SEARCH

SEARCH BY CITATION

Keywords:

  • neuroblastoma;
  • human epidermal growth factor receptor 4;
  • v-erb-a erythroblastic leukemia viral oncogene homolog;
  • HER4/ERBB4;
  • cellular stress;
  • chemoresistance;
  • multicellular tumor sphere

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

BACKGROUND:

Neuroblastoma (NBL) is a common pediatric solid tumor, and outcomes for patients with advanced neuroblastoma remain poor despite extremely aggressive treatment. Chemotherapy resistance at relapse contributes heavily to treatment failure. The poor survival of patients with high-risk NBL prompted this investigation into novel treatment options with the objective of gaining a better understanding of resistance mechanisms. On the basis of previous work and on data from publicly available studies, the authors hypothesized that human epidermal growth factor receptor 4 (Her4) contributes to resistance.

METHODS:

Her4 expression was reduced with small-hairpin RNA (shRNA) to over express intracellular HER4, and the authors tested its impact on tumor cell survival under various culture conditions. The resulting changes in gene expression after HER4 knockdown were measured by using a messenger RNA (mRNA) array.

RESULTS:

HER4 expression was up-regulated in tumor spheres compared with the expression in monolayer culture. With HER4 knockdown, NBL cells became less resistant to anoikis and serum starvation. Moreover, HER4 knockdown increased the chemosensitivity of NBL cells to cisplatin, doxorubicin, etoposide, and activated ifosfamide. In mRNA array analysis, HER4 knockdown predominately altered genes related to cell cycle regulation. In NBL spheres compared with monolayers, cell proliferation was decreased, and cyclin D expression was reduced. HER4 knockdown reversed cyclin D suppression. Overexpressed intracellular HER4 slowed the cell cycle and induced chemoresistance.

CONCLUSIONS:

The current results indicated that HER4 protects NBL cells from multiple exogenous apoptotic stimuli, including anoikis, nutrient deficiency, and cytotoxic chemotherapy. The intracellular fragment of HER4 was sufficient to confer this phenotype. HER4 functions as a cell cycle suppressor, maintaining resistance to cellular stress. The current findings indicate that HER4 overexpression may be associated with refractory disease, and HER4 may be an important therapeutic target. Cancer 2012. © 2012 American Cancer Society.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

Neuroblastoma is a common childhood cancer that is diagnosed most frequently before age 1 year.1 Approximately 50% of patients are at high risk, with survival rates of <40% despite intensive multimodal therapy. Relapsed disease is rarely cured, highlighting the urgent need for new therapeutic options for patients with high-risk neuroblastoma.

Therapies against the v-erb-a erythroblastic leukemia viral oncogene homolog (ERBB) family of receptor tyrosine kinases (epidermal growth factor receptor [EGFR], human epidermal growth factor receptor 2 [HER2], HER3, and HER4) have improved outcomes for some patients with common carcinomas.2 We and others have reported the relation between ERBB receptors and neuroblastoma,3-5 suggesting ERBB signaling promotes neuroblastoma growth and survival. We previously reported superior in vivo growth inhibition from a pan-ERBB inhibitor compared with EGFR-specific therapy.4, 6 An immunohistochemistry study of neuroblastoma patient samples suggested that HER4 may correlate with worse outcomes.5 We recently used a publicly available oncogenomic data set to analyze the prognostic impact of HER4 expression in patients with neuroblastoma.7 In 4 independent data sets, higher HER4 expression was correlated significantly with reduced survival (Fig. 1). Notably, these DNA microarray data were generated by different probes that recognize different HER4 sequences, suggesting that the observed difference is unlikely to be caused by artifact. Collectively, the evidence cited above elevates the importance of HER4 in neuroblastoma and warrants further mechanistic study.

thumbnail image

Figure 1. Human epidermal growth factor receptor 4 (Her4) expression in neuroblastoma was correlated with a worse prognosis in 4 independent genomic screens. Kaplan-Meier survival estimates were generated from (A) the National Cancer Institute (NCI) Exon Array Neuroblastoma Database (transcript cluster 2597552; cutoff, −0.248); (B) the Oncogenomics Neuroblastoma Prognosis Database (probe 51939; cutoff, 0.78); (C) the Neuroblastoma Prognosis Database-Oberthuer Laboratory (probe A_32_lP183765; cutoff, 0.193); and (D) the Neuroblastoma Prognosis Database-Seeger Laboratory (probe 241581; cutoff, 0). All data sets were accessed through the Oncogenomics Section Data Center of the Pediatric Oncology Branch of the NCI (Javed Khan, MD, principal investigator.)

Download figure to PowerPoint

HER4 forms homodimers or heterodimers with the other ERBB members to activate signaling by multiple second messengers, and that signaling is pivotal for its final biologic effects.2 One means by which HER4 may contribute to malignant behavior is increased expression of Her4 in nonadherent tumor spheroids, possibly because of signaling mediated by cell-cell adhesion.8 Three-dimensional cultured tumor spheroids are known to have acquired chemoresistance and radioresistance,9-11 which have been reported for various cancer types.9-12 Although neuroblastoma may have the same pattern of multicellular resistance (MCR),13 very few studies have focused specifically on elucidating the underlying mechanism.

The role of HER4 in cancer remains controversial.14-16 HER4 expression was reported as an adverse prognostic factor in some studies17 but a favorable factor in others, even in reports on the same tumor type.18, 19 These disparate results may arise from the expression of 4 alternatively spliced isoforms of HER4, which differ in subcellular localization and function.20, 21 The alternatively used α exon (JM-a/JM-d isoforms) encodes a recognition element for disintegrin and metalloproteinase domain-containing protein 17 preproprotein (ADAM17)-mediated proteolysis. Isoforms lacking this exon (juxtamembrane [JM]-b/JM-c) cannot be cleaved by ADAM17. After 2-step proteolysis by ADAM17 (required first) and then γ-secretase, the cytosolic fragment of HER4 (HER4 intracellular domain [4ICD]/p80) is released from the membrane and may traffic to the nucleus.22 The CYT-1 and CYT-2 isoforms differ in their subsequent activation of downstream signaling pathways and protein degradation processes.23 Some studies failed to distinguish between membranous, cytoplasmic, and nuclear expression of HER4, confounding associations between expression and outcome.

To assess the role of HER4 in neuroblastoma, we evaluated HER4 expression under different culture conditions, discovering HER4 up-regulation during cell stress. HER4 knockdown by small-hairpin RNA (shRNA) decreased resistance to multiple adverse factors, including loss of attachment, serum starvation, and cytotoxic agents. Transduced intracellular HER4 reduced cell proliferation and protected cells from apoptosis. Our findings suggest that HER4 plays a protective role against cellular stress in neuroblastoma, indicating that HER4 expression may be an unfavorable prognostic factor and a potential therapeutic target for neuroblastoma.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

Cell Culture and Reagents

The neuroblastoma cell lines IMR32, CHP134, and LAI-55N were cultured as described previously.4 COL, cultured as described,16 was previously identified as an osteosarcoma. However, based on its expression of cluster of differentiation 56 (CD56 [neural cell adhesion molecule]) and Nestin; its lack of expression of other small, round, blue cell tumor markers; its massive N-Myc amplification; and its in vivo growth characteristics (pseudorosette formation, metastasis to bone marrow, liver, and retro-orbital space in severe combined immunodeficient [SCID] mice), it is now confirmed that COL is a neuroblastoma. All cell lines were authenticated using short tandem repeat DNA fingerprinting by the Characterized Cell Line Core Facility at The University of Texas M. D. Anderson Cancer Center. For the sphere culture condition, single cell suspensions mobilized from monolayers were seeded onto poly(hydroxyethyl)methacrylate-precoated plates precoated plates (1 × 105cells/cm2; Sigma-Aldrich Corporation, St. Louis, Mo). Cis-diamminedichloroplatinum(II) (cisplatin [CDDP]), doxorubicin (DXR), and etoposide (VP-16) were purchased from Sigma-Aldrich Corporation, and 4-hydroxy-ifosfamide (4-H-ifo) was purchased from Niomech (Bielefeld, Germany).

Cell Proliferation and Viability Assay

Cell proliferation was measured by direct nucleus counting as described previously24 or by Alamar Blue assay in a 96-well format.

Soft Agar Clonogenic Assay

Soft agar clonogenesis was assessed as described previously.25 Cells were seeded in 0.35% top agar at 2000 cells per well on 0.5% bottom agar in 6-well plates. After 21 days, viable colonies were stained with 3-(4.5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma Chemical Company, St. Louis, Mo), photographed (ChemiDoc XRS; Bio-Rad, Hercules, Calif), and counted by Quantitive One software (Bio-Rad).

DNA Vector Design and Retroviral Transduction

The shRNA sequences for human HER4 targeting shRNA were as follows: sense, 5′GATCCCCGCCAAGAAAGCGTTTGACATTCAAGAGATGTCAAACGCTTTCTTGGCTTTTTC3′; and antisense, 5′TCGAGAAAAAGCCAAGAAAGCGTTTGACATCTCTTGAATGTCAAACGCTTTCTTGGCGGG3′. The sequences for scrambled control shRNA were as follows: sense, 5′GATCCCCGCGCGCTTTGTAGGATTCGTTCAAGAGACGAATCCTACAAAGCGCGCTTTTTC3′; and antisense, 5′TCGAGAAAAAGCGCGCTTTGTAGGATTCGTCTCTTGAACGAATCCTACAAAGCGCGCGGG3′. The shRNA was inserted into a circular pSuperior.retro.neo+gfp (OligoEngine) vector after digestion with BgLII and XhoI (New England BioLabs, Ipswitch, Mass). HER4 intracellular domain inserts 4ICD-CYT1 and 4ICD-CYT2 were amplified by polymerase chain reaction analysis using described techniques22 and was inserted into the multiple cloning site of the MIgR1-mKate2-C retroviral expression vector to create a 4ICD with a c-terminal mKate2 tag. The MIgR1-mKate2-C vector was generated from the Hes1-MIgR1 vector25 by replacement of Hes1 (first position) with mKate226 and replacement of EGFR with a puromycin resistance gene. Cells were transduced as described perviously,25 selected for puromycin resistance, then analyzed by fluorescence-activated cell sorting for far-red fluorescence.

Western Blot Analysis

Cells were lysed and immunoblotted as described.24 Primary antibodies for EGFR and HER4 (antibodies 1902-1 and 1200-1, respectively; Epitomics, Burlingame, Calif) and for poly(adenosine diphosphate ribose) polymerase (PARP) and cyclin D (antibodies 9542 and 2978, respectively; Cell Signaling Inc., Danvers, Mass). Beta-actin (Sigma-Aldrich Corporation) served as a loading control.

Cell Cycle Analysis

Monolayer-cultured cells were detached by cell dissociation buffer (Invitrogen, Carlsbad, Calif). Spheres were pelleted by centrifuge and disaggregated by incubation with cell dissociation buffer for 10 minutes in 37°C. The cell cycle was analyzed with propidium iodide and flow cytometry as previously described.24

Messenger RNA Microarray Analysis

Col-NC and Col-SH2 cells were grown in 6-well plates with 4 replicates each of monolayer or spheres. Total RNA was extracted using a mirVana microRNA Isolation Kit (Ambion-Life Technologies, Carlsbad, Calif). Total RNA was amplified and converted into biotin-labeled combinational RNA (cRNA) using the Illumina TotalPrep RNA Amplification Kit (Illumina, Inc., San Diego, Calif). After purification, 0.75 μg cRNA were fragmented and hybridized to HumanHT-12 v4 BeadChip (Illumina, Inc.). The chips were scanned with iScan system (Illumina, Inc.), and the signal intensities were quantified and summarized using GenomeStudio software (Illumina, Inc.). After removal of the probe sets with intensities below noise, the data were quantile normalized. The significantly differentially expressed genes were identified using 2-sample t tests and a beta-uniform mixture model to control the false-discovery rate at 5%. The pathway analysis was performed using the significant genes in the Ingenuity Pathway Analysis (IPA) software.

Bromodeoxyuridine Incorporation Assay

Monolayer cells were treated with bromodeoxyuridine (BrdU) for 15 minutes before harvesting, whereas spheres were incubated with BrdU overnight. The cells were fixed and treated with DNase, stained with fluorescein isothiocyanate-anti-BrdU antibody (1:50 dilution; Becton Dickinson and Company, Franklin Lakes, NJ), and analyzed with flow cytometry.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

HER4 Expression Was Density-Dependent and Up-Regulated in Sphere Culture

We measured the expression of HER4 in neuroblastoma cell lines by Western blot analysis. In Col and CHP134 cells, HER4 expression increased with increasing cell density (Fig. 2A). When converted from monolayer to anchorage-independent culture, neuroblastoma cells tended to aggregate spontaneously and formed tumor microspheres as previously described.27 We detected a striking up-regulation of HER4 in neuroblastoma spheres; the range of up-regulation varied from 1.4-fold to 6.3-fold (Fig. 2B,C). Notably, cell lines with low basal levels of HER4 exhibited much higher up-regulation than cell lines with high basal levels of HER4 expression. Moreover, even in high-expressing HER4 cells LAI-55N that had minor HER4 up-regulation, we observed increased intracellular HER4 expression (Fig. 2D). We also compared EGFR, HER2, and HER3 expression between monolayer and sphere cultures. Unlike HER4 expression, EGFR expression did not increase in sphere culture, whereas basal HER2 and HER3 expression levels were too low to detect4 and did not increase in sphere culture (data not shown). These data demonstrate that HER4 expression varies depending on culture conditions, suggesting that HER4 may regulate the response to different conditions.

thumbnail image

Figure 2. The expression of human epidermal growth factor 4 (HER4) is density-dependent and is up-regulated in sphere culture. (A) The neuroblastoma cell lines Col and CHP134 were seeded at different densities. Photomicrographs demonstrate densities of +, ++, +++, and sphere (SP). (B) HER4 expression was measured in monolayer (MN) or sphere (SP) culture in Col, CHP134, IMR32, and LAI-55N cells by Western blot analysis. (C) HER4 expression in CHP134 monolayer cells and spheres was detected by immunofluorescence (red); Hoechst 33342 (blue) counterstains the nuclei. (C) HER4 intracellular domain (4ICD) expression in LAI-55N monolayer (MN) and sphere (SP) cells was measured by Western blot analysis.

Download figure to PowerPoint

Neuroblastoma Tumor Spheres Exhibited Chemoresistance

We seeded Col and CHP134 cells onto plates that were precoated with nonadherent substrate. After 24 hours, compact spheres were generated spontaneously (Fig. 3A1). Scanning electron microscopy revealed that individual tumor cells adhered tightly with adjacent cells, such that the cell boundary was obscure (Fig. 3A2). Further culture for 96 hours resulted in a mixture of healthy, necrotic, and apoptotic cells in the center of the spheres (Fig. 3A3). Transmission electron microscopy revealed that tight cell-cell adhesion was well established within spheres (Fig. 3A4). We compared cell proliferation in monolayer and sphere culture using an Alamar Blue assay. Tumor spheres grew at a much lower rate than monolayer culture with elongated doubling time (Fig. 3B). We reasoned that, because chemotherapy predominantly affects cells that are rapidly dividing, the slower growing cells in spheres may be more resistant to chemotherapy. To observe whether the sphere culture would cause neuroblastoma cells to be less sensitive to chemotherapy, we compared cell viability between monolayer culture and spheres after exposure to drugs that are used clinically for neuroblastoma therapy: CDDP, DXR, VP-16, and 4-H-ifo. Col and CHP134 cells in sphere culture were more chemoresistant than cells grown in monolayer (Fig. 3C). These results suggest that neuroblastoma cells can survive and grow in anchorage-independent conditions by forming spheres, which confers a chemoresistant phenotype, perhaps because of reduced proliferation.

thumbnail image

Figure 3. The morphology and phenotype of neuroblastoma tumor spheres are illustrated. (A) These photomicrographs show (1) the morphology of 3-dimensional tumor spheres under light microscopy; (2) the surface of tumor spheres under scanning electron microscopy; (3) the coexistence of healthy, apoptotic, and necrotic nuclei; and (4) tight cell-cell adhesion within tumor spheres under transmission electron microscopy (original magnification, ×400 in A1, ×1000 in A2, ×5000 in A3, ×20,000 in A4). (B) Cell proliferation was measured by Alamar Blue assay. (C) Col and CHP134 cells were cultured in 96-well plates under monolayer or sphere conditions for 24 hours and then treated with 3 μM and 10 μM cis-diamminedichloroplatinum(II) (cisplatin [CDDP]), 0.03 μM and 0.1 μM doxorubicin (DRX), 0.3 μM and 3 μM etoposide (VP-16), and 3 μM and 10 μM 4-hydroxy-ifosfamide (4H-Ifo) for 72 hours. Cell viability was measured by Alamar Blue assay.

Download figure to PowerPoint

Knockdown of HER4 Suppressed Anchorage-Independent Survival

Because HER4 is up-regulated in sphere culture, we investigated whether the up-regulation is proapoptotic or protective for cells. If HER4 is crucial for cells to survival, then survival will decrease when HER4 is inhibited. To address this question, we used shRNA to knockdown HER4 expression in Col cells, because they had the greatest HER4 increase when transferring from monolayer to sphere culture. We selected 3 clones that had stable HER4 expression reductions >95% (Fig. 4A). First, we tested the impact of HER4 knockdown on proliferation. After 72 hours in monolayer culture, a slight decrease in cell yield was observed (Fig. 4B), possibly because of slightly increased apoptosis, as demonstrated by increased PARP cleavage in 3 shRNA clones (Fig. 4A). Furthermore, we conducted a soft agar clonogenic assay to measure anchorage-independent growth. The cells with HER4 knockdown had a significant reduction in colony formation (P < .001) (Fig. 4C).

thumbnail image

Figure 4. Knockdown of human epidermal growth factor receptor 4 (HER4) decreased the survival of neuroblastoma cells. (A) Col cells were transduced with nonsense small-hairpin RNA (shRNA) (Col-NC) or with shRNA targeting HER4 (Col-SH), and stable shRNA-expressing clones were selected (Col-SH-2, Col-SH-3, and Col-SH-4). Cells were cultured in monolayer or sphere conditions for 72 hours. Immunoblots were used to assess HER4 and poly(adenosine diphosphate ribose) polymerase (PARP) expression. β Actin served as a loading control. (B) Cell yields of Col-NC and HER4 knockdown cells were measured by Vi-cell after 72 hours of culture (double asterisks indicate P < .01). (C) Col-NC and HER4 knockdown clones were seeded in soft agar and cultured for 3 weeks (triple asterisks indicate P < .0001). Histograms illustrate average colony counts. (D) Cell cycle analyses of Col-NC and HER4 knockdown clones cultured in monolayer (MN) or sphere (SP) conditions for 72 hours are illustrated.

Download figure to PowerPoint

The soft agar clonogenic assay measures tumor survival as single cells in the anchorage-independent condition. Multicellular tumor spheres may be more resistant to cellular stress (see Fig. 3), so we wanted to determine whether HER4 knockdown also could affect the survival of tumor spheres. We conducted a cell cycle analysis based on propidium iodide staining and quantified the sub-G1 population to represent cell death. We observed that cells grown in sphere culture exhibited G1 arrest compared with monolayer culture, consistent with our observation that tumor spheres are slow-growing. HER4 knockdown caused a slight increase in the sub-G1 population in monolayer cells but a larger increase in the sub-G1 population when cells were grown as spheres (Fig. 4D). To test whether the sub-G1 population represented apoptosis, we measured the level of PARP cleavage by immunoblotting. All 3 shRNA clones had increased levels of cleaved PARP compared with controls (Fig. 4A), indicating apoptosis. Together, these findings demonstrated that knockdown of HER4 in Col cells reduced survival in anchorage-independent growth by increasing apoptosis both in single-cell or multicellular spheres. This indicates that HER4 is crucial for anoikis resistance in neuroblastoma.

Knockdown of HER4 Reduced Tolerance to Serum Starvation

The data detailed above suggest that, in stressed conditions like loss of surface attachment, tumor cells up-regulate HER4 expression, and loss of HER4 renders cells susceptible to death from stressful conditions. We wondered how generalizable this HER4 response would be to other cellular stress. Hence, we first tested whether serum starvation had any impact on HER4 expression. After culturing Col and CHP134 cells without fetal bovine serum for 24 hours, 48 hours, and 72 hours, HER4 was up-regulated in a time-dependent manner (Fig. 5A). The HER4 intracellular fragment also increased in proportion to the full-length protein. To evaluate the importance of HER4 in survival during serum deprivation, Col cells with nonsense and HER4–specific shRNA were cultured in monolayers or as spheroids, and fetal bovine serum was withdrawn 24 hours later. Cells were starved for 48 hours before we measured the cell cycle. In monolayer culture, HER4 knockdown cells had a higher sub-G1 population in response to serum deprivation, whereas nonsense control cells had few cells in the sub-G1 population (Fig. 5B). In tumor spheres, the increase in the sub-G1 population caused by HER4 knockdown was even more dramatic because of the coexistence of 2 stress factors (Fig. 5B). These data indicate that HER4 knockdown caused Col cells to become less resistant to limited nutrition. Because nutrition insufficiency is a very common event in solid tumors (because of the high metabolism of cancer), this finding suggests that HER4 may be critical for tumor cells to adapt to nutritional insufficiency in neuroblastoma.

thumbnail image

Figure 5. Human epidermal growth factor receptor 4 (HER4) expression was up-regulated in response to serum starvation, and HER4 knockdown reduced tolerance to serum deprivation. (A) Col and CHP134 cells were deprived of serum beginning at 80% confluence for the indicated times; then, the cells were lysed and subjected to immunoblotting to HER4. Full-length Her4 indicates; 4ICD, HER4 intracellular domain; PARP, poly(adenosine diphosphate ribose) polymerase. (B) Col cells transduced with nonsense small-hairpin RNA (Col-NC) and HER4 clones were cultured in monolayer (MN) or spheres (SP) conditions, then deprived of serum for 48 hours, and the cell cycle was measured by flow cytometry.

Download figure to PowerPoint

HER4 Knockdown Increased Chemosensitivity

We have observed chemoresistance in neuroblastoma tumor spheres, and our previous data support a role for HER4 in cellular stress response and apoptosis regulation. Therefore, we investigated whether HER4 up-regulation in tumor spheres contributes to chemo-resistance. We performed a viability assay on cell lines with knocked down HER4 after exposure to the drugs commonly used in treating neuroblastoma. After 72 hours, all HER4 knockdown cells presented lower viability upon treatment with cytotoxic drug than control cells (Fig. 6A). Furthermore, cell cycle analysis revealed that HER4 knockdown clones had a dramatically greater proportion of the sub-G1 population compared with nonsense control cells (Fig. 6B), indicating increased apoptosis. With HER4 knockdown, monolayer cells had increased chemosensitivity, and tumor spheres lost their chemoresistance phenotype. These findings suggest that HER4 is required to provide neuroblastoma cells with a protective mechanism against cytotoxic drugs. The resistance to chemotherapy observed in neuroblastoma cells when cultured as tumor spheres is partially because of HER4 up-regulation.

thumbnail image

Figure 6. Human epidermal growth factor receptor 4 (HER4) knockdown increased chemosensitivity in neuroblastoma cell lines. (A) Col cells transduced with nonsense small-hairpin RNA (Col-NC) and HER4 knockdown cells were cultured in 96-well plates and treated with 10 μM and 30 μM cis-diamminedichloroplatinum(II) (cisplatin [CDDP]) and with 0.03 μM and 0.1 μM doxorubicin (DXR) for 3 days. Cell viability was measured using an Alamar Blue assay (double asterisks indicate P < .01; triple asterisks, P < .0001). (B) Col-NC and HER4 knockdown clones were treated with different drugs for 3 days, including CDDP, DXR, and 4-hydroxy-ifosfamide (4H-Ifo). No Tx indicates no treatment. The cell cycle was analyzed by flow cytometry, and sub-G1 populations were measured.

Download figure to PowerPoint

HER4 Is Involved in Cell Cycle Regulation

To understand how HER4 contributes to stress protection and chemoresistance, we used a messenger RNA (mRNA) microarray to identify changes in gene expression induced by HER4 knockdown. Col cells were transduced with HER4-specific or control shRNA and cultured in either monolayers or spheres; mRNA was isolated from 5 individual biologic replicates under each condition. We measured the gene expression of all samples using the HumanHT-12 v4 BeadChip (Illumina, Inc.). We compared control versus knockdown samples for each condition, and differentially expressed genes were identified with a 5% false-discovery rate. To categorize these changes functionally, we used IPA. In monolayers, the “molecular and cellular functions” most altered by Her4 knockdown were cell cycle-associated genes. In the more stressed sphere condition, however, the most significant categorized function is “cell death,” as expected from the data illustrated in Figures 3 through 6. Genes associated with “DNA replication, recombination, and repair” changed with HER4 knockdown in both conditions (Fig. 7A). We hypothesized that HER4 knockdown would result in an alteration of the cell cycle, which may contribute to the vulnerability of HER4 knockdown cells. To further explore how HER4 may regulate gene expression, the associations between HER4 and the identified genes with differential expression in the “cell cycle,” “cell death,” and “DNA replication, recombination, and repair” categories were mapped using the network function of IPA centered on Her4 (Fig. 7A). This network identified potential mechanisms by which HER4 may regulate the cell cycle and cell death. However, more studies are required to confirm and elucidate the functional relation of these genes.

thumbnail image

Figure 7. Human epidermal growth factor receptor 4 (HER4) is involved in cell cycle regulation. (A) Gene expression in Col cells that were transduced with either nonsense small-hairpin RNA (shRNA) or HER4-specific shRNA was compared using the Illumina Human HT-12v4 BeadChip and scan system (Illumina, Inc., San Diego, Calif). Genes that had significant differential expression were identified and analyzed further by ingenuity pathway analysis. The high-confidence categorized functions of the significant genes are listed in the tables. Genes that had known connections with HER4 in the categories “cell cycle,” “cell death,” and “DNA replication, recombination, and repair” are illustrated in a network. YAP1 indicates yes-associated protein 1; MAP2K3, mitogen-activated protein kinase kinase 3; SERPINE2, serpin peptidase inhibitor, clade E, member 2; CRK, v-crk sarcoma virus CT10 oncogene homolog (avian); CADM1, cell adhesion molecule 1; ERBB4, v-erb-a erythroblastic leukemia viral oncogene homolog 4 (murine); PIK3R2, phosphoinositide-3-kinase, regulatory subunit 2; IGFBP5, insulin-like growth factor binding protein 5; EFNB2, ephrin B2; NCK2, NCK adaptor protein 2; DLG4, discs, large homolog 4; CDKN2A, cyclin-dependent kinase inhibitor 2A; FIGF, c-fos induced growth factor (vascular endothelial growth factor D. (B) Cyclin D expression was measured by Western blot analysis in various Col cell lines. (C) Col cells transduced with nonsense shRNA (Col-NC) and with shRNA targeting HER4 (Col-SH-2) were cultured in monolayer or sphere conditions for 72 hours, and the cell cycle was assessed with flow cytometry. Histograms illustrate the proportion of cells in G0/G1-phase (a single asterisk indicates P < .05; triple asterisks, P < .0001). (D) The cell cycles of representative samples from C are illustrated.

Download figure to PowerPoint

To follow-up on the potential role of HER4 in the cell cycle that we observed in the microarray data, we measured cell cycle-related molecules in HER4 knockdown and control cells by Western blot analysis. Similar to previous findings reported by others,27 we observed that cyclin D was suppressed in spheres compared with monolayers (Fig. 7B), which was reflected in reduced proliferation and G1 arrest (54.8% ± 0.7% vs 63.1% ± 0.7%; P < .001) (Fig. 7C,D). However, HER4 knockdown partially rescued the suppression of cyclin D caused by sphere culture. In parallel, cell cycle analysis revealed a significantly smaller proportion of cells in G1-phase among HER4 knockdown cells (Fig. 7C). Together, these data suggest that cells would respond protectively to stress by arresting the cell cycle in G1 phase, allowing more time for DNA repair. However, HER4 knockdown impairs this mechanism and drives cell cycle progression, leading to increased apoptosis.

The HER4 Intracellular Domain Suppressed the Cell Cycle and Conferred Chemoresistance

Because HER4 is a receptor tyrosine kinase (RTK), we wanted to investigate whether the activity of the tyrosine kinase is responsible for the stress-protective role of HER4. Because, to our knowledge, there is no HER4-specific RTK inhibitor, we used CI-1033, a pan-ERBB inhibitor, to inhibit HER4 activation. In addition, an antibody (clone H4.72.8; Thermo Scientific, Braunschweig, Germany) that recognizes the ectodomain of HER4,28 also was used to inhibit the binding of heregulin, a ligand of HER4, which blocked the activation of the HER4 tyrosine kinase. However, neither CI-1033 nor the HER4-blocking antibody reproduced the impact of HER4 knockdown on the cells (data not shown). Because the intracellular fragment of HER4 can function as a transcription factor,18, 29, 30 we asked investigated intracellular HER4 was sufficient to confer stress protection. To study how intracellular HER4 would impact the cells, we transduced Col cells with the intracellular HER4 isoforms CYT-1 and CYT-2. Both HER4 isoforms reduced cell yield after 3 days of growth (Fig. 8A,B). To determine whether the loss of cell yield was caused by reduced proliferation, we performed a BrdU incorporation assay to measure S-phase cells. Consistent with the proliferation assay, Col-CYT-1 and Col-CYT-2 had lower percentages of dividing cells than control cells, as indicated by the proportion of BrdU-positive cells (Fig. 8C). We further tested whether this suppressed cell cycle would confer chemoresistance. Although both isoforms conferred resistance to CDDP, overexpression of the CYT-1 HER4 isoform produced a more resistant phenotype (Fig. 8D). These results support the notion that the HER4 intracellular fragment regulates the cell cycle. Together with previous data, our findings indicate that neuroblastoma cells adapt to cell stress by up-regulating HER4 to acquire a relatively slow-growing phenotype and to protect themselves from apoptosis.

thumbnail image

Figure 8. The human epidermal growth factor receptor 4 (HER4) intracellular domain (4ICD) suppressed the cell cycle and conferred chemoresistance. (A) Two isoforms of 4ICD were transduced into Col cells (CYT-1 and CYT-2). Overexpression of 4ICD was tested by immunoblotting. Col-mKate indicates control cells; FL-Her 4 indicates full-length Her4. (B)The proliferation of control and 4ICD-overexpressed cells was measured by cell counting after 72 hours of culture (triple asterisks indicate P < .0001). (C) Histograms illustrate bromodeoxyuridine (BrdU) incorporation of control cells, Col-CYT-1 cells, and Col-CYT-2 cells grown in monolayer and sphere conditions (a single asterisk indicates P < .05). (D) Control cells, Col-CYT-1 cells, and Col-CYT-2 cells were cultured in monolayer and sphere conditions and were treated with 5 μM and 10 μM cis-diamminedichloroplatinum(II) (cisplatin [CDDP]) for 72 hours, and the cell cycle was analyzed by flow cytometry.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

Resisting cell death is one of the hallmarks of cancer.31 Under less than ideal conditions, such as serum starvation, loss of attachment, hypoxia, etc, cancer cells usually have greater resistance to death than normal cells. An improved understanding of the mechanisms that provide this resistance to stress may clarify the reasons for treatment failure in patients with cancer. In the current study, we observed altered expression of HER4 in neuroblastoma cells in response to changes in the culture environment. In particular, there was up-regulation of HER4 when cells were exposed to diverse stressors. This led us to consider 2 opposing roles for the function of HER4 inside the cell. First, HER4 may mediate proapoptotic signaling to trigger cell death. Second, HER4 may mediate the up-regulation or down-regulation of diverse genes required for cells to survive under stress. Both models have been proposed by other investigators.8, 18 In our study, we sought to determine whether HER4 acts to promote cell survival or cell death in neuroblastoma cells and to identify the mechanism by which it acts. Identifying how HER4 contributes to malignant behavior could provide new therapeutic opportunities.

First, we observed density-dependent HER4 expression: HER4 was up-regulated when cells cultured in vitro became more confluent. A high level of confluence causes increased cell-cell adhesion because of the close proximity of cells to one another. Cell-cell adhesion mediates important biologic functions, including transduction of proliferative signals.8 Low-confluence cell culture is considered a poor experimental model, because it lacks cell-cell adhesion and bears less resemblance to a solid tumor. Our findings indicate that cells in greater confluence express more HER4 than cells in lower confluence, suggesting that cell-cell adhesion may trigger downstream signals to increase HER4 expression. It is widely known that cancer cells typically have no contact inhibition, and this feature is considered a manifestation of malignancy.31 Here, we have demonstrated that HER4 is up-regulated upon reaching confluence. This up-regulation may be 1 of the mechanisms that regulate the suppression of contact inhibition in cancer cells. Furthermore, over confluence is stressful because of a lack of sufficient nutrients, space, etc, which would cause an increase in reactive oxygen species (ROS) and would induce senescence32 and, thus, the up-regulation of HER4 when over confluence may be protecting cells from stress. A similar finding was been observed previously with regard to heat-shock protein 27 (HSP27), a well known cell stress protector.33

We also observed that, when neuroblastoma cells were grown on nonadherent plates, they aggregated spontaneously to form compact spheroids, which has been observed in different cancer types.9, 34, 35 The multicellular tumor sphere usually is considered a model that holds an intermediate complexity between monolayer cell culture and an in vivo model,9 and it may be a useful tool for mimicking avascular tumor regions and micrometastases in the prevascularized stage. It is regarded as a better model than monolayer cell culture, because it resembles solid tumors more closely in several respects, including tight cell-cell adhesion,27, 36 moderate proliferation rate,27 hypoxic microenvironment,37 and chemotherapy/radiation resistance.10, 12, 27 One important factor that may cause therapy ineffectiveness is the intrinsic resistance to the adverse environment that comes from the 3-dimensional structure within the bulk of tumors: MCR.10 Our data reveal that HER4 up-regulation is 1 of the events that occur during the acquisition of MCR. We believe that HER4 may be an important factor contributing to MCR, because HER4 knockdown caused a phenotype that was more vulnerable to the stressors used in our experiment. This would strengthen the point that it may serve as a therapeutic target.

The acquisition of anoikis resistance is perceived as 1 of the prominent features of tumorigenesis31 and is associated with metastasis. Some groups used the multicellular tumor sphere model to study anoikis resistance.27, 38, 39 Although tumor cells in this model are not fully “homeless” because of the multicellular structure of the sphere, tumor cells do suffer from loss of attachment in early stages when cells are still in suspension as single cells. For tumor spheres as a whole, the anchorage-independent culture condition still is stressful, and the cells had decreased proliferation. A proteomic analysis of neuroblastoma tumor spheres revealed changes in proteins that regulate the cell stress response.35 Thus, the stress that cells undergo in tumor spheres could cause a reactive up-regulation of HER4 if HER4 indeed is a cell stress regulator. Our results revealed that knockdown of HER4 made neuroblastoma cells more susceptible to death from loss of attachment, indicating that HER4 protects cells from anoikis by regulating response to cellular stress. Because anoikis resistance is associated with metastasis, it is possible to use HER4 as a target to reduce tumor metastasis. The effect of reducing tumor metastasis may be increased by combining HER4-targeted therapy with established regimens for treating malignant tumors with chemotherapeutics or radiation therapy.

Serum starvation is a well established approach for inducing a broad range of cellular stress. It induces oxidative stress and causes an accumulation of intracellular ROS.40 In the current study, we observed the up-regulation of HER4 upon serum starvation in neuroblastoma cell lines and 293T cells (data not shown). We also demonstrated that HER4 knockdown rendered the cells less tolerant to serum deprivation. It has been demonstrated that HER4 signaling protects neural-origin tumor cells from serum starvation41 and oxidative stress.42 Another group demonstrated that ROS activates neuregulin-1β/HER4 paracrine signaling in the heart, suggesting that HER4 is involved in cardiac adaptation to oxidative stress.43 Together with our findings, these data support the proposition that stress-induced HER4 expression may function protectively to maintain homeostasis and prevent apoptosis.

The role of HER4 in cancer has been controversial.14, 18, 44-47 One possible explanation for the conflicting observations may be that different isoforms and the subcellular localizations of HER4 differ in function.15, 20 It has been established that 4ICD functions as a transcription factor in the nucleus.29, 48, 49 In the current study, our experimental model using neuroblastoma proposes another explanation for the contradiction. Our results demonstrated that HER4 sufficiently protects cancer cells from different kinds of cellular stressors that can contribute to the malignancy. In contrast, insertion and overexpression of 4ICD suppressed the cell cycle and cell proliferation, making HER4 take on an “inhibitory” role. One recent study suggested that high HER4 expression correlates with a low mitosis karyorrhexis index, an indicator of mitosis activity. However, those investigators also observed that high HER4 expression was associated with clinical high-risk groups, metastasis, and poorer survival,5 consistent with our laboratory findings. The regulation of tumor dormancy affects metastasis and therapeutic response.50, 51 In essence, these observations point to the idea that tumors growing more slowly may be harder to treat. Together with our findings, these reports suggest that, although HER4 may reduce proliferation, its overexpression renders a refractory phenotype, which may be highly dependent on the microenvironment. Although the prognostic relevance of HER4 in neuroblastoma needs to be confirmed with larger scale clinical-pathologic analyses, at the least, levels of HER4 expression should be considered as 1 important factor that influences outcome.

In conclusion, HER4 expression can be induced by various types of cellular stress in neuroblastoma and functions to protect cells from apoptosis. HER4 knockdown increases the vulnerability of neuroblastoma cells to chemotherapy. Intracellular HER4 may provide protection from stress by slowing proliferation and conferring increased chemoresistance. Further investigation is required to understand the consequences of HER4 intracellular signaling and whether signaling at the membrane is required in conjunction with the transcriptional regulation provided by the soluble HER4 fragment to provide protection from stress. Thus, HER4 has been suggested as a potential therapeutic target in neuroblastoma and Ewing sarcoma,8 and this may raise interest in developing new strategies against HER4 in pediatric solid tumors.

FUNDING SOURCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

This work was supported by grant 1R01-CA149501 (D.P.M.H.), grant 1K08CA118730, the Physician-Scientist Program of The University of Texas M. D. Anderson Cancer Center (D.P.M.H.), and the Jori Zemel Children's Bone Tumor Foundation (Y.H.). The High-Resolution Electron Microscopy Facility at The University of Texas M. D. Anderson Cancer Center was funded by institutional core grant CA16672.

CONFLICT OF INTEREST DISCLOSURES

The authors made no disclosures.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES