SEARCH

SEARCH BY CITATION

Keywords:

  • p53 polymorphism;
  • cancer risk;
  • high-risk human papillomavirus (HR-HPV)-positive;
  • oropharyngeal squamous cell carcinoma

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

BACKGROUND.

Tobacco smoking, alcohol abuse, and high-risk human papillomavirus (HPV) are risk factors in the etiology of oropharyngeal squamous cell carcinomas (SCCs). The TP53 polymorphism, in which an arginine (R) is changed to proline (P) at codon 72, is functionally significant and could therefore be a predisposing genetic defect.

METHODS.

The aim of the study was to investigate the role of codon 72 polymorphism by means of double gradient-denaturing gel electrophoresis in 77 oropharyngeal SCC patients including 33 TP53 mutated and 16 HPV-16-positive cases. The controls consisted of 141 consecutive healthy blood donors.

RESULTS.

The cases and controls showed significantly different genotype distribution (P = .0005): the frequencies of the RR, RP, and PP genotypes among the cases were, respectively, 81.8%, 10.4%, and 7.8%, as opposed to 59.6%, 33.3%, and 7.1% among the controls, in agreement with the Hardy-Weinberg equilibrium (P = .35). The PP genotype was significantly overrepresented among females (22.2% vs 3.4%; P = .0243) and in HPV-16-positive cases (25.0% vs 3.3%; P = .0152). No segregation was found between either of the codon 72 genotypes and age or TP53 mutations.

CONCLUSIONS.

The significantly lower frequency of the RP genotype in the patients as a whole suggests that it has a protective effect on oropharyngeal SCCs. Moreover, the PP genotype may be a risk factor for the development of oropharyngeal SCC by females and the development of HPV-16-related SCC, although the findings need to be validated in a larger number of tumors. Cancer 2007. © 2007 American Cancer Society.

Oropharyngeal squamous cell carcinomas (SCCs) are multifactor tumors mainly correlated with high-risk human papillomavirus (HR-HPV), tobacco smoke, alcohol abuse, and molecular alterations such as TP53 mutations and the p16INK4a deletion.1–3 However, because other predisposing genetic defects cannot be ruled out, it could be interesting to verify whether the functionally significant, single nucleotide codon 72 polymorphism in the TP53 gene encoding arginine (R) or proline (P) influences the risk of developing this malignancy and, in the case of developed tumors, the prognosis and predictivity of response to treatments. It is known, for example, that the R72 and P72 forms have distinct biochemical and biologic properties that affect the apoptotic and transcriptional activity of the p53 protein.4–6

The codon 72 polymorphism in head and neck SCC (HNSCC) appears to have a marginal impact on the susceptibility to HNSCC as a whole.7–12 However, the RP genotype appears to predict a moderately increased risk of developing oropharyngeal and hypopharyngeal SCC,13 and the P allele appears to be associated with an early age of onset of oral cavity SCC.12

Furthermore, despite the greater susceptibility of the R72 form to degradation mediated by the HPV E6 protein,14 to our knowledge there is no consensus regarding the still unclear association between codon 72 polymorphism and HPV-related HNSCC. Some authors have reported a striking reduction in the frequency of PP in the case of HPV-positive oral SCCs, thus suggesting that the RR genotype may be more susceptible to HPV,10, 15 whereas others have found no significant differences in genotype distribution between HPV-positive and HPV-negative oral SCCs.11, 13, 16

To verify the role of TP53 polymorphisms in oropharyngeal SCCs, we analyzed the distribution of the codon 72 genotypes in a series of HPV-16-positive and HPV-16-negative cases and compared them with a group of healthy controls. Our data suggest that the RP genotype is associated with a reduction in the risk of developing oropharyngeal SCC, whereas the PP genotype is associated with an increased risk for the development of SCC by females and the development of HPV-16-related SCCs.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Samples

In this study, we successfully analyzed 77 of 90 oropharyngeal SCCs from a single cohort of patients surgically treated at the National Cancer Institute of Milan, and previously characterized in terms of HPV DNA-RNA (types 16 and 18), physical status, and TP53 mutations.2, 3 Reliable information regarding smoking and alcohol life-habits of patients was not systematically available.

To evaluate possible effects of the polymorphism on cancer risk, the oropharyngeal SCC patients were frequency-matched to cancer-free control subjects selected in this institution. These controls consisted of 141 consecutive healthy blood donors (a patient/control ratio of approximately 1:2) who were first surveyed by means of a questionnaire to determine their suitability to be a blood donor and to obtain information regarding demographic factors. This control group included 79 men and 62 women (mean age, 53 years; range, 31–70 years) who were homogeneous in terms of race (white) and residence (Italy), the 2 major determinants of variations in the p53 codon 72 polymorphisms.17

TP53 Genotype at Codon 72

DNA was isolated from formalin-fixed, paraffin-embedded tumor sections and peripheral blood lymphocytes following the instructions of the DNA purification kit (Qiagen, Chatsworth, Calif).

TP53 genotyping at codon 72 was performed by means of double gradient-denaturing gel electrophoresis (DG-DGGE) polymerase chain reaction (PCR) analysis using a 2-step PCR protocol as previously described.17 The first amplification step used 50 ng of DNA and the forward primer 5′-CAAGGGTTGGGCTGGGACCT-3′ and reverse primer 5′-AGAGGAATCCCAAAGTTCCA-3′. The PCR profile was 3 minutes at 94°C, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 64°C, and 1 minute at 62°C; 10 cycles of 30 seconds at 94°C, and 30 seconds at 62°C; and 1 minute at 72°C; and finally 5 minutes at 72°C.

Seven microliters of the amplification product were used as a DNA template for the second amplification step with the specific primers: forward 5′-CGCCCGCCGCGC CCCGCGCCCGTCCCGCCGCCCCC GCCCCGCCTGGTCCTCTGACTGCTCT-3′ and reverse: 5′-GTGTAGGAGCTGCTGGTGCA-3′. This amplification step was performed under the same PCR conditions as those described above except for an additional final cycle of 10 minutes at 95°C and 1 hour at 56°C. The gels containing a 35% to 75% denaturing and a 6.5% to 12% porosity gradient were run at 4 V/cm for 16 hours in 1× Tris-acetate/ethylenediamine tetraacetic acid (EDTA) (TAE) buffer kept at a constant temperature of 60°C. The controls were 3 ovarian cancer samples carrying the RR, RP, and PP genotypes, each characterized by means of automatic sequencing. After electrophoresis the gels were stained with ethidium bromide and the specific genotype of the samples was identified by comparing their mobility shift with those of the controls of a known genotype.

Statistical Analysis

The TP53 polymorphism data were described by reporting the absolute frequencies and corresponding percentages of the RR, RP, and PP genotypes in the oropharyngeal SCC cases and controls as a whole or in subgroups defined by age (≤55 years vs >55 years), gender (male vs female), TP53 type (wild-type vs mutated), and HR-HPV status (negative vs positive).

We compared the observed and expected genotype frequencies in the controls using the Hardy-Weinberg equilibrium theory. Fisher exact tests were used to assess the differences in the frequencies of genotypes and the individual alleles between the cases and controls, as well as between the subgroups. Exact odds ratios (ORs) and the corresponding 95% confidence intervals (95% CIs) were also computed as a measure of association, using the prevalent RR genotype as the reference: ORs equal to 1 denote the absence of association, whereas those that are more (or less) than 1 indicate a genotype that is overrepresented (or underrepresented) in the cases compared with controls.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

TP53 Codon 72 Polymorphism

The 77 patients included 59 males and 18 females (mean age, 58 years; range, 32–76 years). The corresponding oropharyngeal SCCs were TP53 mutated in 33 patients, wild-type TP53 in 44 patients, HPV-16-positive in 16 patients, and HPV-16-negative in 61 patients. None showed HPV-18 DNA.

The distribution of TP53 codon 72 polymorphisms in the oropharyngeal SCC cases and controls is shown in Table 1. The frequencies of the RR, RP, and PP genotypes among the controls were, respectively, 59.6%, 33.3%, and 7.1%, in agreement with Hardy-Weinberg equilibrium (exact P = .35); the corresponding figures among the cases were 81.8%, 10.4%, and 7.8%. The overall difference was statistically significant (P = .0005), and corresponded to a more frequent R allele (from 76.2% in controls to 87.0% in the cases) and a less frequent P allele (from 23.8% in controls to 13.0% in the cases).

