SEARCH

SEARCH BY CITATION

Keywords:

  • microRNA;
  • esophageal adenocarcinoma;
  • gastric adenocarcinoma;
  • microarray;
  • prognosis

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

BACKGROUND

MicroRNAs (miRNAs) play critical roles in tumor development and progression. The finding that a single miRNA can regulate hundreds of genes places miRNAs at critical hubs of signaling pathways. For the current study, the authors investigated the miRNA expression profile of gastric adenocarcinomas and compared it with esophageal adenocarcinomas to better identify a unique miRNA signature of gastric adenocarcinoma.

METHODS

miRNA expression profiles were obtained using 2 different proprietary microarray platforms on primary gastric adenocarcinoma tissue samples. The cross comparison of results identified 17 up-regulated miRNAs and 12 down-regulated miRNAs that overlapped in both platforms. Quantitative real-time polymerase chain reaction was performed for independent validation of a representative set of 8 miRNAs in gastric and esophageal adenocarcinomas compared with normal gastric mucosa or esophageal mucosa, respectively.

RESULTS

The deregulation of miR-146b-5p, miR-375, miR-148a, miR-31, and miR-451 was associated significantly with gastric adenocarcinomas. Conversely, deregulation of miR-21 (up-regulation) and miR-133b (down-regulation) was detectable in both gastric and esophageal adenocarcinomas. It was noteworthy that miR-200a was significantly down-regulated in gastric adenocarcinoma samples (P = .04) but was up-regulated in esophageal adenocarcinoma samples (P = .001). In addition, the expression level of miR-146b-5p displayed a strong correlation with the tumor stage of gastric cancer.

CONCLUSIONS

Gastric adenocarcinoma displayed a unique miRNA signature that distinguished it from esophageal adenocarcinoma. This specific signature may reflect differences in the etiology and/or molecular signaling in these 2 closely related cancers. The current findings suggest important miRNA candidates that can be investigated for their biological functions and for their possible diagnostic, prognostic, and therapeutic role in gastric adenocarcinoma. Cancer 2013;119:1985–1993. © 2013 American Cancer Society.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

Gastric adenocarcinoma remains a major health problem and is the second largest cause of cancer deaths worldwide.[1, 2] Moreover, the prognosis for patients with gastric adenocarcinoma remains poor, especially in advanced stages.[3] Approximately 80% of patients in the United States present with regional or distant metastases, are poorly responsive to therapy, and have an unfavorable outcome. Infection with Helicobacter pylori, classified as a class 1 carcinogen by the World Health Organization,[4] has been strongly correlated with gastric tumorigenesis through a pathway involving atrophic gastritis and intestinal metaplasia.[5] Over the past few decades, there has been a change in trends of gastric adenocarcinoma in the United States and in Northern and Western Europe. Although a significant decline in the incidence of distal adenocarcinomas has been noted in these regions, there has been a surprising increase in the incidence involving the gastric cardia, gastroesophageal junction, and distal esophagus.[6] Both gastric and esophageal adenocarcinomas are characterized by poor response to chemotherapeutics, with a 5-year survival rate below 20%.[7, 8] This poor clinical outcome can be attributed to a lack of effective strategies for early detection, the weak prognostic value of histologic indicators, the limited effect of surgery or cytotoxic treatment in advanced disease, and a lack of molecular markers used for targeted therapy.[7, 9] Although gastric and esophageal adenocarcinomas share some common biologic behaviors, they display distinct risk factors, molecular mechanisms, and histologic types.[10] Therefore, elucidating the unique molecular signature of gastric adenocarcinoma is a critical step toward understanding its biology and improving our currently limited management approaches.[14]

MicroRNAs (miRNAs), short noncoding RNAs, are post-transcriptional regulators that bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing.[15] miRNAs have emerged in the past few years as significant regulators of cellular activities, with significant implications for cancer development and progression.[16] Deregulation of miRNAs have been identified in cancers from different organs with variable histologic types.[17, 18] The expression pattern of miRNAs in tumors may provide useful information about the underlying biology and signaling pathways in cancer.[19, 20] miRNAs have been suggested as novel and powerful diagnostic, prognostic, and possibly therapeutic tools in cancer.[21, 22] In the current study, we detected the gastric cancer-related miRNAs and identified differences in miRNA expression patterns between gastric and esophageal adenocarcinomas.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

MicroRNA Microarray Analysis

For microarray analysis, total RNA was purified from 6 tissue samples that included 3 advanced gastric adenocarcinomas (stages III and IV) and 3 nontumor histologically normal tissue samples using the miRNeasy kit (Qiagen, Valencia, Calif). All samples were processed and hybridized according to the manufacturers' protocols on 2 independent microarray platforms: the Exiqon miRCURY LNA microRNA Array, version 11.0-human, which contains 1434 unique miRNAs on the chip (Exiqon Life Science, Woburn, Mass), and the Agilent Human microRNA Microarray V2, which represents 961 unique records with 723 human miRNAs (Agilent Technology, Santa Clara, Calif). To minimize variations, the normal samples were pooled into a single normal reference sample that was used for all hybridizations. This approach was considered to minimize technical variations and to allow us to focus on the most reproducible changes that are cross-validated between the 2 platforms. Preliminary analysis of the Agilent miRNA microarray data was performed using the Agilent Feature Extraction program to obtain the miRNA expression signal status. Subsequent analysis was carried out by using R language (R Foundation for Statistical Computing, Vienna, Austria; available at: http://www.r-project.org [Accessed July 13, 2012]). Overall, 136 to 230 miRNAs were detected per sample. After data transformation, interarray normalization was performed using a quantile normalization method. Data were log2 transformed, and the log2 ratio for each miRNA was computed by subtracting the log2 value in the pooled control sample from the average log2 values in 3 cancer samples. We used the limma R package to process the Exiqon miRNA expression data. The following steps were executed sequentially: 1) background correction; 2) intra-array normalization using the loess method; 3) for replicate probes, the median value was calculated to represent the miRNA intensity value; and 4) quantile normalization to allow comparison among arrays. To identify the differentially expressed miRNAs between the cancer and normal groups, we then performed a 2-class, unpaired comparison, and the P values were adjusted using the false discovery rate method.[23] The miRNAs that were detected by both platforms and exhibited differential expression between normal and cancer tissues were subjected to subsequent validation by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR).

Quantitative Real-Time Polymerase Chain Reaction

In total, 145 tissue samples (33 gastric adenocarcinomas, 37 esophageal adenocarcinomas, 47 normal gastric tissues, and 28 normal esophageal tissues) were collected from the National Cancer Institute Cooperative Human Tissue Network and the pathology archives at Vanderbilt University Medical Center. All tissue samples were collected, coded, and de-identified in accordance with the Vanderbilt University Institutional Review Board-approved protocols. Total RNA was isolated using the miRNeasy kit (Qiagen), and single-stranded combinational DNA was subsequently synthesized using a 3-step protocol that included poly(A) tail synthesis using 2 μg RNA in the presence of 1.5 U poly(A) polymerase, 10 times poly(A) buffer, and 10 times adenosine triphosphate in a reaction volume of 15 μL; incubation at 37°C for 30 minutes; followed by the annealing of a universal poly(dT)-adaptor at 60°C for 5 minutes. Reverse transcription was carried out by means of iScript kit (Bio-Rad, Hercules, Calif) according to the manufacturer's instructions. Primers for qRT-PCR were designed by means of the online database miRbase (available at: http://www.miRbase.org/ [Accessed September 2, 2012]); Table 1 lists the primers' sequences. qRT-PCR was carried out using the CFX Connect Real-Time System (Bio-Rad). The reactions were carried out in a 96-well plate according to a thermal protocol that included an initial incubation at 95°C for 3 minutes followed by 40 cycles of a 2-step annealing at 95°C for 10 seconds and 60°C for 30 seconds. Normalization was made to 2 reference miRNAs: miR-191 and miR-103a-5p.[24] The fold change was calculated based on the formula 2(Rt − Et)/2(Rn − En), where Rt is the threshold cycle number of the reference gene in the tumor sample, Et is the threshold cycle number of the experimental gene in the tumor sample, Rn is the threshold cycle number for the reference gene in the normal sample, and En is the threshold cycle number of the experimental gene in the normal sample.[25] A heat map representing the relative fold changes in tumors and normal tissues was constructed using Treeview software (EisenLab, Berkeley, Calif). The Student t test was used to evaluate statistical significance, and the cutoff P value was set at ≤ .05.

Table 1. Primers Used in Quantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis of MicroRNAs
MicroRNAPrimer Sequence
  1. Abbreviations: miR, microRNA.

Universal 5′ primerGCGAGCACAGAATTAATACGAC
miR-191CAACGGAATCCCAAAAGCAGCTG
miR-21TAGCTTATCAGACTGATGTTGA
miR-146b-5pTGAGAACTGAATTCCATAGGCT
miR-375TTTGTTCGTTCGGCTCGCGTGA
miR-148aTCAGTGCACTACAGAACTTTGT
miR-31AGGCAAGATGCTGGCATAGCT
miR-133bTTTGGTCCCCTTCAACCAGCTA
miR-451AAACCGTTACCATTACTGAGTT
miR-200aTAACACTGTCTGGTAACGATGT

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

Deregulation of MicroRNAs in Gastric Adenocarcinoma

We identified 17 up-regulated and 12 down-regulated miRNAs that were consistently deregulated in both microarray platforms (Fig. 1). The details of these miRNAs are provided in Table 2. Eight miRNAs (up-regulated, miR-146b-5p and miR-21; down-regulated, miR-375, miR-133b, miR-148a, miR-31, miR-200a, and miR-451) were selected for validation using qRT-PCR based on their expression level (greater than 2-fold change) and known cancer-related molecular functions, such as regulating cancer cell proliferation, apoptosis, and invasion (Fig. 2). We confirmed that these miRNAs were significantly deregulated in gastric adenocarcinoma samples compared with normal gastric mucosae. Our next step was to determine whether any of these miRNAs were also deregulated in the closely located esophageal adenocarcinomas. Analyses of these miRNAs in esophageal adenocarcinoma samples indicated that miR-21 and miR-133b were similarly deregulated in both gastric and esophageal adenocarcinomas (Fig. 3). Conversely, 5 of the 8 miRNAs were not altered significantly in esophageal adenocarcinomas. In addition, miR-200a, which was down-regulated in gastric adenocarcinomas, was up-regulated in esophageal adenocarcinomas (Fig. 4). These data suggest the presence of unique differences between gastric and esophageal adenocarcinomas. Linear regression analysis of miRNA alterations indicated that miR-146b-5p expression levels had a strong correlation with gastric adenocarcinoma stage classification (r2 = 0.46) (Fig. 5).3

image

Figure 1. These are Venn diagrams of microRNA (miRNA) microarray analysis. The Venn diagram was used to identify overlapping and nonoverlapping miRNA in the analysis of Exiqon (Exi) and Agilent (Agi) microarrays. miRNAs with a ≥2-fold change difference (up or down) were included. D indicates down-regulated; U, up-regulated.

Download figure to PowerPoint

image

Figure 2. Validation of the expression of 8 microRNAs (miRs) is illustrated using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). (A) Expression levels of 8 miRs (miR-146b-5p, miR-21, miR-375, miR-148a, miR-31, miR-133b, miR-451, and miR-200a) were evaluated by qRT-PCR using 33 gastric adenocarcinoma tissues and 47 normal gastric tissues. miR-191 and miR-103a-5p were used for normalization, and data are expressed as the relative expression level. Horizontal bars indicate the arithmetic mean. Statistical analysis was performed using the Student t test, and P values ≤ .05 were considered statistically significant. (B) This heat map illustrates the relative expression levels of the 8 miRs in gastric adenocarcinoma and normal gastric tissues.

Download figure to PowerPoint

image

Figure 3. This bar chart illustrates the quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis of 2 microRNAs (miRNAs) in gastric and esophageal tissues. Expression levels of miRNA-21 and miRNA-133b were evaluated by qRT-PCR using a total of 145 tissue samples (33 gastric adenocarcinoma [GC] samples, 37 esophageal adenocarcinoma [EAC] samples, 47 normal gastric [NG] samples, and 28 normal esophagus [NS] samples). miRNA-191 and miRNA-103a-5p were used for normalization, and data are expressed as the relative fold change. Box-and-whisker plots are used to illustrate the data. The bottom and top edges of each box mark the 25th and 75th percentile, respectively, and the areas between the box and the whisker extend to the 10th and 90th percentiles. P values ≤ .05 were considered statistically significant.

Download figure to PowerPoint

image

Figure 4. Differences in expression levels of microRNAs (miRNAs) are illustrated in gastric and esophageal adenocarcinoma tissues. Expression levels of 6 miRNAs (miRNA-146b-5p, miRNA-375, miRNA-148a, miRNA-31, miRNA-451, and miRNA-200a) were evaluated by quantitative reverse transcriptase-polymerase chain reaction analysis using a total of 145 tissue samples (33 gastric adenocarcinoma [GC] samples, 37 esophageal adenocarcinoma [EAC] samples, 47 normal gastric [NG] samples, and 28 normal esophagus [NS] samples). miRNA-191 and miRNA-103a-5p were used for normalization, and data are expressed as the relative fold change. The horizontal line represents the median value. Box-and-whisker plots are used to illustrate the data. The bottom and top edges of the box mark the 25th and 75th percentile, respectively, and the areas between the box and the whisker extend to the 10th and 90th percentiles. P values ≤ .05 were considered statistically significant.

Download figure to PowerPoint

image

Figure 5. The correlation between microRNA (miR)-146b-5p and tumor TNM stage is illustrated. Linear regression analysis of miR expression indicated that the level of miR-146b-5p expression had a strong correlation with gastric adenocarcinoma stage classification (r2 = 0.4580). miR-191 and miR-103a-5p were used for normalization, and data are expressed as the log10 value of the relative fold change. Patients were staged according to the American Joint Committee on Cancer TNM classification (seventh edition): 1 indicates stage I disease; 2, stage II disease; 3, stage III disease; 4, stage IV disease.

Download figure to PowerPoint

Table 2. Fold Change Expression Values of MicroRNAs in Gastric Adenocarcinomasa
Down-RegulatedUp-Regulated
miRNAAgilentExiqonmiRNAAgilentExiqon
  1. Abbreviations: Agilent, Agilent Technology (Santa Clara, Calif); ebv-miR, Epstein-Barr virus microRNA; Exiqon, Exiqon Life Science (Woburn, Mass); has-miR, human microRNA; miRNA, microRNA.

  2. a

    Fold change (FC) expression levels of miRNAs in the Agilent and Exiqon platforms are listed. miRNAs were selected if their FC values were ≤−2 (down-regulated) or ≥2 (up-regulated) in both platforms.

hsa-miR-1−6.5−2.4ebv-miR-BART162.02.9
hsa-miR-133b−6.1−3.0ebv-miR-BART32.13.0
hsa-miR-143a−5.5−2.5ebv-miR-BART73.24.4
hsa-miR-145−4.3−2.5hsa-miR-142-3p20.53.8
hsa-miR-145a−2.9−3.3hsa-miR-142-5p3.63.9
hsa-miR-148a−23.6−2.4hsa-miR-146a5.83.7
hsa-miR-203−41.2−19.6hsa-miR-146b-5p2.34.5
hsa-miR-205−63.2−93.3hsa-miR-1553.72.7
hsa-miR-31−5.0−4.7hsa-miR-1923.45.8
hsa-miR-365−8.2−2.3hsa-miR-19432.26.7
hsa-miR-375−15.1−4.8hsa-miR-20a2.52.1
hsa-miR-451−18.3−3.7hsa-miR-212.63.0
   hsa-miR-2145.72.1
   hsa-miR-2154.15.8
   hsa-miR-2235.13.3
   hsa-miR-342-3p4.22.3
   hsa-miR-7655.83.1
Table 3. Comparison of MicroRNA Expression Between Gastric and Esophageal Adenocarcinoma
 Gastric AdenocarcinomaEsophageal Adenocarcinoma
MicroRNAStatusPStatusP
146b-5pUp-regulated.004Not significant.71
21Up-regulated.019Significant.01
375Down-regulated< .0001Not significant.06
148aDown-regulated.0015Not significant.40
31Down-regulated.0006Not significant.07
133bDown-regulated0.006Significant.03
451Down-regulated0.018Not significant.33
200aDown-regulated.040Significant.001

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

MicroRNAs are noncoding RNA molecules that are widely expressed in human tissues and have significant power to regulate several biologic activities.[26] In this context, miRNAs provide a way to explore the complicated mechanisms within disease status, including cancer. Given the finding that a single miRNA may regulate hundreds of mRNAs with similar functions, miRNA has evolved as a powerful target for understanding the biology of cancer.[15] Studies have indicated that miRNA expression levels can have a diagnostic and/or prognostic value for cancer.[27, 28] Gastric and esophageal adenocarcinomas share several common features, including close anatomic proximity, histology types, and a poor prognosis in the late stages.[29, 30] However, they also have some distinguishing features, such as etiology, risk factors, and biological mechanisms.[31, 32] In the current study, we investigated the miRNA signature of gastric adenocarcinoma and examined whether there are miRNAs that are uniquely expressed in gastric adenocarcinoma but not in esophageal adenocarcinoma. The differences between the 2 cancers may provide a novel insight into understanding the mechanisms involved in the development and progression of these cancers.

miR-191 and miR-103a-5p have been identified as stably expressed and highly consistent in human normal and tumor tissues. These 2 miRNAs were statistically superior to the most commonly used reference RNAs in miRNA qRT-PCR experiments, such as 5S rRNA, U6 snRNA, or total RNA.[24] In the current study, miR-191 and miR-103a-5p were used as normalization controls. Our finding that miR-21 is up-regulated in both gastric and esophageal adenocarcinomas is in agreement with several recent findings that have documented the overexpression of miR-21 in several malignancies, such as lung cancer, lymphoma, hepatocellular cancer, and colon cancer.[33] Recent studies have demonstrated several oncogenic functions for miR-21, indicating its role in inhibiting apoptosis by suppressing the inhibitors of Ras/MEK/ERK.[36] It has also been demonstrated that miR-21 overexpression mediates the activation of NF-κB signaling, providing a link between inflammation and cancer.[33, 37] These findings suggest that miR-21 is a common oncomiR in human malignancies. Similar to miR-21, we detected the down-regulation of miR-133b in both gastric and esophageal adenocarcinomas. Earlier studies have indicated that miR-133b is down-regulated in esophageal squamous cell carcinoma and bladder cancer.[38, 39] miR-133b regulates colorectal cancer cell proliferation and apoptosis by targeting the receptor tyrosine kinase MET signaling pathway.[40] It also can directly target the pro-survival gene MCL-1, thus regulating cell survival and sensitivity of lung cancer cells to chemotherapeutic agents.[41] Our results, together with the reported studies, suggest that the deregulation of miR-21 and miR-133b regulate important pathways that control tumorigenicity, irrespective of organ type.

Through our approach, we were able to identify and validate miRNAs that were uniquely deregulated in gastric adenocarcinomas, but not in esophageal adenocarcinomas. miR-146b-5p was among the miRNAs that were uniquely overexpressed in gastric carcinomas and not in esophageal adenocarcinomas. We observed that the expression level of miR-146b-5p had strong correlation with TNM stage in gastric adenocarcinoma. A similar finding was observed in lung cancer, in which miR-146b overexpression was predictive of patients' outcomes.[42] miR-146b-5p is also up-regulated from non-neoplastic tissue to dysplasia in patients who have inflammatory bowel disease with associated colorectal cancer.[43] At the functional level, a recent report has confirmed the direct binding of miR-146b-5p on the SMAD4 3′ untranslated region. The overexpression of miR-146b-5p decreases SMAD4 levels and disrupts transforming growth factor-β signal transduction, suggesting an oncogenic role of miR-146b-5p in thyroid follicular cells.[44] Taken together, these data suggest that miR-146b expression, although tissue-specific, may play a role in tumor progression. However, it remains to be investigated whether miR-146b targets the same pathways in gastric cancer that have been identified in other cancers.

Our results demonstrated the down-regulation of miR-375, miR-148a, miR-31, and miR-451 in gastric adenocarcinomas, but not in esophageal adenocarcinomas. The down-regulation of miR-375 is consistent with previous reports that have demonstrated its role in targeting the JAK2 oncogene to suppress gastric cancer cell proliferation.[45] Expression of miR-375 in gastric adenocarcinoma inhibits expression of PDK1, which is a direct target of miR-375, followed by suppression of AKT phosphorylation. These findings explain miR-375 as a tumor suppressor in gastric adenocarcinoma.[46] We have also shown the down-regulation of miR-148a in gastric adenocarcinoma. Earlier reports indicated that miR-148a suppresses tumor cell invasion and metastasis by down-regulating Rho-associated coiled-coil containing protein kinase 1 (ROCK1). Down-regulated miR-148a was also significantly associated with TNM stage and lymph node metastasis.[47] miR-148a also promotes apoptosis by targeting BCL-2 in colorectal cancer and induces apoptosis.[48] Our results further support the role of miR-148a in tumorigenesis. We also detected the down-regulation of miR-31 in gastric cancer. Our finding is consistent with another study, which indicated that expression levels of miR-31 in gastric cancer tissues were significantly lower than the levels in nontumor tissues.[49] miR-31 expression correlates inversely with metastasis in breast cancer.[50] Silencing of miR-31 is also implicated in the aberrant activation of NF-κB signaling in tumors.[51] Loss of miR-31 has been associated with defects in the p53 pathway and functions in serous ovarian cancer and other cancers.[52] Whether the down-regulation of miR-31 in gastric cancer is associated with these functions or different targets remains to be investigated. miR-451 is down-regulated in nonsmall cell lung carcinoma (NSCLC) and is also associated with shorter overall survival in patients with NSCLC.[53] Ectopic overexpression of miR-451 suppresses the in vitro proliferation and colony formation of NSCLC cells and the development of tumors in nude mice by enhancing apoptosis, which may be associated with the inactivation of the AKT signal pathway.[53] miR-451 is also involved in the self-renewal, tumorigenicity and chemoresistance of colorectal cancer stem cells.[54] Down-regulation of miR-451 induces the expression of cyclooxygenase-2 (COX-2) and activates the Wnt pathway, which is essential for cancer stem cell growth.[54] The finding that we only detected significant down-regulation of miR-375, miR-148a, miR-31, and miR-451 in gastric adenocarcinoma tissues, but not in esophageal adenocarcinomas, may indicate the presence of distinct molecular mechanisms driving the development and progression of these 2 types of cancers.

One of our most interesting findings is related to miR-200a, which was down-regulated in gastric carcinoma but up-regulated in esophageal adenocarcinoma. It has been demonstrated that miR-200a is overexpressed or down-regulated in different cancer types.[55, 56] The expression of miR-200a mimics p38α deficiency and increases tumor growth in mouse models, but it also improves the response to chemotherapeutic agents. miR-200a targets p38α and modulates the oxidative stress response in ovarian cancer.[57] The role of miR-200a in stress response may be a predictive marker for clinical outcome in patients with ovarian cancer.[57] Conversely, all 5 members of the miRNA-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) were markedly down-regulated in cells that had undergone epithelial-to-mesenchymal transition in response to transforming growth factor-β.[58] Overexpression of the miR-200 family of miRNAs in mesenchymal cells initiated mesenchymal-to-epithelial transition (MET). Consistent with their role in regulating epithelial-to-mesenchymal transition, expression of these miRNAs reportedly was lost in invasive breast cancer cell lines with a mesenchymal phenotype,[58] suggesting that the down-regulation of miR-200a may be an important step in tumor progression. Taken together, it is possible that the up-regulation or down-regulation of miR-200a in different cancers is a reflection of its complex, tissue-specific role in tumorigenesis. There also are reports of the down-regulation of miR-143, miR-145, and miR-215 in esophageal adenocarcinomas. In addition, miR-23b and let-7b reportedly were involved in the progression from low-grade dysplasia Barrett's esophagus to esophageal adenocarcinoma.[59, 60] Additional studies that address this complexity could achieve further understanding of the different roles of miRNAs in gastric versus esophageal adenocarcinomas.

In summary, our findings demonstrate a unique miRNA expression profile in gastric tumors. Although few miRNAs shared similar expression patterns in gastric and esophageal adenocarcinomas, we have identified and validated 6 miRNAs that are uniquely deregulated in gastric adenocarcinomas. These miRNAs may provide a new approach to understand the specific molecular mechanisms that are relevant to gastric tumorigenesis with the possibility of improving our currently limited diagnostic, prognostic, and therapeutic options in this devastating worldwide disease.

FUNDING SOURCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES

This study was supported by grants from the National Institute of Health (R01CA93999), from the Department of Veterans Affairs, Vanderbilt Specialized Programs of Research Excellence (SPORE) in Gastrointestinal Cancer (P50 CA95103), the Vanderbilt Ingram Cancer Center (P30 CA68485), and the Vanderbilt Digestive Disease Research Center (DK058404).

CONFLICT OF INTEREST DISCLOSURES

The authors made no disclosures.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. REFERENCES