SEARCH

SEARCH BY CITATION

Keywords:

  • breast cancer;
  • CYP3A43;
  • polymorphism;
  • tumor grade

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

BACKGROUND:

CYP3A enzymes, due to their role in the metabolism of steroid hormones, are suggested to affect carcinogenesis of hormone-related cancers. The purpose of the present study was to evaluate the association between polymorphisms located in CYP3A43, breast cancer risk, and tumor characteristics.

METHODS:

A 3-plex matrix-assisted laser desorption ionization time of flight mass spectrometry assay has been established for CYP3A43_74_delA (CYP3A43*2A), CYP3A43_1018_C>G (CYP3A43*3), and CYP3A43_1047_C>T (CYP3A43*1B) polymorphisms, and 1021 breast cancer cases and 1015 age-matched, population-based controls from the German GENICA collection have been genotyped.

RESULTS:

No differences in genotype frequencies between cases and controls were observed, indicating that CYP3A43_74_delA is not associated with breast cancer risk. Subgroup analyses showed an association between the CYP3A43_74_delA allele and high-grade tumors (odds ratio, 1.74; 95% confidence interval, 1.14-2.65 [P = .010 and Ptrend = .012]).

CONCLUSIONS:

The data support the notion that the CYP3A43_74_delA variant may result in decreased protein and/or activity levels, and this may further lead to increased hormone levels to promote tumor cell growth and hinder differentiation. Cancer 2010. © 2010 American Cancer Society.

The cytochrome P450 3A (CYP3A) isoenzymes comprise the largest portion of liver and small intestine CYP proteins, but they are also expressed in gut, colon, prostate, and breast tissue.1-6 Their expression pattern infers a predominant role in the metabolism of drugs, toxins, carcinogens, fatty acids,7 and steroids.8 A potential association of CYP3A with hormone-related cancers has been suggested. For example, variations in CYP3A activity are suspected to modulate levels of sex hormones, thus influencing the risks for breast and prostate cancer.3 The carcinogenic role of estrogens and progesterone is well established in in vitro and in vivo studies.9-13 On the clinical level, high serum concentrations of sex hormones have been observed to be associated with an elevated breast cancer risk.14, 15 Therefore, enzymes of the steroid hormone metabolism, in particular CYP3A, are prime candidates for the investigation of their involvement in hormone-related cancers. Owing to their high degree of genetic variation, CYP3A polymorphisms could play a role in the risk of developing breast and prostate cancer.

The CYP3A subfamily consists of CYP3A4, CYP3A5, CYP3A7, and CYP3A43, with the latter being the most recently discovered member of this family.16 CYP3A43 is expressed in the liver and to a much higher extent in gonads, ovary, and testis.17-19 Moreover, a potential role in steroid hormone metabolism is supported by the observation of increased mRNA and protein levels in prostate, breast, and ovarian carcinomas.17, 19 As of yet, there are few studies investigating the role of CYP3A43 in health and disease. One study reported an associations of the CYP3A43*3 polymorphism with prostate cancer risk,20 and another study showed an association of this polymorphism with grade and size of benign hyperplasia.21 No data on a relationship between CYP3A43 polymorphisms and breast cancer are available. Within this context, 3 CYP3A43 polymorphisms are of interest to be correlated with breast cancer risk and/or tumor characteristics: the exon 2 frameshift mutation CYP3A43_74_delA (CYP3A43*2A, rs61469810) leading to a premature stop 64 codons downstream, the exon 10 missense mutation CYP3A43_1018_C>G (CYP3A43*3, rs680055) leading to an amino acid exchange of proline to alanine at position 340, and the silent exon 11 mutation CYP3A43_1047_C>T (CYP3A43*1B, rs17342647).22 The molecular analyses of these polymorphisms are hampered by the high degree of sequence homologies shared between CYP3A genes and a pseudogene, and therefore these analyses require specific procedures for unanimous CYP3A43 genotyping.

We established a matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI TOF MS) assay for CYP3A43_74_delA, CYP3A43_1018_C>G, CYP3A43_1047_C>T polymorphisms, and genotyped 1021 breast cancer cases and 1015 age-matched population-based controls of the German GENICA collection. Association studies showed a link between CYP3A43_74_delA and tumor grade, but there was no association with breast cancer risk in general.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

Study Subjects

The GENICA study participants of the population-based breast cancer case-control study from the Greater Bonn Region, Germany, were recruited between August 2000 and September 2004 as described previously.23, 24 In brief, there are 1143 incident breast cancer cases and 1155 population controls matched in 5-year classes. Cases and controls were eligible if they were of Caucasian ethnicity, current residents of the study region, and <80 years of age. Of these, DNA samples were available for 1021 breast cancer cases and 1015 controls. Information on known and supposed risk factors was collected for all participants via in-person interviews. The response rate was 88% for cases and 67% for controls. Characteristics of the study population regarding potential breast cancer risk factors include age at diagnosis (<50, ≥50 years), menopausal status (premenopausal, postmenopausal), family history of at least 1 first-degree relative with breast or ovarian cancer (yes, no), use of oral contraceptives (never, >0-<5, 5-<10, ≥10 years), use of hormone therapy (never, >0-<10, ≥10 years), body mass index (<20, 20-<25, 25-<30, ≥30 kg/m2), and smoking status (never, former, current)(Table 1).

Table 1. Breast Tumor Characteristics, Epidemiologic Baseline Information, and CYP3A43_74_delA Genotype Frequencies of the GENICA Study Population
VariablesCases, n=1021, No.a(%)Controls, n=1015, No.a(%)OR (95% CI)b
  • OR indicates odds ratio; CI, confidence interval; ER, estrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2; BMI, body mass index.

  • a

    Totals may vary due to missing data.

  • b

    OR conditional on age in 5-year groups adjusted for menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, BMI, and smoking history.

  • c

    Reference.

Tumor characteristics
ER status
 Positive755 (77.8)  
 Negative216 (22.2)  
PR status
 Positive678 (70.0)  
 Negative291 (30.0)  
 HER2 status 
 Positive189 (27.2)  
 Negative493 (72.3)  
Grading
 177 (8.2)  
 2567 (60.4)  
 3295 (31.4)  
Tumor size
 T1582 (61.9)  
 T2289 (30.7)  
 T330 (3.2)  
 T439 (4.2)  
Histology
 Ductal634 (69.5)  
 Lobular177 (19.4)  
 Ductolobular101 (11.1)  
Lymph node status
 N0602 (63.8)  
 ≥N1342 (36.2)  
Epidemiological variables
Age, y
 <50225 (22.6)226 (22.3) 
 ≥50796 (77.3)789 (77.7) 
Menopausal status
 Premenopausal248 (24.8)235 (23.6)1.00c
 Postmenopausal753 (75.2)762 (76.4)0.90 (0.65-1.24)
Family history of breast cancer
 No845 (84.4)914 (91.7)1.00c
 Yes156 (15.6)83 (8.3)2.04 (1.53-2.70)
Use of oral contraceptives, y
 Never372 (36.5)368 (36.3)1.00c
 >0 to <5180 (17.7)185 (18.3)0.97 (0.74-1.28)
 5 < 10134 (13.1)120 (11.8)1.11 (0.81-1.52)
 ≥10333 (32.7)340 (33.6)0.97 (0.76-1.25)
Use of hormone therapy, y
 Never506 (49.8)509 (50.3)1.00c
 >0 to <10245 (24.1)290 (28.6)0.86 (0.68-1.09)
 ≥10266 (26.1)214 (21.1)1.36 (1.05-1.76)
BMI, kg/m2
 <2088 (8.8)70 (7.2)1.28 (0.91-1.81)
 20 < 25459 (45.9)464 (46.4)1.00c
 25 < 30302 (30.1)319 (32.0)0.99 (0.80-1.22)
 ≥30152 (15.2)144 (14.4)1.08 (0.83-1.42)
Smoking history
 Never586 (57.5)555 (54.7)1.00c
 Former192 (18.8)215 (21.2)0.95 (0.75-1.19)
 Current242 (23.7)245 (24.1)0.84 (0.66-1.06)

Information on clinical and histopathological tumor characteristics was available for 1011 (99%) breast cancer cases. The dataset included estrogen receptor (ER) status (positive, negative), progesterone receptor (PR) status (positive, negative), human epidermal growth factor receptor 2 (HER2) status (positive, negative), grading (grade 1, grade 2, grade 3), tumor size (T1, T2, T3, T4), histology (ductal, lobular, ductolobular), and lymph node status (N0, N ≥1)(Table 1). Histologic grading involved assessment of 3 components of tumor morphology, granular formation, nuclear atypia, and frequency of mitosis. The GENICA study was approved by the ethics committee of the University of Bonn. All study participants gave written informed consent.

Genotyping

Genomic DNA was extracted from heparinized blood samples (Puregene; Gentra Systems, Inc., Minneapolis, Minn) as previously described.25 The polymorphisms CYP3A43_74_delA (CYP3A43*2A), CYP3A43_1018_ C>G (CYP3A43*3), and CYP3A43_1047_C>T (CYP3A43*1B) were genotyped by MALDI TOF MS. Due to sequence homologies resulting in >1 hit in the human genome in sequence alignment, the automatic assay design was hampered. Therefore, specific polymerase chain reaction (PCR) primers were designed by eye inspection. They were scrutinized with respect to PCR primer binding sites for uniqueness in the CYP3A43 gene. An adapted touch-down PCR cycling program was established to enhance specific primer binding: 94°C for 2 minutes followed by 5 cycles with 95°C for 20 seconds, 65°C for 30 seconds, and 72°C for 1 minute, followed by 40 cycles with 95°C for 20 seconds, 62°C for 30 seconds, and 72°C for 1 minute, followed by 72°C for 10 minutes. MALDI TOF MS analysis was performed using the Sequenom MassARRAY platform and homogenous MassEXTEND methodology according to the manufacturer's instructions (Sequenom, San Diego, Calif). Sensitivity, accuracy, and reproducibility of this assay were controlled by repeated analyses of 20% randomly selected samples and inclusion of 6 positive controls validated by sequencing (Genterprise Genomics, Mainz, Germany). Primer sequences are given in Table 2. All primers were synthesized by Metabion International AG, Martinsried, Germany.

Table 2. Primer Sequences and Mass Extensions Used for Specific Analysis of CYP3A43 Polymorphisms by MALDI TOF MS as Well as Primers Used for Sequencing
PolymorphismPrimerPrimer SequenceMass Extension
Allele 1Allele 2
  1. MALDI TOF MS indicates matrix-assisted laser desorption ionization time of flight mass spectrometry; F, forward; R, reverse; E, extension; ins, insertion; del, deletion.

MALDI TOF MS
 CYP3A43_74_delAFACGTTGGATGTACAATTTCTGTAACCTGGC  
 (CYP3A43*2A, rs61469810)RACGTTGGATGCAGGAATTCCCAGCTTCTTA  
 EGGCTTTCTCTTTTATTTTATAGTTins: dA ddTdel: ddT
 CYP3A43_1018_C>GFACGTTGGATGTATGACACAACTAGCACCAC  
 (CYP3A43*3, rs680055)RACGTTGGATGTCTTGCTGAGGCTTCACCTT  
 EGGAGGAGATTGACGCAGTTTTAC: dG ddCG: ddC
 CYP3A43_1047_C>TFACGTTGGATGCTTTCTTCCCAGGCACCTGT  
 (CYP3A43*1B, rs17342647)RACGTTGGATGGTAACTCTACTAACAACTGG  
 EGTACTCCATCTGTACCAGC: dG ddCT: ddA
Sequencing
 CYP3A43_74_delAFCTAAGCTTGGGTTTGCATCG  
 (CYP3A43*2A, rs61469810)RTACAATTTCTGTAACCTGGC  
 CYP3A43_1018_C>GFATGAAAGAACTGATGCTTAC  
 (CYP3A43*3, rs680055)RTATGACACAACTAGCACCAC  
 CYP3A43_1047_C>TFGATTGGAACCATCACTGCTA  
 (CYP3A43*1B, rs17342647)RCTTTCTTCCCAGGCACCTGT  

Statistical Analyses

Genotype frequencies were tested for Hardy-Weinberg equilibrium. Associations between genotypes and breast cancer risk were analyzed by logistic regression conditional on age (5-year groups) and adjusted for 6 epidemiological breast cancer risk factors (menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking). Logistic regression was also used to analyze the associations between CYP3A43 genotypes and 7 clinical and histopathological tumor characteristics (ER, PR, and HER2 status, grading, tumor size, histology, and lymph node status) of breast cancer cases. To correct for multiple testing we divided the significance level of .05 by the number of tested variables. Since we analyzed 7 tumor characteristics, P values <.007 were considered significant. In addition, analyses for a putative additive effect with respect to the 2 polymorphisms with the potential to alter CYP3A43 function (CYP3A43_74_delA and CYP3A43_1047_ C>T) were performed. Risk estimates were given as odds ratio (OR) and 95% confidence interval (CI). P values for trend (Ptrend) were calculated using Cochran-Armitrage Trend test. All statistical analyses were performed using SAS statistical software (version 9.1.3; SAS Institute Inc, Cary, NC).

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

Multiplex Genotyping

A specific 3-plex MALDI TOF MS assay has been developed to amplify the CYP3A43 polymorphic regions of interest. Genotypes at CYP3A43_74_delA (CYP3A43*2A), CYP3A43_1018_C>G (CYP3A43*3), and CYP3A43_ 1047_C>T (CYP3A43*1B) were obtained for 2036 patient and control samples. Genotype frequencies met Hardy-Weinberg equilibrium and are congruent to published data.22 The call rates were >99%. Duplicates and positive controls showed 100% congruency. Statistical analysis showed no association between CYP3A43_74_ delA, CYP3A43_1018_C>G, and CYP3A43_1047_ C>T genotypes and breast cancer risk, respectively (Table 3).

Table 3. Genotype Frequencies of CYP3A43 Polymorphisms and Risk Estimates of Breast Cancer Cases and Controls of the GENICA Study
PolymorphismGenotypeCases, n=1021, No.a(%)Controls, n=1015, No.a(%)OR (95% CI)b
  • OR indicates odds ratio; CI, confidence interval; ins, insertion; del, deletion.

  • a

    Totals may vary due to missing data.

  • b

    OR conditional on age in 5-year groups adjusted for menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking history.

  • c

    Reference.

  • d

    In case of homozygous carrier of the variant alleles of CYP3A43_74_delA and CYP3A43_1018_C>G, numbers are too low for valid statistical analyses.

CYP3A43_74_delA (*2A)ins/ins893 (89.8)890 (90.7)1.00c
 ins/del96 (9.7)88 (9.0)1.08 (0.80-1.47)
 del/del5 (0.5)d3 (0.3)dd
 ins/del+del/del101911.10 (0.81-1.48)
CYP3A43_1018_C>G (*3)CC891 (89.4)885 (89.2)1.00b
 CG102 (10.2)105 (10.6)0.97 (0.73-1.30)
 GG4 (0.4)d2 (0.2)dd
 CG + GG1061070.99 (0.74-1.32)
CYP3A43_1047_C>T (*1B)CC785 (78.5)767 (77.9)1.00c
 CT205 (20.5)202 (20.5)0.99 (0.80-1.24)
 TT10 (1.0)15 (1.5)0.65 (0.29-1.45)
 CT + TT2152170.97 (0.78-1.20)

Breast Cancer Risk Associations

None of the polymorphisms showed a risk association in subgroup analysis with respect to menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking (data not shown). Moreover, no additive effect has been observed for the putative functional variants CYP3A43_74_delA and CYP3A43_1047_C>T (data not shown).

Associations With Histopathological Characteristics

With respect to histopathological breast tumor characteristics, we observed a significant association with the CYP3A43_74_delA polymorphism. Carriers of the delA allele were more likely to have poorly differentiated breast tumors (Table 4). In particular, women with a heterozygous ins/del genotype showed an increased risk for high-grade tumors, with a Ptrend of .004 (Table 4). When we compared patients with well-differentiated tumors (grade 1) versus the combined group of patients with moderately (grade 2) and poorly differentiated tumors (grade 3), we observed an OR of 1.89 (95% CI, 1.23-2.90; P = .004) for carriers of the ins/del genotype (Table 4). The number of patients with a homozygous variant genotype (del/del) was too low for valid statistical analysis. This patient group therefore was combined with the group of heterozygote carriers. All women carrying at least 1 CYP3A43_74_delA allele showed an increased risk for high-grade tumors, with a Ptrend of.012 (Table 4). The comparison of patients with well-differentiated tumors (grade 1) versus the combined group of patients with moderately (grade 2) and poorly differentiated tumors (grade 3) revealed an OR of 1.74 (95% CI, 1.14-2.65; P = .010)(Table 4). The observed associations remained significant following correction for multiple testing. Additional analyses of the comparison between patients groups with different grading (grade 1 to grade 3) and healthy controls showed a significant effect for the correlation between the heterozygous CYP3A43_74_delA (ins/del) genotype and grade 3 (OR, 1.77; 95% CI, 1.19-2.63 [P = .005]) (Table 5) as well as the combined group of carriers of the variant allele (OR, 1.69; 95% CI, 1.14-2.51 [P = .010]) (Table 5). The latter effect vanished after correction for multiple testing. No other significant effects were observed with respect to other histopathological variables (data not shown).

Table 4. Association of CYP3A43_74_delA (*2A) With Grading of Corresponding Breast Tumors
CYP3A43_74_delA (*2A) GenotypesGradingPOR (95% CI)a
Grade 1, No. (%)Grade 2, No. (%)Grade 3, No. (%)Grade 2 + Grade 3, No. (%)
  • OR indicates odds ratio; CI, confidence interval; del, deletion; ins, insertion.

  • a

    OR adjusted for menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking history.

  • b

    In case of homozygous carrier of the variant allele, numbers are too low for valid statistical analyses.

  • c

    Reference.

ins/ins71 (92.2)512 (90.9)249 (85.3)   
ins/del5 (6.5)48 (8.6)43 (14.7) Ptrend = .004 
del/del1 (1.3)b3 (0.5)b0 (0)b b 
ins/del + del/del65143 Ptrend = .012 
ins/ins71 (92.2)  761 (89.1) 1.00c
ins/del5 (6.5)  90 (10.5)P = .0041.89 (1.23-2.90)
del/del1 (1.3)b  3 (0.4)bbb
ins/del + del/del6  93P = .0101.74 (1.14-2.65)
Table 5. Association of CYP3A43_74_delA (*2A) With Grading of Corresponding Breast Tumors in Comparison With Healthy Controls
CYP3A43_74_delA (*2A) GenotypesGradingPOR (95% CI)a
Grade 1, No. (%)Grade 2, No. (%)Grade 3, No. (%)Controls, No. (%)
  • OR indicates odds ratio; CI, confidence interval; ins, insertion; del, deletion.

  • a

    OR adjusted for menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking history.

  • b

    Reference.

  • c

    In case of homozygous carrier of the variant allele, numbers are too low for valid statistical analyses.

ins/ins71 (92.2)  890 (90.7) 1.00b
ins/del5 (6.5)  88 (9.0).7360.85 (0.33-2.19)
del/del1 (1.3)c  3 (0.3)ccc
ins/del + del/del6  91.9230.95 (0.40-2.29)
ins/ins 512 (90.9) 890 (90.7) 1.00b
ins/del 48 (8.6) 88 (9.0).9410.99 (0.68-1.43)
del/del 3 (0.5)c 3 (0.3)ccc
ins/del + del/del 51 91.9911.00 (0.70-1.44)
ins/ins  249 (85.3)890 (90.7) 1.00b
ins/del  43 (14.7)88 (9.0).0051.77 (1.19-2.63)
del/del  0 (0)c3 (0.3)ccc
ins/del + del/del  4391.0101.69 (1.14-2.51)

No association was observed at CYP3A43_1018_ C>G and CYP3A43_1047_C>T polymorphisms (data not shown).

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

We conducted a study to investigate the role of constitutional CYP3A43 genetic variants for breast cancer risk and/or histopathological breast tumor characteristics. This involved the establishment of a valid MALDI TOF MS 3-plex assay for CYP3A43_74_delA, CYP3A43_1018_C>G, and CYP3A43_1047_C>T genotyping. Due to the >70% sequence homology between CYP3A genes, this specific assay design has enabled us to embark on specific association studies.26, 27 The 3-plex assay met the criteria for the validation of genotyping assays, that is, specificity, reproducibility, and accuracy, and has been used to genotype 1021 cases and 1015 controls of the GENICA breast cancer collection.28 After statistical evaluation, none of the CYP3A43 polymorphisms showed an association with breast cancer risk. Subgroup analyses with respect to menopausal status, family history of breast cancer, use of oral contraceptives, use of hormone therapy, body mass index, and smoking did not show significant effects. Further subgroup analyses for potential relevance with respect to tumor histopathological characteristics, however, showed a significant association between the CYP3A43_74_delA polymorphism and tumor grade. In particular, carriers of the variant delA allele more frequently had poorly differentiated breast tumors. This observation is in line with a recent prostate cancer study, which showed an association between CYP3A43_1018_C>G (CYP3A43*3) and tumor grade of benign prostatic hyperplasia.21 Although the functional consequences of CYP3A43_1018_C>G (CYP3A43*3) are not known, a CYP3A43*3-driven reduction of enzyme activity has been discussed.22 In the case of the CYP3A43_74_delA polymorphism and its association with breast tumor grade, there is plausible support from the literature of its relevance.22 The delA variant in exon 2 leads to a premature stop codon and presumably to a severely altered and truncated protein.22 This change in amino acid composition and length may decrease or even abolish the enzyme function. Thus, carriers of the CYP3A43_74_delA allele may have decreased CYP3A43 activity, which could result in increased levels of endogenous steroid hormone levels. Such a putative dysfunction may ultimately enhance breast cell proliferation and promote the development of high-grade tumors. This interpretation is plausible, because it has been shown that CYP3A43 is expressed in tissues related to steroid hormone synthesis and metabolism, and moreover in hormone related cancers, including carcinoma of the breast.17-19 Thus, our finding of an association between the CYP3A43_74_delA polymorphism and poorly differentiated breast tumors adds a new candidate to the list of modulators of hormone-driven tumors. This should draw attention to CYP3A43 as a potential candidate marker for breast cancer prognosis.

CONFLICT OF INTEREST DISCLOSURES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES

All authors disclose any actual or potential conflict of interest including any financial, personal, or other relationships with other people or organizations. The work was supported by the Federal Ministry of Education and Research, Germany grants 01KW9975/5, 01KW9976/8, 01KW9977/0, and 01KW0114; Robert Bosch Foundation of Medical Research, Stuttgart; Deutsches Krebsforschungszentrum, Heidelberg; Institute for Prevention and Occupational Medicine of German Social Accident Insurance, Bochum; and Department of Internal Medicine, Evangelische Kliniken Bonn gGmbH, Johanniter Krankenhaus, Bonn, Germany.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONFLICT OF INTEREST DISCLOSURES
  7. REFERENCES