Table 1. Distribution of TP53 Codon 72 Polymorphism Among Oropharyngeal SCC and Control Subjects
GenotypeCasesControlsOR (95% CI)*P
No.%No.%
  • SCC indicates squamous cell carcinoma; OR, odds ratio; 95% CI, 95% confidence interval; R, arginine; P, proline; HPV, human papillomavirus.

  • OR estimates with 95% CIs, and Fisher exact P for testing the difference in genotype distribution between cases and controls.

  • *

    With regard to TP53 and HPV-16 status, representing tumor characteristics, the reference distribution for ORs computation is that of the controls.

Overall series (77 cases)
 RR6381.88459.61.00 
 RP810.44733.30.23 (0.09–0.53).0005
 PP67.8107.10.80 (0.23–2.59) 
Age ≤55 y (30 cases)
 RR2273.44959.81.00 
 RP413.33036.60.30 (0.07–1.01).0142
 PP413.333.62.97 (0.45–21.7) 
Age >55 y (47 cases)
 RR4187.23559.31.00 
 RP48.51728.80.20 (0.05–0.70).0061
 PP24.3711.90.24 (0.02–1.41) 
Sex: 59 men
 RR5186.44253.21.0 
 RP610.23038.00.17 (0.05–0.46).0001
 PP23.478.80.24 (0.02–1.34) 
Sex: 18 women
 RR1266.74267.81.0 
 RP211.11727.40.41 (0.04–2.19).0449
 PP422.234.84.67 (0.67–35.3) 
TP53 status: 44 wild-type*
 RR3681.81.00 
 RP49.10.20 (0.05–0.61).0036
 PP49.10.47 (0.05–2.37) 
TP53 status: 33 mutant
 RR2781.81.00 
 RP412.10.27 (0.06–0.83).0354
 PP26.10.62 (0.06–3.21) 
HPV-16 status: 61 negative
 RR5285.21.00 
 RP711.50.24 (0.09–0.59).0009
 PP23.30.32 (0.03–1.61) 
HPV-16 status: 16 positive
 RR1168.81.00 
 RP16.20.16 (0.01–1.19).0099
 PP425.03.06 (0.59–13.0) 

The RP genotype was significantly underrepresented among the cases (OR = 0.23, 95% CI, 0.09–0.53 [P<.0001]), whereas the frequency of the PP genotype among the cases as a whole was similar to those among the controls.

Subgroup Analyses

The distribution of the TP53 codon 72 polymorphisms in the subgroups defined by age, gender, TP53, and HPV-16 status is shown in Table 1.

Among the controls, the genotype distribution was not significantly different between the subjects aged ≤55 years and those aged >55 years (P = .15), or between males and females (P = .21).

Among the SCCs the genotype distribution was not significantly different between the subjects aged ≤55 years and those aged >55 years (P = .21) or between those with a wild-type or mutated TP53 (P = .83), whereas there was a difference between females and males (P = .0366), and between HPV-16-positive and HPV-16-negative SCCs (P = .0258). In detail, the PP genotype was significantly overrepresented among females (4 of 18 [22.2%] vs 2 of 59 [3.4%] in males; P = .0243) and HPV-16-positive SCCs (4 of 16 [25%] vs 2 of 61 [3.3%] in HPV-16-negative cases; P = .0152).

The HPV-16-positive patients include 10 males and 6 females and the genotype distribution in subjects cross-classified by HPV-16 status and sex is shown in Table 2. The results indicate that the increase in the PP genotype is associated with each of the 2 characteristics, independently from each other. In detail, the percentage of the PP genotype increased in female versus male gender both in HPV-16-positive (10% to 50%) and HPV-16-negative (2% to 8.3%) cases. At the same time, the frequency of the PP genotype increased in HPV-16-positive versus HPV-16-negative cases both in males (2% to 10%) and in females (8.3% to 50%). In all conditions the rate of the relative increase was approximately 4–5 times.

Table 2. Distribution of TP53 Codon 72 Polymorphism in Subjects Cross-Classified by Sex and HPV-16 Status
GenotypeMenWomen
No.%No.%
  1. HPV indicates human papillomavirus; R, arginine; P, proline.

HPV-16-positive: 16 cases
 RR880.0350.0
 RP110.00 
 PP110.0350.0
HPV-16-negative: 61 cases
 RR4387.8975.0
 RP510.2216.7
 PP12.018.3

Furthermore, the association pattern for a decreased RP genotype in the series of SCC as a whole compared with the controls was consistent in all of the subgroups, with ORs varying little, with an average value of 0.23.

The profile of the PP genotype was less stable. The corresponding ORs were usually below 1, thus reproducing what was observed in the series as a whole, albeit with some exceptions; as mentioned, the PP genotype is overrepresented in females (22.2%) and in the HPV-16-positive cases (25.0%).

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

The aim of this study was to investigate the distribution of TP53 codon 72 genotypes in a series of 77 patients with oropharyngeal SCCs (16 of which were positive and 61 negative for HPV-16) and 141 healthy subjects to verify the impact of this amino acid variability on the risk of developing the tumor.

The results showed a significant difference in genotype distribution between the cases and controls, and the definite decrease in the frequency of the RP genotype among the cases was consistent with an association between it and decreased susceptibility to oropharyngeal SCCs. The anatomic tumor site may explain the discrepancy between our data and those of Scheckenbach et al.,13 who found that individuals with an RP genotype had a moderately increased risk of developing SCC of the pharynx, including both oropharyngeal and hypopharyngeal tumors.

We can speculate that the protective effect of the RP genotype against oropharyngeal SCC may be due to a functional combination of the 2 p53 polymorphic forms, which have different biochemical and biological properties. In keeping with this finding, it has been demonstrated that R72 has a greater capacity to induce apoptosis than P72,5 whereas P72 has greater transcriptional transactivation ability6 and induces more cell cycle arrest in G1.4

In relation to HPV16-positive SCCs, our findings indicated a significant association between the PP genotype and HPV-16-positivity (P = .0152). The greater frequency of PP in HPV-16-positive tumors indicates that it may represent a risk factor for developing HPV-16-related oropharyngeal SCCs, which may be related to the reduced capacity of the P72 form to induce apoptosis in comparison with R72, as has been postulated in the case of non-HPV-related tumor types.18–21 One other study,10 which included 8 HPV-positive HNSCC tumors, found that the PP genotype was associated with HPV-negative tumors; however, our data is restricted to the oropharynx, the main anatomic site associated with the presence of HPV,1 and is consistent with p53 codon 72 biology.

Although the P72 form leads to greater susceptibility to HPV-16-positive SCCs, its presence in overt HPV-16-positive malignancies is expected to induce functional modifications leading to a more favorable outcome. In comparison with R72, P72 form induces a structural change in the protein that makes p53 more resistant against HPV-mediated E6 degradation.14 The greater resistance of p53 is due to an alteration in p53 binding to E6 or other components of the ubiquitin pathway. The escape of P72 from E6 degradation may explain the observed not fully functional abrogation of p53 in HPV-positive cancer cell lines22, 23 and the high rate of occurrence of TP53 mutations in HPV-16-negative SCCs.2, 3 These findings lend support to the notion that transcriptionally active HPV-16 is not functionally equivalent to TP53 somatic mutations and that the HPV-16-positive oropharyngeal SCCs showed a less aggressive clinical course.2

Moreover, our data also show that the PP genotype was significantly associated with female gender and we can speculate that gender differences in smoking and/or alcohol use may be at least a partial explanation. Finally, no segregation was found between either codon 72 genotype and age or SCC TP53 mutations.

In conclusion, our results confirm that the RP genotype may have a protective effect against the development of oropharyngeal SCCs, and that the PP genotype is independently associated with HPV-16-positive tumors and female gender. Cumulatively, these interesting findings are not in keeping with previously published data, indicating a different role of this polymorphism in terms of susceptibility to SCC.10, 13, 15 Although this discrepancy may be mainly ascribed to differences in race (the major determinant of variations in the p53 polymorphism)17 and the anatomical tumor sites, further studies of larger series of tumors are required to validate the impact of p53 polymorphisms at codon 72 on the risk of oropharyngeal SCCs.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES