SEARCH

SEARCH BY CITATION

Keywords:

  • stage II colorectal cancer;
  • prognosis;
  • p53;
  • K-ras;
  • c-Kit;
  • cyclooxygenase-2

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

BACKGROUND:

The prognosis for patients with colorectal cancer (CRC) depends mainly on standard clinicopathologic factors. However, patients with similar disease characteristics exhibit various outcomes, especially in stage II. Therefore, the identification of molecular prognostic markers is needed to predict patient outcomes.

METHODS:

The authors assessed the prognostic value of c-Kit (also called cluster of differentiation 117 [CD117] or KIT), cyclooxygenase-2 (COX-2), tumor protein 53 (p53), and Kirsten rat sarcoma viral oncogene homolog (K-ras) aberrations in 90 patients with stage II CRC using immunohistochemistry and molecular techniques. The results were correlated with standard clinicopathologic prognostic factors, overall survival (OS), and disease-free survival (DFS).

RESULTS:

COX2 and c-Kit overexpression was detected in 54.6% and 59.3% of patients, respectively. Overexpression of p53 was detected in 47 patients, including 29 who had mutations, and a unique mutation pattern was detected with 3 hotspots at codons 72, 245, and 273. Overexpression of ras was detected in 44 patients, including 37 who had mutations. On multivariate analysis, c-Kit overexpression, p53 codon 72 mutations, perforation, and performance status were independent prognostic factors for DFS (P = .054, P = .015, P < .0001, and P = .043, respectively); whereas codon 12 K-ras mutation, performance status, and perforation were independent prognostic factors for OS (P = .033, P = .006, and P < .0001, respectively).

CONCLUSIONS:

The current results provide evidence for the prognostic value of c-Kit overexpression in patients with stage II CRC. The high p53 mutation rate and the unique hotspot in codon 72 have not been reported previously in CRC. This may be related to environmental or racial features that are unique to the studied population. Cancer 2010. © 2010 American Cancer Society.

Colorectal carcinoma (CRC) is the fourth most common cancer site for men, and 15% to 20% of patients present with localized disease (stages I and II). The main objective in the management of this group is curative surgical resection; however, disease recurrence remains a great problem that leads to morbidity and mortality.1 Adjuvant chemotherapy improves disease-free survival (DFS) and overall survival (OS) rates in patients with stage III CRC, but this has not been established yet in patients with stage II CRC. This may be attributed to the few recurrences and deaths among patients who have negative lymph node status and the small number of patients with stage II disease who have been included in adjuvant clinical trials.2, 3

Although the probability of recurrence and survival in patients with CRC depends mainly on standard clinicopathologic prognostic factors, such as the depth of bowel wall invasion and classification according to the tumor-lymph node-metastasis (TNM) staging system, patients with similar disease characteristics can exhibit various survival outcomes, especially in stage II.2-5 Therefore, it is critical to identify molecular prognostic factors that can help to identify patients who are at high risk of disease recurrence and to individualize adjuvant treatment accordingly.

The tumor protein 53 gene (p53) is the most commonly mutated gene in human cancers. It maintains genomic integrity by inducing cell cycle arrest and apoptosis after DNA damage. Approximately half of all patients with CRC have p53 gene mutations that occur as a late event in the transition of an adenoma to carcinoma.6, 7 However, the impact of p53 alterations on the prognosis of patients remains debatable. Some studies have reported a significantly worse prognosis for patients with p53 aberrations,8, 9 whereas others have not.10, 11

The Kirsten rat sarcoma viral oncogene homolog gene (K-ras) encodes a 21-kDa protein (p21ras), which controls cell growth and differentiation by the transduction of extracellular mitogenic signals.12 Mutations of K-ras, especially in codons 12, 13, and 61, have been detected in patients with CRC the lead to the formation of active proteins, which trigger the transduction of proliferation and differentiation signals.7, 13 To date, the results obtained from previous studies regarding the prognostic significance of K-ras remain controversial.14-16

Recent studies have mentioned c-Kit (also called cluster of differentiation 117 [CD117] or KIT) in relation to CRC and colonic adenomas as well as in colon cancer cell lines. c-Kit is a proto-oncogene that encodes a tyrosine kinase receptor, which is essential during embryonic development and postnatal life. Activation of the receptor by its ligand, also known as stem cell factor, is crucial to melanocyte and germ cell development and during the early stages of hematopoiesis.17 Multiple cellular functions are affected by c-Kit–dependent signals, including cell survival, proliferation, adhesion, differentiation, and functional maturation. Aberrant expression of c-Kit and/or stem cell factor has been reported in gastrointestinal stromal tumors and colon cancer cell lines18-20; however, data regarding c-Kit expression in CRC remain scarce.21

Cyclooxygenase-2 (COX-2) is an inducible enzyme that regulates prostaglandin synthesis. It is overexpressed at sites of inflammation and in several epithelial cancers, in which it is involved in apoptosis resistance, angiogenesis, and tumor cell invasiveness.21 Forced COX-2 expression suppresses apoptosis by modulating the level of death receptor 5, an effect that can be reversed by COX-2 inhibitors.21, 22 Several studies have reported COX-2 overexpression in human colon cancers and adenomas, thus making COX-2 a potential target for chemoprevention trials.23, 24 In the current study, we assessed the prognostic value of c-Kit, COX-2, p53, and K-ras aberrations in patients who had stage II CRC with the specific objectives of identifying new molecular prognostic markers and identifying possible molecular target therapies.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

Patients

This prospective study included 90 patients with sporadic CRC who underwent curative surgical resection at the National Cancer Institute (NCI), Cairo University from 2003 to 2005. Eligibility criteria included electively resected CRC, age between 19 years and 78 years, adequate liver and renal profiles, histologically proven lymph node-negative adenocarcinoma of the colon or rectum, no evidence of metastasis or residual disease by clinical or radiologic examination, and an adequate bone marrow reserve (hemoglobin >11 g, total white blood cells >3000, absolute neutrophils >1500, and platelets >100.000). None of the patients received neoadjuvant chemotherapy or radiotherapy before surgery.

All patients underwent resection of the primary tumor, and the tumors were classified according to World Health Organization criteria as adenocarcinoma, mucoid, or signet ring carcinoma and were staged according to the TNM classification system of the International Union Against Cancer25(Table 1). Tissues were freshly obtained from the operation room and were divided immediately into 2 sections. One section was placed in 10% neutral-buffered formalin, embedded in paraffin. and processed routinely for histopathologic evaluation and immunohistochemistry. The other section was immediately snap-frozen and preserved at −70°C for molecular studies. Twenty samples of normal colonic tissues were obtained from the morphologically and microscopically confirmed normal resection margin, as far as possible from tumors, to be used as control samples.

Table 1. Clinicopathologic Features of Study Patients
FeatureNo. of Patients (%)
  1. CEA indicates carcinoembryonic antigen.

Mean age [range], y48.5 [19-78]
Sex
 Men46
 Women44
Site
 Right26 (28.9)
 Transverse10 (11)
 Left19 (21)
 Rectum34 (37.8)
 Mixed1 (1)
Histologic type
 Conventional adenocarcinoma76 (84.4)
 Mucinous adenocarcinoma10 (11)
 Signet ring carcinoma4
Histologic grade
 11
 279
 310
Tumor classification
 T368 (75)
 T422
CA 19-9 elevation
 With recurrence6
 Without recurrence2
CEA elevation
 With recurrence12
 Without recurrence3

Radiotherapy was received by patients with rectal cancer after surgery, according to NCI-Cairo guidelines, and the patients were followed every 3 months to assess for recurrence or metastases. Assessment included a physical examination, carcinoembryonic antigen and cancer antigen 19.9 levels, abdominopelvic ultrasonography or computed tomography scan of the abdomen and pelvis, plain chest x-ray, and colonoscopy every year or whenever needed.

Written informed consent was obtained from all patients who participated in the study after approval by the NCI-Cairo Institutional Review Board. The study endpoints were disease-free survival (DFS) and overall survival (OS), which were obtained from the clinical charts of the patients. The median follow-up was 31 months (range 6-48 months).

Immunohistochemistry

From each tumor block, a hematoxylin and eosin-stained slide was examined microscopically to confirm the diagnosis and to select representative tumor areas. The tissue microarray technique was used as described previously.26 Tissue cores with a diameter of 1.5 mm were punched from the original block and arrayed in triplicate on 2 recipient paraffin blocks. Five-micrometer sections from these tissue array blocks were cut and placed on positive charged slides. Sections from tissue microarrays were deparaffinized, rehydrated through a series of graded alcohols, and processed using the avidin-biotin immunoperoxidase method. The antibodies we used were mouse antihuman p21ras (clone NCC-RAS-001; Dako, Carpinteria, Calif; 1:80 dilution), mouse anti-COX2 (clone COX229; Zymed Laboratories Inc., South San Francisco, Calif; 1:100 dilution), mouse antihuman p53 (DO7; Dako; 1:50 dilution), and mouse antihuman CD117 (c-Kit; Novocastra Ltd., Newcastle upon Tyne, United Kingdom; ready to use). Diaminobenzidine was used as a chromogen, and Mayer hematoxylin was used as a nuclear counterstain. A sample of gastrointestinal stromal tumor was used as a positive control for c-Kit expression; and a sample of hepatocellular carcinoma was used as a positive control for p53, p21-ras, and COX-2 expression (after confirming the neoplastic nature of the tissue by microscopic examination of hematoxylin and eosin-stained slides).

The results were scored by estimating the percentage of tumor cells that had characteristic nuclear staining for p53 or membrane/cytoplasmic staining for K-ras, c-Kit, and COX2. Protein expression was classified as negative if <10% of tumor cells were positive and otherwise was classified as positive. Positive expression was classified further according to the level of expression into mild expression (from ≥10% to <25% positive tumor cells), moderate expression (from ≥25% to <50% positive tumor cells), and high expression (≥50% positive tumor cells); however, during statistical analysis, expression was classified broadly as either negative or positive.

DNA Extraction

DNA was extracted from fresh tumor tissues according to standard protocols. Only tumors that contained >75% neoplastic cells in the examined sections were used.27

Detection of K-ras Mutations

Mutations in codons 12 and 13 of K-ras were detected by polymerase chain reaction (PCR)/restriction fragment-length polymorphism analysis with MvaI and XcmI restriction endonucleases (Amersham Life Science, Buckinghamshire, England) as described previously27, 28 (Table 2). DNA from the CRC cell line HT-29 was used as a standard to control for the efficacy of the restriction enzymes, and double deionized water was used as a negative control.

Table 2. Primer Sequences for the Tumor Protein 53 Gene and the Kirsten Rat Sarcoma Viral Oncogene Homolog
ExonSequence
  1. K-ras indicates Kirsten rat sarcoma viral oncogene homolog; p53, tumor protein 53 gene; T, thymine; C, cytosine, G, guanine; A, adenine.

  2. Underlined sequences indicate mutations.

p53
 5.0 (Sense  primer)TTCCTCTTCCTGCAGTACTC
 5.3 (Antisense  primer)ACCCTGGGCAACCAGCCCTGT
 6.0ACAGGGCTGGTTGCCCAGGGT
 6.3AGTTGCAAACCAGACCTCAG
 7.0GTGTTGTCTCCTAGGTTGGC
 7.3GTCAGAGGCAAGCAGAGGCT
 8.0TATCCTGAGTAGTGGTAATC
 8.3AAGTGAATCTGAGGCATAAC
K-ras codon 12ACTGAATATAAACTTGTGGTAGTTGGACCT
 TCAAAGAATGGTCCTGGACC
 TAATATGTCGACAAAACAAGATTTACCTC
K-ras codon 13
 Ras ACTGAATATAAACTTGTGGTCCATGGAGCT
 Ras BTTATCTGTATCAAAGAATGGTCCTGCACCA
 Ras CGGATGGTCCTCCACCAGTAATATGGATATTA

Detection of p53 Mutations

Exons 4 through 9 of the p53 gene were amplified using the primer sequences and PCR conditions of Bhatia et al,29 and a single-strand conformation polymorphism technique was used for all amplified PCR products as described by Fujita et al30(Table 2). Next, the samples that were identified as mutated by screening for p53 and K-ras were sequenced by using an automated sequencer (ABI PRISM 310; Applied Biosystems, Foster City, Calif) and were analyzed with sequencing analysis software programs.

Statistical Analysis

SPSS software (version 12-0; SPSS Inc., Chicago, Ill) was used for data analysis. Mean and standard deviations were used to describe quantitative data, and percentages were used to describe qualitative data. Chi-square and Fisher exact tests were used to compare independent proportions. Kaplan-Meier survival estimates and log-rank tests were used to compare curves. Cox regression analysis was used for OS as the outcome (dependent variable), and different prognostic factors, including the tested markers, were used to depict independent effects on survival. Odds ratios were used to describe the likelihood of death or disease recurrence for 1 patient subgroup compared with another patient subgroup. P values <.05 were considered significant.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

Between May 2003 and May 2005, 90 patients with stage II CRC were assessed for aberrations in c-Kit, COX-2, p53, and K-ras. Forty-four mutational events in p53 were detected in 29 patients (32.2%), including silent mutations, missense mutations, and frame-shift mutations, some of which have not been reported previously in patients with CRC (Table 3). Twenty patients (68.96%) had mutations in a single exon, and 9 patients (31.03%) had mutations in multiple exons. Exons 4 and 5 had the highest frequency of mutations (12 mutations each) followed by exon 8 (9 mutations), exon 7 (8 mutations), and exon 6 (3 mutations). No mutations were detected in exon 9.

Table 3. Tumor Protein 53 Gene Mutations in 29 Patients With Colorectal Cancer and Their Correlation With p53 Overexpression
p53 Exon/ CodonMutationAmino Acid ChangeMutation Recorded in CRC at IARCp53 Protein
  1. p53 Indicates tumor protein 53 gene; CRC, colorectal carcinoma; IARC, International Agency for Research on Cancer; G, guanine; C, cytosine; Arg, arginine; Pro, proline; A, adenine; Ser, serine; Hist, histidine; T, taurine; Tyr, typtophan; Asn, asparagine; Gly, glycine; Phe, phenylalanine; Asp, asparagine; R, arginine.

4/72GGC:CCCArg:ProNo, but in other tumors+
7/245GGC:AGCGly:SerYes+
5/158CGC:CACArg:HistNo
4/72GGC:CCCArg:ProNo, but in other tumors 
5/163TAC:AACTyr:AsnNo
7/245GGC:AGCGly:SerYes+
4/72GGC:CCCArg:ProNo, but in other tumors+
5/158CGC:CACArg:HistNo
7/245GGC:AGCGly:SerYes+
8/273CGT:CATArg:HistYes
8/278CCT:CATPro:HistYes
5/175CGC:CACArg:HistYes
7/245GGC:AGCGly:SerYes+
4/72GGC:CCCArg:ProNo, but in other tumors+
4/72GGC:CCCArg:ProNo, but in other tumors+
7/245GGC:AGCGly:SerYes+
5/163TAC:AACTyr:AsnNo
4/72GGC:CCCArg:ProNo, but in other tumors+
5/1611 Base-pair insertionFrameshiftNo
4/72TAT:CATTyr:HistNo+
6/205TAT:CATTyr:HistNo+
5/126TAC:TAGTyr to stopNo
5/126TAC:TAGTyr to stopNo
83′+GT:GGFrameshiftNo+
4/72GGC:CCCArg:ProNo, but in other tumors+
7/245GGC:AGCGly:SerYes+
7/241TCC:TTCSer:PheYes
8/273CGT:CATArg:HistYes
8/280AGA:ACAArg:TrpNo
8/273CGT:CATArg:HistYes+
5/159GCC:GACAla:AspYes
5/154GGC:GGTYes+
8/282CGG:TGGArg:TryYes+
8/273CGT:CATArg:HistYes
5/159GCC:GACAla:AspYes+
4/72GGC:CCCArg:ProNo, but in other tumors
5/154GGC:GGTYes+
7/245GGC:AGCGly:SerYes+
4/72GGC:CCCArg:ProNo, but in other tumors+
6/209AGA:ACAArg:HistNo
4/72GGC:CCCR:ProNo, but in other tumors+
6/213CGA:CTAArg:LeuNo
8/280AGA:ACAR:TrpNo
4/72GGC:CCCR:ProNo, but in other tumors+

Three mutational hotspots were detected in exons, including 4 hotspots in codon 72 (12 patients), 7 hotspots in codon 245 (7 patients), and 8 hotspots in codon 273 (5 patients). To our knowledge, the 1 hotspot in exon 4 has not been reported previously in CRC. The most common types of mutations were transversions (50%) and transitions (45.5%). Overexpression of p53 was detected in 47 patients (52.2%), and 24 of those patients (51.1%) had mutations (Table 3, Fig. 1). The concordance between both techniques was 85.8% (P < .01).

thumbnail image

Figure 1. Samples from a patient with colon cancer demonstrate (A) a mutation in codon 175 of the tumor protein 53 gene (p53) (CGC-CAC) and (B) moderate nuclear expression of p53 protein. G indicates guanine; C, cytosine; A, adenine.

Download figure to PowerPoint

Overall, 29 K-ras mutations in codon 12 (32.2%) and 8 K-ras mutations in codon 13 (8.9%) were identified. The most prevalent mutations in codon 12 were a GGT to GAT transition (glycine:aspartic), a GGT to GTT transversion (glycine:valine), and a GGT to AGT transition (glycine:serine). The most prevalent mutation in codon 13 was a GGC to GAC transition (glycine:aspartic), which was detected in 6 patients. Overexpression of p21ras was detected in 44 patients (48.9%), and 37 of those patients (41.1%) had K-ras mutations (84% concordance) (Fig. 2).

thumbnail image

Figure 2. Samples from a patient with colon cancer demonstrate (A) Kirsten rat sarcoma viral oncogene homolog (K-ras) codon 12 mutation (GGT-GAT), (B) K-ras codon 13 mutation (GGC-GAC), and (C) marked cytoplasmic immunostaining for K-ras. G indicates guanine; C, cytosine; A, adenine.

Download figure to PowerPoint

COX2 overexpression was detected in 47 patients (54.6%), and c-Kit overexpression was detected in 51 patients (59.3%) (Fig. 3). There was a significant correlation between p53 mutation and p53 overexpression (P = .001), K-ras mutation (P = .02), and K-ras overexpression (P = .005). Similarly, there was a significant correlation between p53 mutation and tumor type (P = .03) and tumor grade (P = .02). A border line correlation was present between ras overexpression and performance status (P = .07).

thumbnail image

Figure 3. These samples from a patient with colon cancer were highly positive for (A) cyclooxygenase-2 and (B) c-Kit.

Download figure to PowerPoint

In an analysis of disease recurrence and survival, disease recurrence was evident in 27 of 90 patients (30%), including 19 patients (21%) who developed local recurrences and 8 patients (9%) who developed distant metastases (to the lung in 5 patients and to the liver in 3 patients). The time to recurrence ranged from 5 months to 39 months (average, 14.5 months). Most recurrences (92.5%) occurred during the first 2 years after diagnosis.

The median 2-year DFS rate was 72.2%, and the 2-year OS rate was 75.8%. Univariate analysis revealed a statistically significant correlation between 2-year DFS and performance status (P = .122), intestinal perforation (P = .0001), and p53 codon 72 mutations (P = .043) and a borderline significance with T classification (P = .084), COX2 overexpression (P = .088), and c-Kit overexpression (P = .17). OS was correlated significantly with performance status (P = .012), intestinal perforation (P = .000), T classification (P = .039), p53 mutation (P = .031), and K-ras codon 12 mutations (P = .011) (Tables 4 and 5).

Table 4. Correlation Between the Studied Markers and 2-Year Survival in Univariate Analysis
MarkerDFS, %POS, %P
  • DFS indicates disease-free survival; OS, overall survival; K-ras, Kirsten rat sarcoma viral oncogene homolog; p53, tumor protein 53; COX2, cyclooxygenase-2; c-Kit, a cytokine receptor (also called cluster of differentiation 117 or KIT).

  • a

    Significant P value.

Ras overexpression
 Negative69.6.8176.5.43
 Positive72.3 78.9 
Ras mutation
 Negative71.5.8375.7.37
 Positive70.4 80 
K-ras codon 12 mutation
 Negative75.8.7487.1.011a
 Positive66.1 61 
K-ras codon 13 mutation
 Negative65.6.3679.5.67
 Positive61.2 70.1 
p3 Overexpression
 Negative78.4.3281.57
 Positive63.4 74.3 
p53 Mutation
 Negative79.6.043a87.5.031a
 Positive57.2 60.2 
COX2 overexpression
 Negative79.4.08884.5.12
 Positive65.7 74 
c-Kit overexpression
 Negative77 83 
 Mild77.1777.48
 Moderate67.7 79.8 
 Marked57 64.2 
Table 5. Correlation Between Clinicopathologic Factors and Survival in Univariate Analysis
CharacteristicNo. of PatientsDFS, %POS, %P
  • DFS indicates disease-free survival; OS, overall survival.

  • a

    Significant P value.

2-Year survival
Age, y
 <607672 75.6 
 ≥601463.5.7185.6.75
Sex
 Men4665 76 
 Women4477.4279.764
Smoking history
 Nonsmokers6076 79.1 
 Smokers3060.14673.3.36
Family history
 Negative7668 75.8 
 Positive1485.114875.8.329
Performance status
 05081.4 85.4 
 14057.012a66.012a
Obstruction
 Negative7673.5 78.4 
 Positive1452.271.4.46
Perforation
 Negative8788.5 94.2 
 Positive30.000a33.3.000a
Tumor site
 Right side3277.3 87 
 Left side2369.5 73.9 
 Rectum3465.6.38871.4.35
Histologic type
 Adenocarcinoma7672 75.6 
 Mucinous1462.8.7485.38
Tumor grade
 Low8073 79.4 
 High1054.5.3163.6.38
Tumor classification
 T36877.6.08481.8 
 T42252.8 61.3.039a
No. of lymph nodes
 ≥105072 79.5 
 <103971.8.8176.6.74

In multivariate analysis, perforation, performance status, c-Kit overexpression, and p53 codon 72 mutations were independent prognostic factors for shorter DFS (P < .0001, P = .054, P = .005, and P = .043, respectively); whereas intestinal perforation, performance status, tumor type, and K-ras codon 12 mutations were independent prognostic factors for short 2-year OS (P < .0001, P = .006, P = .026, and P = .033, respectively) (Tables 6, 7; Figs. 4, 5).

thumbnail image

Figure 4. Kaplan-Meier analysis of overall survival (OS) in patients with colorectal cancer is illustrated in relation to standard prognostic factors and molecular markers. K12-ras indicates Kirsten rat sarcoma viral oncogene homolog (K-ras) codon 12 mutation; −ve, negative; +ve, positive; PS, performance status.

Download figure to PowerPoint

thumbnail image

Figure 5. Kaplan-Meier analysis of disease-free survival (DFS) in patients with colorectal cancer is illustrated in relation to standard prognostic factors and molecular markers. PS indicates performance status; p53, tumor protein 53 gene; c-Kit, a cytokine receptor (also called cluster of differentiation 117 or KIT).

Download figure to PowerPoint

Table 6. Cox Regression of Prognostic Factors Affecting Overall Survival
VariableMean β (SE)POR [95% CI]
  1. SE indicates standard error; OR, odds ratio; CI, confidence interval; PS, performance status; K-ras, Kirsten rat sarcoma viral oncogene homolog.

PS 1 versus 01.357 (0.94).006 
Perforation3.998 (0.890).0009.526 [311.933]
Pathologic type2.169 (0.974).0261.297 [59.033]
K-ras codon 12 mutation1.986 (0.605).0334.637 [37.988]
Table 7. Cox Regression Analysis of Prognostic Factors Affecting Disease-Free Survival
VariableMean β (SE)POR [95% CI]
  1. SE indicates standard error; OR, odds ratio; CI, confidence interval; PS, performance status; IHC, immunohistochemistry; c-Kit, a cytokine receptor (also called cluster of differentiation 117 or KIT); p53, tumor protein 53 gene.

PS 1 versus 00.848 (0.440).0542.335 [0.985-5.535]
Perforation3.517 (0.827).00033.668 [6.653-170.376]
IHC for c-Kit−1.836 (0.647).0156.25 [3.9-42.2]
p53 Mutation0.664 (0.386).0434.245 [20.7-31.815]

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

Recent studies suggest that there are several important correlations between some genetic pathways and variations in the clinical outcome of patients with stage I and II CRC.7 Several studies have provided evidence that several molecular markers may be useful in defining the risk for individual patients with CRC after surgery and in identifying patients who may benefit most from adjuvant chemotherapy.24, 31, 32

We investigated the possible prognostic and predictive values of c-Kit, COX2, p53, and K-ras in patients with stage II CRC. A novel and interesting finding in the current study is the high frequency of c-Kit overexpression in stage II CRC patients (59.3%) compared with what was reported in other studies.20, 33, 34 Sammarco et al21 reported c-Kit RNA overexpression in 30% of patients with CRC; however, only 10% of their patients had protein overexpression. Reported differences in the frequency of c-Kit overexpression may be attributed to differences in the studied populations, disease stages, sampling techniques, detection methods (including sensitivity and specificity of the antibodies used), or PCR protocols.

The significant correlation between c-Kit overexpression and reduced DFS (P = .015) in our patients with stage II CRC confirmed the results of Bellone et al,35 who demonstrated an association between c-Kit overexpression and poor clinical outcomes in patients with CRC and premalignant lesions. Therefore, we recommend conducting more extended studies in this area to assess the possibility of using anti-c-Kit as target therapy in patients with stage II CRC who have tumors with increased c-Kit expression.

Another interesting finding in the current study was the unique spectrum of p53 mutations. Although, in the current study, the frequency of p53 overexpression (54.6%) and mutation (36%) was within the universally reported range,7, 36, 38 the spectrum of p53 mutations reported in our Egyptian patients differed from the data reported in Western countries and the United States on several points, including 1) the high rate of multiple mutations occurring in the same patient (9 of 29 mutations), which also was reported by Akkiprik et al7 in patients with CRC from Turkey; and 2) the mutational hotspot at exon 4 (codon 72), which was not reported previously in patients with CRC from Western countries. However codon 72 polymorphism (arginine-proline) have been reported in other solid tumors.39 Moreover, it has been demonstrated that p53 protein with proline differs structurally from p53 protein with arginine, and there seems to be functional differences in inducing both apoptosis and cell cycle repair in addition to affecting the function of somatic p53 sequence variants. Therefore, patients who have the proline tumor genotype and nonmissense sequence variants or missense sequence variants that affecting the L2 or L3 loop domains of the p53 protein have significantly poorer disease-specific survival compared with patients who have wild-type or other sequences.39 It is interesting to note that this polymorphism in codon 72 has been reported in other solid tumors in the Egyptian population, including bilharzial bladder cancer40 and hepatocellular carcinoma,41 suggesting that there are specific environmental or racial contributions in this population. Third, transversion mutations were slightly more common than transitions in our series (50% vs 45.4%, respectively), and there was a high rate of mutations at CpG dinucleotides (20 events). This could be attributed either to the high rate of mutations at exon 4, which is characterized by an over-representation of CpG islands, or to the production of large amounts of nitric oxide by the inflammatory cells as a consequence of chronic nonspecific colitis, which is common in the Egyptian population,42 The same findings also were reported by Akkiprik et al7

Our results regarding the significant correlation between p53 mutations and DFS are comparable to some previous reports8, 9, 39 in which p53 was considered an independent predictor of reduced survival in patients with stage II CRC. Still other studies7, 43, 44 demonstrated that neither p53 mutations nor overexpression have any impact on DFS or OS rates in patients with early stage CRC.

Data regarding K-ras mutations in CRC varied in different studies from 18% to 60%.7, 14, 15, 38, 45 Such a wide range was attributed to tumor storage methods, the techniques used to assess mutations, tumor heterogeneity, or the specific features of patient cohorts in the study. However, the reported K-ras mutation rates do not exceed 50%, suggesting the presence of alternative pathway(s) in colorectal carcinogenesis.16

Our reported frequency of K-ras overexpression and mutations (48.9% and 41.1%, respectively), together with the significant correlation with reduced OS, was comparable to that reported in some previous studies. In this context, Bazan et al,16 Suehiro et al,46 and Pajkos et al47 reported a significant correlation between K-ras codon 12 mutations and aggressive forms of disease with reduced survival rates. In contrast, Akkiprik et al7 and Bouzourene et al15 demonstrated that the presence or absence of K-ras mutations was not correlated with prognosis in patients with stage II CRC.

Our results regarding COX-2 expression are comparable to, although slightly lower than, most published data. However, this may be attributed to the inclusion of only patients with stage II disease in our study. Moreover, our data did not reveal a correlation between COX-2 expression and the survival rate. Some previous studies demonstrated similar results,23, 24 although others considered COX-2 overexpression an independent prognostic factor associated with reduced DFS in patients with CRC.48, 49

In conclusion, our data revealed a high frequency of p53 mutations with multiple mutations in the same patient and a unique mutational hotspot at codon 4, which nay be attributed to different environmental and etiologic effects, such as chronic inflammatory conditions, rather than dietary habits or racial differences. The data also provide evidence that c-Kit, p53 codon 72, and K-ras codon 12 are independent prognostic factors in patients with stage II CRC and should be considered in predicting the clinical outcome of patients and in individualizing their therapy. However, further studies still are needed to confirm our findings regarding the prognostic impact of these markers compared with well established genetic and epigenetic prognostic factors, such as microsatellite instability and B-Raf proto-oncogene serine/thereonine-protein kinase (BRAF) mutation.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES
  • 1
    Van Cutsem E, Labianca D, Hossfeld D, et al; PETACC 3. Randomized phase III trial comparing infused irinotecan/5-fluorouracil (5-FU)/folinic acid (IF) versus 5-FU/FA (F) in stage III colon cancer patients (pts). (PETACC 3) [abstract]. J Clin Oncol. 2005; 23(16S; pt 1 of 2 June 1 suppl; ). Abstract 8.
  • 2
    Nelson H, Petrelli N, Carlin A, et al. National Cancer Institute Expert Panel. Guidelines 2000 for colon and rectal cancer surgery. J Natl Cancer Inst. 2001; 93: 583-596.
  • 3
    Moertel CG, Fleming TR, Macdonald JS, et al. Fluorouracil plus levamisole as effective adjuvant therapy after resection of stage III colon carcinoma: a final report. Ann Intern Med. 1995; 122: 321-325.
  • 4
    Allegra CJ, Paik S, Colangelo LH, et al. Prognostic value of thymidylate synthase, Ki-67, and p53 in patients with Dukes B and C colon cancer: a National Cancer Institute-National Surgical Adjuvant Breast and Bowel Project Collaborative study. J Clin Oncol. 2003; 21: 241-250.
  • 5
    Benson AB 3rd, Schrag D, Somerfield MR, et al. American Society of Clinical Oncology recommendations on adjuvant chemotherapy for stage II colon cancer. J Clin Oncol. 2004; 22: 3408-3419.
  • 6
    Graziano F, Cascinu S. Prognostic molecular markers for planning adjuvant chemotherapy trials in Dukes' B colorectal cancer patients: how much evidence is enough? Ann Oncol. 2003; 14: 1026-1038.
  • 7
    Akkiprik M, Ataizi-Celikel C, et al. Clinical significance of p53, K-ras and DCC gene alterations in the stage I-II colorectal cancers. J Gastrointest Liver Dis. 2007; 16: 11-17.
  • 8
    Zhao DP, Ding XW, Peng JP, Zheng YX, Zhang SZ. Prognostic significance of bcl-2 and p53 expression in colorectal carcinoma. J Zhejiang Univ Sci B. 2005; 6: 1163-1169.
  • 9
    Samowitz WS, Curtin K, Ma KN, et al. Prognostic significance of p53 mutations in colon cancer at the population level. Int J Cancer. 2002; 99: 579-602.
  • 10
    Forslund A, Lonnroth C, Andersson M, Brevinge H, Lundholm K. Mutations and allelic loss of p53 in primary tumor DNA from potentially cured patients with colorectal carcinoma. J Clin Oncol. 2001; 19: 2829-2836.
  • 11
    Dix BR, Robbin P, Song R, Jenner D, House AK, Iacoprtta BJ. The common molecular genetic alteration in Dukes' B and C colorectal carcinoma are not long term prognostic indicators of survival. Int J Cancer. 1994; 59: 747-751.
  • 12
    Barbacid M. Ras genes. Annu Rev Biochem. 1987; 56: 779-827.
  • 13
    Finkelstein SD, Sayeg R, Chritensen S, Swalsky PA. Genotypic classification of colorectal adenocarcinoma. Cancer. 1993; 71: 3827-3838.
  • 14
    Andreyev HJ, Norman AR, Cunningham D, et al. Kirsten ras mutations in patients with colorectal cancer: the RASCAL II study. Br J Cancer. 2001; 85: 692-696.
  • 15
    Bouzourene H, Gervaz P, Cerottini JP, et al. p53 and Ki-ras as prognostic factors for Dukes' stage B colorectal cancer. Eur J Cancer. 2000; 36: 1008-1015.
  • 16
    Bazan V, Migliavacca M, Zanna I, et al. Specific codon 13 K-ras mutations are predictive of clinical outcome in colorectal cancer patients, whereas codon 12 K-ras mutations are associated with mucinous histotype. Ann Oncol. 2002; 13: 1438-1446.
  • 17
    Besmer P, Murphy JE, George PC, et al. A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family. Nature. 1986; 320: 415-421.
  • 18
    Bellone G, Silvestri S, Artusio E, et al. Growth stimulation of colorectal carcinoma cells via the c-Kit receptor is inhibited by TGF-beta 1. J Cell Physiol. 1997; 172: 1-11.
  • 19
    Kitamura Y, Hirota S, Nishida T. Molecular pathology of c-Kit proto-oncogene and development of gastrointestinal stromal tumors. Ann Chir Gynaecol. 1998; 87: 282-286.
  • 20
    Bellone G, Carbone A, Sibona N, et al. Aberrant activation of c-Kit protects colon carcinoma cells against apoptosis and enhances their invasive potential. Cancer Res. 2001; 61: 2200-2206.
  • 21
    Sammarco I, Capurso G, Coppola L, et al. Expression of the proto-oncogene c-KIT in normal and tumor tissues from colorectal carcinoma patients. Int J Colorectal Dis. 2004; 19: 545-553.
  • 22
    Koki A, Khan NK, Woerner BM, et al. Cyclooxygenase-2 in human pathological disease. Adv Exp Med Biol. 2002; 507: 177.
  • 23
    Zhang H, Sun XF. Overexpression of cyclooxygenase-2 correlates with advanced stages of colorectal cancer. Am J Gastroenterol. 2002; 97: 1037-1041.
    Direct Link:
  • 24
    Wu AW, Gu J, Ji JF, Li ZF, Xu GW. Role of COX-2 in carcinogenesis of colorectal cancer and its relationship with tumor biological characteristics and patients' prognosis. World J Gastroenterol. 2003; 9: 1990-1994.
  • 25
    Hamilton SR, Vogelstein B, Kudo S, et al. Carcinoma of the Colon and Rectum. In: HamiltonSR, AaltonenLA, eds. World Health Organization Classification of Tumors: Pathology and Genetics of the Digestive System. Lyon, France: IARC Press; 2000 103-142.
  • 26
    Puig P, Capodieci P, Drobnjak M, et al. p73 Expression in human normal and tumor tissues: loss of p73alpha expression is associated with tumor progression in bladder cancer. Clin Cancer Res. 2003; 9: 5642-5651.
  • 27
    Kubrusly MS, Cunha JE, Bacchella T, et al. Detection of K-ras point mutation at codon 12 in pancreatic diseases: a study in a Brazilian casuistic. JOP. 2002; 3: 144-151.
  • 28
    Dieterle CP, Conzelmann M, Linnemann U, Berger MR. Detection of isolated tumor cells by polymerase chain reaction restriction fragment length polymorphism for K-ras mutations in tissue samples of 199 colorectal cancer patients. Clin Cancer Res. 2004; 10: 641-650.
  • 29
    Bhatia KG, Gutierrez MI, Huppi K, Siwarski D, Magrath IT. The pattern of p53 mutations in Burkitts lymphoma differs from that of solid tumors. Cancer Res. 1992; 52: 4273-4276.
  • 30
    Fujita M, Enomoto T, Inoue M, et al. Alteration of the p53 gene in human primary cervical carcinoma with and without papilloma virus infection. Cancer Res. 1992; 52: 5323-5328.
  • 31
    Bahnassy AA, Zekri AR, El-Houssini S, et al. Cyclin A and cyclin D1 as significant prognostic markers in colorectal cancer patients [serial online]. BMC Gastroenterol. 2004; 4: 22.
  • 32
    Amaya H, Tanigawa N, Lu C, et al. Association of vascular endothelial growth factor expression with tumor angiogenesis, survival and thymidine phosphorylase/platelet-derived endothelial growth factor expression in human colorectal cancer. Cancer Lett. 1997; 119: 227-235.
  • 33
    Yorke R, Chirala M, Younes M. c-Kit proto-oncogene product is rarely detected in colorectal adenocarcinoma. J Clin Oncol. 2003; 21: 3885-3886.
  • 34
    Reed J, Ouban A, Schickor FK, Muraca P, Yeatman T, Coppola D. Immunohistochemical staining for c-Kit (CD117) is a rare event in human colorectal carcinoma. Clin Colorectal Cancer. 2003; 2: 119-122.
  • 35
    Bellone G, Smirne C, Carbone A, et al. KIT/stem cell factor expression in premalignant and malignant lesions of the colon mucosa in relationship to disease progression and outcomes. Int J Oncol. 2006; 29: 851-859.
  • 36
    Nasif WA, Lotfy M, El-Sayed IH, El-Kenawy Ael-M, El-Shahat M, El-Hak NG. Implications of CEA and p53 overexpression in the poor prognosis of colorectal cancer. Med Oncol. 2006; 23: 237-244.
  • 37
    Resnick MB, Routhier J, Konkin T, Sabo E, Pricolo VE. Epidermal growth factor receptor, c-MET, β-catenin, and p53 expression as prognostic indicators in stage II colon cancer. A tissue microarray study. Clin Cancer Res. 2004; 10: 3069-3075.
  • 38
    Chan AO, Soliman AS, Zhang Q, et al. Differing DNA methylation patterns and gene mutation frequencies in colorectal carcinomas from Middle Eastern countries. Clin Cancer Res. 2005; 11: 8281-8287.
  • 39
    Wang Y, Kristensen GB, Borresen, -Dale A-L, Helland A. TP53 mutations and codon 72 genotype—impact on survival among ovarian cancer patients. Ann Oncol. 2007; 18: 964-966.
  • 40
    Khaled HM, Bahnassi AA, Zekri AN, Kassem HA, Mokhtar N. Correlation between p53 mutations and HPV in bilharzial bladder cancer. Urol Oncol. 2003; 21: 334-341.
  • 41
    Zekri AN, Bahnassi AA, Madbouly M, Assad N, El-Shehay A, Alam El-Din H. P53 mutation in HCV gene type-4 associated hepatocellular carcinoma in Egyptian patients. J Egypt Natl Cancer Inst. 2006; 18: 17-29.
  • 42
    Warren W, Big PJ, El-Baz M, Ghoneim MA, Sttaton MR, Venitt S. Mutations in the p53 in bilharzial bladder cancer: a study of 92 tumors from Egyptian patients and comparison between mutational spectra from schistosomal and non-schistosomal urothelial tumors. Carcinogenesis. 1995; 16: 1181-1189.
  • 43
    Soong R, Powell B, Elsaleh H, et al. Prognostic significance of TP53 gene mutation in 995 cases of colorectal carcinoma. Influence on tumor site, stage, adjuvant chemotherapy and type of mutation. Eur J Cancer. 2000; 36: 2053-2060.
  • 44
    Petersen S, Thames HD, Nieder C, Petersen C, Baumann M. The results of colorectal cancer treatment by p53 status: treatment-specific overview. Dis Colon Rectum. 2001; 44: 322-333.
  • 45
    Font A, Abad A, Monzo M, et al. Prognostic value of K-ras mutations and allelic imbalance on chromosome 18q in patients with resected colorectal cancer. Dis Colon Rectum. 2001; 44: 549-557.
  • 46
    Suehiro Y, Wong CW, Chirieac LR, et al. Epigenetic-genetic interactions in the APC/WNT, RAS/RAF, and p53 pathways in colorectal carcinoma. Clin Cancer Res. 2008; 14: 2560-2569.
  • 47
    Pajkos G, Kiss I, Sandor J, Ember I, Kishazi P. The prognostic value of the presence of mutations at the codons 12, 13, 61 of K-ras oncogene in colorectal cancer. Anticancer Res. 2000; 20: 1695-1701.
  • 48
    Fux R, Schwab M, Thon KP, Gleiter CH, Fritz P. Cyclooxygenase-2 expression in human colorectal cancer is unrelated to overall patient survival. Clin Cancer Res. 2005; 11: 4754-4760.
  • 49
    Yamac D, Celenkoglu G, Coskun U, et al. Prognostic importance of COX-2 expression in patients with colorectal cancer. Pathol Res Pract. 2005; 201: 497-502.