Cyclophilin A is overexpressed in human pancreatic cancer cells and stimulates cell proliferation through CD147

Abstract

BACKGROUND

Although overexpression of cyclophilin A (CypA) is associated with several types of cancer, its role in pancreatic cancer has not been studied. In this study the expression of CypA and its receptor CD147 on pancreatic cancer was determined as well as the effect of exogenous CypA on pancreatic cancer cell proliferation.

METHODS

The expression of CypA and CD147 in human pancreatic cancer cell lines and tissues was determined with real-time reverse transcriptase polymerase chain reaction (RT-PCR), Western blot, and immunostaining. Cell proliferation in response to CypA was performed by [³H]thymidine incorporation assay. Phosphorylation of MAPK and cytokine secretion profiles in pancreatic cancer cells were determined by using the Bio-Plex phosphoprotein assay and cytokine assay.

RESULTS

Pancreatic cancer cell lines expressed significantly higher levels of CypA and CD147 than normal human pancreatic ductal epithelium (HPDE) cells. Expression of CypA and CD147 was also substantially higher in human pancreatic adenocarcinoma tissues than those in normal pancreatic tissues. Addition of exogenous CypA significantly stimulated pancreatic cancer cell proliferation in a dose-dependent manner and this effect was effectively blocked by pretreatment with anti-CD147 antibody. In addition, CypA activated ERK1/2 and p38 MAPK signaling pathways and increased the secretion of 2 key cytokines IL-5 and IL-17 in Panc-1 cells.

CONCLUSIONS

The expression of CypA and CD147 was significantly increased in both pancreatic cancer cell lines and tissues. Exogenous CypA promotes pancreatic cancer cell growth, which may be mediated through the interaction with CD147 and the activation of ERK1/2 and p38 MAPKs. Cancer 2006. © 2006 American Cancer Society.

Pancreatic cancer is the fourth leading cause of cancer-related deaths in North America. Although progress has recently been made in surgery, chemotherapy, and radiation therapy, the mortality rate of pancreatic cancer still remains high.1–5 The poor survival statistics are due to the fact that there are no reliable tests for early diagnosis and no effective therapies once the metastasis has occurred. Clearly, there is a need to understand the mechanisms of pancreatic carcinogenesis and to develop effective therapeutic treatments for pancreatic cancer.

Cyclophilin A (CypA) is a member of immunophilin family. It is a peptidylprolyl cis-trans-isomerase (PPIse), which makes it an important component in protein folding.6 CypA was originally identified as the intracellular receptor for cyclosporin A (CsA).7 Although CypA was initially thought to be present intracellularly, it was recently found to be secreted from cells in response to inflammatory stimulation.8 The secreted CypA has multiple functions in chemotaxis and cell signaling cascade through its cellular receptor, CD147. Recently, correlations of CypA with tumor pathogenesis have been studied. Campa et al.9 generated a protein expression profiling and determined macrophage migration inhibitory factor and CypA as the most dominantly expressed proteins in nonsmall cell lung carcinoma. A novel cyclophilin, which is similar to CypA, has been associated with metastasis and is overexpressed in bladder cancer, hepatocellular carcinoma, sarcoma, and breast carcinoma.10 However, there are no reports of CypA correlation with pancreatic cancer.

CD147 is a type I transmembrane glycoprotein with 2 immunoglobulin-like domains, and it is thought to be involved in inflammation, neural-glial interaction, virus infection, and tumor invasion.6, 11–13 Studies have shown that CypA binds to CD147 and transmits a signal to downstream cascades. CD147 is found to be highly expressed in human gliomas as compared with nonneoplastic brain tissues,14 and is expressed on melanoma cells and induces tumor cell invasion by stimulating production of matrix metalloproteinases (MMPs) by adjacent fibroblasts, resulting in tumor invasion and metastasis.15 However, the roles of CD147 in pancreatic cancer growth are not clear.

In the present study, we first examined the expression of CypA and CD147 in pancreatic cancer cell lines as well as clinical pancreatic adenocarcinoma specimens. We then focused on the effect of CypA interaction with CD147 on cell proliferation in Panc-1 cells, one of the pancreatic cancer cell lines. Furthermore, we studied the signaling pathways of mitogen-activated protein kinase (MAPK) as well as the secretion of cytokines, which may be involved in pancreatic cancer pathogenesis.

MATERIALS AND METHODS

Chemicals and Reagents

[³H]-labeled thymidine was purchased from Perkin Elmer (Boston, MA). The EGM-2 Bullet kit, trypsin-EDTA, and trypsin neutralization solution were purchased from Clonetics (Walkersville, MD). Recombinant human CypA was purchased from Sigma (St. Louis, MO). Rabbit anti-CypA antibody was purchased from Upstate (Charlottesville, VA). Mouse antihuman CD147 blocking antibody was purchased from Ancell (Bayport, MN) and mouse IgG1 irrelevant antibody control was purchased from R&D Systems (Minneapolis, MN).

Cell Culture and Tissue Specimen

Human pancreatic cancer cell lines (Panc-1, Panc 03.27, and ASPC-1) were obtained from the American Type Culture Collection (ATCC, Rockville, MD). Primary human umbilical vein endothelial cells (HUVECs) were purchased from Clonetics. The human pancreatic ductal epithelium (HPDE) cells were provided as a generous gift from Dr. Ming-Sound Tsao from the University of Toronto, Canada.16, 17 Panc-1 cells were cultured in Dulbecco modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS) at 37°C with 5% CO₂. Panc 03.27 and ASPC-1 cells were cultured in RPMI 1640 medium with 10% FBS at 37°C with 5% CO₂. HUVECs were grown in EGM-2 Bullet kit supplemented with 10% FBS. HPDE cells were cultured in keratinocyte serum-free (KSF) medium supplied with 5 ng/mL EGF and 50 μg/mL bovine pituitary extract (Invitrogen, Carlsbad, CA). Human pancreatic adenocarcinoma specimens and normal surrounding tissues were collected from patients who underwent surgery according to an approved human protocol (H7094) at the Baylor College of Medicine (Houston, TX).

RNA Extraction from Cells and Tissues

Total RNA was extracted from 3 pancreatic cancer cell lines (Panc-1, Panc 03.27, and ASPC-1 cells), as well as HPDE cells, HUVECs, 10 tissue specimens of pancreatic cancer and adjacent noncancer pancreatic tissues using an Ambion (Austin, TX) “RNAqueous-4PCR” kit following the manufacturer's instruction as described previously.18 Briefly, cells were lysed by Ambion lysis buffer and then transferred to an Ambion mini-column and centrifuged at 10,000g for 1 minute. The column was washed 3 times with wash buffer and eluted in 100 μL of elution buffer. RNA solution was treated with DNAse I to remove any trace amounts of genomic DNA contamination by using an Ambion DNA removing kit. For tissue specimen, the frozen tissue blocks were processed into 5-μm-thick slices using a Cryostat (Meyer Instruments, Houston, TX) at −20°C and soaked overnight in RNAlater-ICE buffer (Ambion) before being lysed in Ambion lysis buffer. The RNA was then extracted as described above.

Primer Designing

Specific primers for CypA and CD147 were designed with the Beacon Designer 2.1 software and the primer sequences are listed as follows. The homology between different subtypes and the template secondary structure were carefully examined and the primers were chosen to avoid the homologies. The lengths of all amplicons are between 75-150 bp. The primer sequences are for CypA: (sense) 5′ GTCAACCCCACCGTGTTCTTC 3′ and (antisense) 5′ TTTCTGCTGTCTTTGGGACCTTG 3′; for CD147: (sense) 5′ CCATGCTGGTCTGCAAGTCAG3′ and (antisense) 5′ CCGTTCATGAGGGCCTTGTC3′; for IL-5: (sense) 5′ CGTTTCAGAGCCATGAGGATGC 3′ and (antisense) 5′ GCCAAGGTCTCTTTCACCAATGC 3′; for IL-17: (sense) 5′ ATACCAATCCCAAAAGGTCCTCAG 3′ and (antisense) 5′ CACTTTGCCTCCCAGATCACAG 3′; and for the housekeeping gene β-actin: (sense) 5′ CTGGAACGGTGAAGGTGACA 3′ and (antisense) 5′ AAGGGACTTCCTGTAACAATGCA 3′.

Real-Time RT-PCR

The mRNA levels for CypA, CD147, IL-5, and IL-17 were analyzed by real-time reverse transcriptase polymerase chain reaction (RT-PCR) using the iCycler system (Bio-Rad, Hercules, CA). The mRNA was reverse-transcribed into cDNAs using the iScript cDNA synthesis kit (Bio-Rad). PCR reaction included the following components: 100 nM each primer, diluted cDNA templates and iQ SYBR Green supermix, running for 40 cycles at 95°C for 20 seconds and 60°C for 1 minute. Each cDNA sample was run in triplicate and the corresponding no-reverse transcriptase (RT) mRNA sample was included as a negative control. The β-actin primer was included in every plate to avoid sample variations. The mRNA level of each sample for each gene was normalized to that of the β-actin mRNA. The relative mRNA level was presented as unit values of 2^∧[Ct_(β-actin)–Ct_{(gene of interest)}].

Western Blot Analysis

Three pancreatic cancer cells as well as HPDE cells and HUVECs were lysed with ice-cold lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM Na₂EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, 1 μg/mL leupeptin, and protease inhibitor cocktail) for 30 minutes in ice. Cell lysates were then collected after centrifugation at 12,000 rpm for 5 minutes at 4°C. Sixty μg of lysate protein was loaded for CypA analysis. Total cellular protein was separated with 15% SDS-polyacrylamide gel electrophoresis and then transblotted overnight at 4°C onto Hybond-P PVDF membrane (Amersham Biosciences, Arlington Heights, IL). The membrane was probed with anti-CypA (1:1000) or anti-β-actin (1:3000) antibody at room temperature for 1 hour and then washed 3 times with 0.1% Tween 20-TBS and incubated in a horseradish peroxidase-linked secondary antibody (1:2000) for 1 hour at room temperature. The membrane was washed 3 times with 0.1% Tween 20-TBS and the immunoactive bands were detected by using an enhanced chemiluminescent (ECL) plus reagent kit.

Immunofluorescence and Immunohistochemistry Assay

Clinical human pancreatic adenocarcinoma and surrounding normal tissues were collected and processed into 5-μm slices. For immunofluorescence and immunohistochemistry analysis, fixed cells or tissue slides were incubated with anti-CypA or anti-CD147 antibodies for 30 minutes at 4°C and incubated with secondary antibodies conjugated with fluorescein isothiocyanate (FITC; Vector Laboratories, Burlingame, CA), for another 30 minutes at 4°C. After washing with phosphate-buffered saline (PBS) 3 times, slides were mounted with Texas Red mounting medium and observed with an Olympus BX41 microscope (Melville, NY). Images were captured with an attached SPOT-RT digital camera (Diagnostic Instruments, Sterling Heights, MI). For diaminobenzidine (DAB) visualization, slides were incubated with an avidin-biotin-peroxidase solution (Vectastain ABC Elite kit; Vector) at room temperature for 1 hour, followed by 0.1% DAB and 0.003% H₂O₂ in TBS for 5-10 minutes. The reaction was terminated by rinsing in tap water and the sections were then mounted and observed under a microscope.

Cell Proliferation Assay

Panc-1 cells were seeded in 96-well plates (2 × 10³ cells/well) and serum-starved (0% FBS) for 24 hours before adding human recombinant CypA (0.01, 0.1 1.0, and 10 nM) or PBS as a control. After 6 hours, 1 μCi/mL [³H]-thymidine was added to each well. Cells were incubated further for another 18 hours and then [³H]-thymidine incorporation was measured in scintillation solution using a microplate scintillation and luminescence counter (Packard Biosciences, Meriden, CT). For blocking assay, Panc-1 cells were incubated with an anti-CD147 neutralizing antibody, or an irrelevant IgG1 antibody for 1 hour at 37°C, before adding CypA (10 nM) or PBS. After 6 hours, 1 μCi/mL [³H]-thymidine was added to each well and incubated for another 18 hours. Cell proliferation rate was measured by [³H]-thymidine incorporation as described above.

Bio-Plex Phosphoprotein Assay

Cells at 1.5 × 10⁵/mL were treated with CypA (10 nM) for 5, 15, 30, or 60 minutes. Protein lysates were prepared using Cell lysis kit (Bio-Rad) on samples collected at each indicated timepoint. The presence of p-ERK1/2 and p-p38 MAPK were detected by Bio-Plex 4-plex phosphoprotein assay kit (Bio-Rad) and the Phosphoprotein Testing Reagent kit (Bio-Rad) according to the manufacturer's protocol as described previously.19, 20 Briefly, 50 μL of cell lysate (adjusted to a concentration of 100-450 μg/mL of protein) was plated in the 96-well filter plate coated with anti-p-ERK1/2 and p-p38 antibodies and incubated overnight on a platform shaker at 300 rpm at room temperature. After a series of washes to remove the unbound proteins, a mixture of biotinylated detection antibodies, each specific for a different epitope, was added to the reaction, resulting in the formation of sandwiches of antibodies around the target proteins. Streptavidin-phycoerythrin (streptavidin-PE) was then added to bind to the biotinylated detection antibodies on the bead surface. Data from the reaction was then acquired and analyzed using the Bio-Plex suspension array system (Luminex 100 system) from Bio-Rad Laboratories. The total proteins for ERK and p38 MAPKs were tested using the Bio-Plex 4-plex total protein assay kit (Bio-Rad).

Bio-Plex Cytokine Assay

Panc-1 cells were treated with 10 nM of CypA for 24 hours and the supernatant was collected. For blocking assay, Panc-1 cells were incubated with an anti-CD147 neutralizing antibody or an irrelevant IgG1 antibody as a negative control for 1 hour at 37°C before adding CypA (10 nM). Cytokine concentrations were determined using the Bio-Plex multiplex Human Cytokine Assay kit (Bio-Rad) and the Cytokine Reagent kit (Bio-Rad) according to the manufacturer's protocol as described previously.19, 20 Briefly, 50 μL of culture supernatants or cytokine standards were plated in a 96-well filter plate coated with a multiplex of antibodies against the above-mentioned cytokines and incubated overnight on a platform shaker at 300 rpm at room temperature. Data from the reaction were then acquired and analyzed using the Bio-Plex suspension array system (Luminex 100 system) from Bio-Rad Laboratories as described above.

Statistical Analysis

Data from real-time PCR, [³H]-thymidine incorporation, and Bio-Plex assay are expressed as mean ± standard error of the mean (SEM). Significant differences were determined by paired Student t-test (2 tails).

RESULTS

mRNA Levels of CypA and CD147 Are Increased in Human Pancreatic Cancer Cell Lines and Pancreatic Adenocarcinoma Tissues

To investigate the expression levels of CypA and its receptor CD147 in human pancreatic cancer, we quantified and compared the mRNA levels of CypA and CD147 in 3 human pancreatic cancer cell lines (Panc-1, Panc 03.27, and ASPC-1) as well as in HPDE cells and HUVECs as nontumor cell controls. The mRNA level was quantified by real-time RT-PCR using specifically designed primers for CypA and CD147. β-Actin was used as the housekeeping gene to avoid variation between different samples. The threshold cycle (Ct) values, which represented the relative amount of the mRNA molecules, were compared between different cell lines and different genes. All pancreatic cancer cell lines expressed significantly higher levels of CypA mRNA and moderate levels of CD147 than HPDE cells and HUVECs (Fig. 1A; P<.05). Panc-1, ASPC-1, and Panc 03.27 cells showed high expression of CypA and represented 261%, 179%, and 152% of that in HPDE cells, and 314%, 215%, and 182% of that in HUVEC cells, respectively. In addition, Panc 03.27, Panc-1, and ASPC-1 cells significantly overexpressed CD147 mRNA and represented 148%, 139%, and 134% of that in HPDE cells, and 224%, 210%, and 204% of that in HUVEC cells, respectively (Fig. 1A; P<.05).

Figure 1. Expression of CypA and CD147 mRNA in pancreatic cancer cells, HPDE cells, HUVECs, and pancreatic tissues. (A) Relative mRNA levels in pancreatic cancer cells, HPDE cells, and HUVECs. (B) Relative mRNA levels in pancreatic adenocarcinoma and normal tissues. mRNA level of each sample for each gene was normalized to that of β-actin mRNA. Relative mRNA level was presented as 2∧[Ct_(β-actin)–Ct_{(gene of interest)}]. All data shown are the mean ± SEM of three separate experiments. *P<.05 and **P<.01 as compared with HPDE cells.

To correlate CypA and CD147 overexpression in pancreatic cancer, 10 pancreatic adenocarcinoma surgical specimens and their surrounding normal pancreatic tissues were collected from the operating room under an approved Internal Review Board (IRB) protocol. Tissue RNAs were extracted and the expression of CypA and CD147 was detected by real-time RT-PCR. As shown in Figure 1B, the pancreatic adenocarcinoma specimens had a 2.85- and 1.46-fold increase of CypA and CD147 mRNA levels, respectively, as compared with their adjacent normal pancreatic tissues (P<.05), and the percentages of the tumor tissues overexpressing CypA and CD147 were 60% and 70%, respectively.

Protein Levels of CypA and CD147 Are Increased in Pancreatic Cancer Cells and Pancreatic Adenocarcinoma Tissues

To confirm protein expression of CypA and CD147 in pancreatic cancer cells, we used Western blot and immunofluorescence staining to detect protein levels of CypA and CD147 in these cells. As shown in Figure 2A,B, CypA protein band density was significantly increased in all pancreatic cancer cell lines (Panc-1, Panc 03.27, and ASPC-1), and represented 210%, 170%, and 270% as compared with that in HPDE cells (P<.05). Because CD147 is a surface protein, we used surface immunofluorescence staining to detect both the expression and localization of CD147 in Panc-1 cells with an anti-CD147 antibody. As shown in Figure 2B, CD147 protein was positively stained in Panc-1 cells and represented a typical surface staining. These protein data of CypA and CD147 are consistent with the mRNA results described above.

Figure 2. Protein expression of CypA and CD147 in pancreatic cancer cells. (A) Overexpression of CypA in pancreatic cancer cells detected by Western blot. Specific anti-CypA Ab (1:1000) was used to probe the protein bands. The density of each protein band was determined and plotted. *P <.05 and **P <.01 as compared with HPDE cells. (B) CD147 overexpression in Panc-1 cells detected by surface immunofluorescence staining. Anti-CD147 Ab (1:100) was used as a primary antibody followed by FITC-conjugated secondary Abs (1:80). Nuclei were counterstained with Texas Red. Green color represents positive staining of CD147.

To further confirm the CypA and CD147 protein levels in human pancreatic cancer tissues, the pancreatic adenocarcinoma as well as adjacent normal pancreatic tissues were processed and stained with anti-CypA and anti-CD147 antibodies, respectively. As shown in Figure 3, CypA immunostaining was substantially higher in pancreatic adenocarcinoma tissues (Fig. 3B) than in adjacent normal pancreas tissues (Fig. 3A). Similarly, the immunoreactivity of CD147 in tumor tissues (Fig. 3D) was higher than that of normal tissues (Fig. 3C). These clinical specimen stainings were consistent with findings of the overexpression patterns of CypA and CD147 in pancreatic cancer cell lines.

Figure 3. Overexpression of CypA and CD147 in pancreatic adenocarcinoma tissues. (A) Normal pancreatic tissue composed of acinar cells and ductal epithelial cells with very weak immunostaining of CypA. (B) Pancreatic ductal adenocarcinoma with strong immunostaining of CypA. (C) Normal pancreatic tissue with very weak immunostaining of CD147. (D) Pancreatic ductal adenocarcinoma with strong immunostaining of CD147. Dark brown color represents positive staining of CypA and CD147. N: normal ductal epithelial cells; T: tumor epithelial cells.

CypA Stimulates Pancreatic Cancer Cell Proliferation through Its Receptor CD147

CypA is a multifunctional cytokine that plays an important role in angiogenesis and endothelial cell proliferation.21 To examine whether CypA could stimulate the proliferation of pancreatic cancer cells, we incubated Panc-1 cells with human recombinant CypA at various concentrations for 24 hours. Cell proliferation was detected by [³H]-thymidine incorporation assay. As shown in Figure 4, in the presence of a low concentration of CypA (0.1 nM) there was a significant increase of cell proliferation up to 21% over that of control cells (P<.05). Upon the addition of a higher concentration of CypA at 10 nM, Panc-1 cell proliferation was significantly increased by 35% as compared with controls (P<.01). To further confirm if CD147 could be involved in CypA-induced cell proliferation, specific anti-CD147 antibody was utilized to block CypA action. Interestingly, when 5 μg/mL of anti-CD147 antibody was incubated with Panc-1 cells for 1 hour at 37°C before treatment with CypA, CypA-induced cell proliferation was substantially blocked to the level similar to that in the control group, whereas the irrelevant isotype control IgG1 antibody did not significantly affect the CypA-induced cell proliferation (Fig. 4). Thus, CD147, the receptor for secreted CypA, may mediate CypA-induced cell proliferation in Panc-1 cells. To further confirm the effect of CypA in other pancreatic cancer cells, we also examined the cell proliferation in Hs766T and Panc 03.27 cells, in which CypA are both overexpressed, upon CypA treatment. We found that the exogenous CypA (1 nM) caused a significant increase of cell proliferation by 79% and 16% in Hs766T and Panc 03.27 cells, respectively, as compared with untreated control cells (P <.05).

Figure 4. Effects of CypA and anti-CD147 antibody on Panc-1 cell proliferation. Serum-starved Panc-1 cells were treated with the indicated concentrations of CypA or PBS for 24 hours and labeled with [³H]-thymidine at 1 μCi/mL 6 hours later. For blocking, serum-starved Panc-1 cells were incubated with anti-CD147 blocking antibody (5 μg/mL) 1 hour before addition of CypA. Irrelevant isotype antibody mouse IgG1 (5 μg/mL) was included as a control. [³H]-thymidine incorporation was measured in scintillation solution. Data are expressed as mean ± SEM of triplicate values from 2 separate experiments. *P<.05 and **P<.01 as compared with controls.

CypA Stimulates ERK1/2 and p38 MAPK Activation in Panc-1 Cells

To investigate the possible signaling pathways involved in CypA-induced cell proliferation, we examined the changes of phosphorylation levels of ERK1/2 and p38 MAPK levels in Panc-1 cells stimulated with CypA for 5, 15, 30, or 60 minutes. As shown in Figure 5A, CypA increased ERK1/2 phosphorylation as early as 5 minutes and continued to increase by 57% at 15 minutes. The level of ERK1/2 phosphorylation dropped below normal at 30 and 60 minutes after CypA stimulation. Similarly, phosphorylated p38 was increased to 20% as early as 5 minutes and gradually reduced below normal levels after 15 minutes (Fig. 5B). In addition, there was no detectable alteration of phosphorylated JNK protein during CypA treatment (data not shown). Thus, CypA activates ERK1/2 and p38 MAPK in Panc-1 cells.

Figure 5. CypA induces phosphorylation and activation of ERK1/2 and p38 MAPK. Panc-1 cells were treated with 10 nM CypA for 5, 15, 30, or 60 minutes. Proteins extracted from samples collected at the indicated timepoints were tested for the presence of phosphorylated and total ERK or p38 MAPK by Bio-Plex phosphoprotein and total protein assay kits. The values plotted show the ratio of phosphoprotein to total protein. (A) ERK1/2. (B) p38 MAPK. Data are expressed as mean ± SEM of triplicate values from 2 separate experiments.

CypA Significantly Stimulates IL-5 and IL-17 Production in Panc-1 Cells through CD147

To assess whether CypA could affect cytokine production in Panc-1 cells, a Bio-Plex cytokine assay was used to determine 17 different cytokine levels in Panc-1 cells. Upon CypA treatment, production of IL-5 was significantly increased by 41% and IL-17 by 1281% as compared with controls (Fig. 6A,B, P <.05). CypA-induced production of IL-5 and IL-17 could be effectively blocked by anti-CD147 antibody but not by irrelevant isotype antibody control (Fig. 6). Thus, the interaction of CypA and CD147 may be responsible for the up-regulation of IL-5 and IL-17 cytokines in pancreatic cancer cells.

Figure 6. Effect of CypA on cytokine secretion in Panc-1 cells. Supernatants from CypA-treated Panc-1 cells were collected after 24 hours. For blocking assay, Panc-1 cells were incubated with anti-CD147 neutralizing antibodies or irrelevant IgG1 antibodies as negative controls for 1 hour at 37°C before adding CypA (10 nM). Cytokine levels were determined by Bio-Plex cytokine assay. (A) IL-5. (B) IL-17. The values plotted are the percentage of CypA-treated to the nontreated Panc-1 cells. Data are expressed as mean ± SEM of triplicate values from 2 separate experiments. *P<.05 and **P<.01 as compared with controls.

Elevated IL-5 Level Is Correlated with CypA and CD147 Overexpression in Human Pancreatic Cancer

To further investigate whether IL-5 or IL-17 levels are upregulated in human pancreatic cancer and whether the levels are correlated with CypA and/or CD147 overexpression, we examined and compared the expression levels of IL-5, IL17, CypA, and CD147 in pancreatic adenocarcinoma tissues and their surrounding normal pancreatic tissues of surgical specimens from 7 patients by real-time RT-PCR. As shown in Figure 7A, 5 of 7 pancreatic cancer tumor tissues overexpressed IL-5 and the tumor tissues had an overall 2.53-fold increase of IL-5 mRNA as compared with their surrounding normal pancreatic tissues. The elevated IL-5 level was well correlated with CypA (Fig. 7B) and CD147 (Fig. 7C) overexpression in pancreatic cancer tissues. However, the IL-17 mRNA level was very low in both pancreatic cancer and normal pancreatic tissues (data not shown). Therefore, IL-5 is up-regulated and correlated with overexpressed CypA and CD147 levels in human pancreatic cancer tissue samples.

Figure 7. Expression of IL-5, CypA, and CD147 mRNA in human pancreatic tissues. Relative mRNA levels of (A) IL-5, (B) CypA, and (C) CD147 in pancreatic adenocarcinoma and its surrounding normal tissues were assessed by real-time RT-PCR. The mRNA level of each sample for each gene was normalized to that of β-actin mRNA. Relative mRNA level was presented as 2∧[Ct_(β-actin) – Ct_{(gene of interest)}]. All data shown are the mean ± SEM of triplicate values of three separate experiments. *P < .05 and **P < .01 as compared with normal control.

DISCUSSION

We have shown that all three pancreatic cancer cell lines express significantly high levels of CypA and CD147. Additionally, we observed overexpression of CypA and CD147 in human pancreatic adenocarcinoma tissues as compared with adjacent normal pancreatic tissues. Interestingly, exogenous CypA could stimulate Panc-1 cell proliferation in a dose-dependent manner. Furthermore, we have shown that CypA treatment could significantly increase IL-5 and IL-17 secretion in Panc-1 cells. We also found that IL-5 is up-regulated in human pancreatic cancer tissues and the expression level of IL-5 is well correlated with that of CypA and CD147 in human pancreatic cancer. These effects of CypA may be mediated by interaction with CD147 and activation of ERK1/2 and p38 MAPKs. These data suggest, for the first time, that CypA and CD147 may be involved in pancreatic cancer pathogenesis.

CypA is a multifunction cytokine involved in many biological processes, including protein folding, immunosuppression, cellular signaling, and apoptosis. CypA has been shown to be a secreted growth factor induced by oxidative stress and stimulates ERK1/2 pathway and cell proliferation in vascular smooth muscle cells (VSMCs).22 In neuronal cells, where CypA has been shown to be most highly concentrated, augmented cell proliferation of human embryonic brain cells in response to CypA stimulation was found.23 However, studies of correlation between CypA and cancers are limited. Only recently, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis in lung cancer indicated that the overexpressed CypA was strongly correlated with malignant lung cancer cells, whereas negative expression of CypA was found in normal lung tissues. The cytosolic concentration of CypA in T-cell acute lymphocytic leukemias and in mucosal cells from colonic tumors was found to be higher than that in the normal cells.24, 25 There have not been any studies performed in pancreatic cancer on CypA and cancer pathogenesis. Our current study revealed the important clue in CypA involvement in human pancreatic cancer. In both mRNA and protein levels, we found that CypA and CD147 were overexpressed in pancreatic cancer cells and tissues. Furthermore, we discovered that CypA could stimulate cell proliferation in Panc-1 cells in a dose-dependent manner and the stimulation was mediated by the cell-surface CypA receptor CD147. This is the first evidence that indicates the important role of CypA in pancreatic cancer pathogenesis.

CD147 is a transmembrane receptor protein involved in neuronal function, inflammation, tumor invasion, and metastasis.6 Previous studies have shown that CD147 is highly expressed in melanoma and glioma cells, and induces tumor invasion by stimulating generation of MMPs by adjacent fibroblast cells or other stromal cells.14, 15 Although normal cells also express CD147, it seems that CD147 is highly expressed in many human cancer cells,26–30 and the tumor-specific induction of MMPs in facilitating tumor invasion and metastasis caused by CD147 may be due to different glycosylation or modification of CD147 molecules in tumor cells as compared with the normal cells.6 Transfection of CD147 cDNA into slow-growing breast cancer cells in vivo turned them into more tumorigenic and invasive cancer cells as compared with the mock transfected cells.31 The current study indicated that CD147 was overexpressed in pancreatic cancer cell lines and tissues and served as the major player in CypA-CD147 interaction to promote cell proliferation in pancreatic cancer cells. Because CypA is a multifunctional protein that is involved in many basic cell functions such as protein folding and mitochondrial functions, an siRNA knocked-down CypA approach may affect cell survival. An siRNA approach may not apply to the exogenous CypA, which may play a role similar to a cytokine or growth factor. Alternatively, using an antibody blocking approach, our study showed that using CD147 blocking antibody could specifically block the effect of exogenous CypA on pancreatic cancer cell proliferation in Panc-1 cells. Our results suggest that CD147 plays an important and specific role in pancreatic cancer cell proliferation, and might serve as a key signal transducer in pancreatic cancer pathogenesis.

It has been shown that CypA serves as a secreted growth factor induced by oxidative stress and promotes cell proliferation in VSMCs through the ERK1/2 pathway.22 Our results suggest that CypA increases phosphorylation of ERK1/2 and p38 as early as 5 minutes in human pancreatic cancer cells. Our data provide evidence that CypA stimulates proliferation of Panc-1 cells through its cellular receptor CD147 by activating the ERK1/2 and p38 pathways, the most common signal pathways shared by other growth factors. Whether or not there are other signal transduction pathways involved in the CypA-CD147 system in human pancreatic cancer cells and what the underlying mechanisms of the CypA-induced cell proliferation are warranted for further investigation.

Most solid tumors are surrounded by a variety of nontumor cells, including stromal cells, immune cells, and blood-vessel cells, which are critical components in inflammation. Although the functional link between inflammation and cancer has not been elucidated, several studies have shown the involvement of inflammatory or proinflammatory mediators (cytokines) in cancer development. Among those factors, NF-κB and TNF-α seem to be the central players for linking inflammation with cancer development.32, 33 Our results indicate that CypA induces the secretion of Th2 types of cytokines, IL-5 and IL-17, by Panc-1 cells, and this increased cytokine secretion is effectively blocked by anti-CD147 antibody, but not by isotype control antibody. IL-5 is mostly secreted by T cells, and its primary function is involved in the pathogenesis of atopic diseases. IL-5 regulates the production, activation, and localization of eosinophils, causing tissue damages in atopic diseases.34 IL-5 is also detectable in tumors, such as cutaneous T-cell lymphoma and Hodgkin disease.35–38 IL-17 is reported to be secreted exclusively by T cells, especially activated CD4⁺ T cells, and induces stromal cells to secrete several proinflammatory and hematopoietic factors such as TNF-α, IL-1β, Il-6, IL-10, and IL-12. IL-17 also stimulates the secretion of several chemokines containing NF-κB binding sites in their promoters, including IL-8 and monocyte chemoattractant protein-1 (MCP-1).39–41 In the current study, we found that IL-5 but not IL-17 is up-regulated in human pancreatic cancer tissues and the expression level of IL-5 is well correlated with CypA and CD147 overexpression in human pancreatic cancer. Interestingly, addition of a large amount of exogenous CypA significantly increases both IL-5 and IL-17 production in pancreatic cancer cells in vitro. Our results and others may indicate potential therapeutic targets for treatment of pancreatic cancer aiming at cytokines.33, 42

In summary, the current study demonstrates the potential roles and molecular mechanisms of CypA and CD147 in pancreatic cancer pathogeneses. It also opens up a door for studies of cytokine involvement in pancreatic cancer development. Further investigations on the detailed molecular mechanisms and potential therapeutic values of CypA, CD147, IL-5, and IL-17 for pancreatic cancer are warranted.

Acknowledgements

The authors thank Dr. Craig Logsdon for critical suggestions for this article.