

thumbnail image

Figure 6. Cumulative survival curve for 240 patients with primary unifocal hepatocellular carcinoma in relation to tumor stage. Tumor stage was closely correlated with 10-year survival (P = 0.00000; log rank test).

Download figure to PowerPoint

thumbnail image

Figure 7. Cumulative survival curve for 240 patients with primary unifocal hepatocellular carcinoma (HCC) in relation to early tumor recurrence. HCC with early tumor recurrence (within 12 months) had a poorer 10-year survival rate (P = 0.00000; log rank test).

Download figure to PowerPoint

Table 3. Age-and-Gender-Adjusted Relative Risk values for Selected Predictors of Overall Survival at 120 Months after Resection of Hepatocellular Carcinoma
PredictorRR95% CIP value
  • OPN: osteopontin mRNA; HBsAg: hepatitis B virus surface antigen; AFP: α-fetoprotein; RR: relative risk; CI: confidence interval.

  • a

    Designates early intrahepatic tumor recurrence and/or distant metastasis detected in the 12 months after tumor removal of primary hepatocellular carcinoma.

HBsAg   
 Positive vs negative1.080.78–1.490.647
AFP (ng/mL)   
 ≥ 400 vs. < 4001.391.05–1.850.021
Child-Pugh grade   
 B vs. A1.340.77–2.320.298
Cirrhosis   
 Yes vs. no1.060.81–1.400.675
Tumor size (cm)   
 3.1–5 vs. ≤ 31.791.21–2.650.004
 > 5 vs. ≤ 32.031.45–2.82< 0.001
Tumor grade   
 II vs. I1.511.1–2.320.012
 III–IV vs. I1.581.10–2.260.013
Tumor stage   
 IIIA vs. I–II1.360.97–1.920.078
 IIIB–IV vs. I–II2.822.06–3.86< 0.001
Early recurrencea   
 Yes vs. no4.493.34–7.29< 0.001
OPN overexpression   
 Yes vs. no1.321.01–1.720.039

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Using mRNA DD to identify aberrantly expressed genes related to tumor progression of HCC, we found that OPN mRNA was expressed preferentially in HCC. RNA in situ hybridization confirmed that the OPN transcript was confined to tumor cells.20, 36, 37 The RT-PCR assays then were used for large-scale analysis of OPN expression in surgically resected HCC. The patients in the study represented a special group of HCC patients with adequate liver function reserve suitable for hepatic resection. In these surgical HCC patients, adverse effects related to cirrhosis were reduced significantly, and the tumor factors, particularly tumor stage, which is a crucial prognostic factor, were analyzed pathologically.23, 24 This facilitated the analysis of the role of OPN in the tumor progression of HCC. Among 240 unifocal primary HCCs, OPN mRNA was overexpressed in 133 (58%). Overexpression was closely correlated with serum AFP elevation (P = 0.001) and Grade II–IV tumors (P < 0.001), confirming the association of poorly differentiated HCC with AFP elevation.27 In addition, OPN overexpression occurred more often in larger tumors (P = 0.002) and in late-stage (Stage IIIB–IV) HCC (P < 0.001). Late-stage HCC exhibited portal vein invasion and was correlated closely with poorer prognosis.23 Our findings therefore support the suggestion that OPN expression enhances metastatic potential of transformed cells,13–15, 21, 38 as well as human cancers,18, 39 including HCC. Although the molecular mechanisms for the role of OPN in portal vein invasion and metastasis are not understood fully, OPN has a GRGDS amino acid motif that is important in promoting cell migration40 and tumor metastasis.10 Osteopontin also participates in the interaction of invading tumor cells with components of basement membrane via the integrin αvβ3.40, 41 These interactions mediate key aspects of the metastatic process.42, 43 Recently, El-Tanani et al.44 showed that OPN is a novel downstream effector of the Tcf-signaling pathway and is involved directly in promoting metastasis. Osteopontin is a major transcriptional target of hepatocyte growth factor and can dramatically increase invasive growth.45 These observations support the suggestion that OPN overexpression has a direct, rather than correlative, role in metastasis.14, 22

Prolonged survival has been achieved in patients receiving hepatic resection for HCC, but the prognosis remains grave because of the high tumor recurrence rate, mostly caused by intrahepatic metastasis.46 During the follow-up period of 175 months, tumor recurrence and/or metastasis were encountered in 179 (79.6%) of 225 eligible patients and early tumor recurrence was detected in 106 patients (47%). Early tumor recurrence was closely correlated with tumor stage and was associated with poorer prognosis, confirming that portal vein invasion is the major risk factor for early tumor recurrence after hepatic resection for HCC.46–49 However, molecular factors useful for the prediction of tumor recurrence remain to be identified.29 We showed that OPN overexpression was associated with a higher early tumor recurrence rate (P < 0.00001), particularly in early-stage (Stage I and II) HCCs in which OPN mRNA overexpression was associated with an early tumor recurrence rate three times higher than in HCCs without OPN overexpression (P = 0.0025), and may be a useful molecular marker for predicting early tumor recurrence. Furthermore, HCC with OPN mRNA overexpression was associated with a significantly lower 10-year survival rate than HCC without OPN overexpression (P = 0.00013). However, age-and-gender-adjusted RR analysis showed that tumor stage and early tumor recurrence are more important predictors of poor prognosis23, 24, 46–49 than is OPN overexpression. Therefore, OPN overexpression appears to be a stage-related prognostic factor. During tumor progression, multiple genetic alterations accumulate and can contribute synergistically to tumor metastasis and poor prognosis. In the current study, OPN overexpression was associated with p53 mutations (P = 0.021), which also were associated with tumor aggression and poorer prognosis.28, 35 We therefore speculate that OPN, in cooperation with p53 mutations, may facilitate tumor cell growth and enhance portal vein invasion, leading to late-stage HCC and poorer prognosis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

The authors thank J. Y. Hsu, Ph.D. (Associate Professor, Department of Biochemistry, College of Medicine, National Taiwan University) for her helpful discussion.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES