SEARCH

SEARCH BY CITATION

Keywords:

  • oxaliplatin;
  • neurotoxicity;
  • biomarkers;
  • chemotherapy-induced peripheral neuropathy;
  • SCNA;
  • genotyping

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

BACKGROUND

The current prospective, multicenter study sought to identify single nucleotide polymorphisms of voltage-gated sodium channels (SCNAs) genes that might confer susceptibility to an increased incidence and severity of oxaliplatin-induced peripheral neuropathy (OXAIPN) in patients treated with either leucovorin, 5-fluorouracil, and oxaliplatin (FOLFOX) or oxaliplatin plus capecitabine (XELOX) for colorectal cancer (CRC).

METHODS

A total of 200 patients with CRC were genotyped with real-time polymerase chain reaction using locked nucleic acid hydrolysis probes or allele-specific primers. All patients had received oxaliplatin-based chemotherapy, either in the adjuvant or metastatic setting. The incidence and severity of cumulative OXAIPN was graded using the clinical version of the Total Neuropathy Score and the neurosensory National Cancer Institute Common Toxicity Criteria (version 3.0). The incidence of acute OXAIPN was assessed using a descriptive questionnaire (yes/no response format) at each clinical evaluation. Acute OXAIPN was present in 169 of 200 patients (84.5%), whereas after treatment discontinuation, the cumulative/chronic form of neurotoxicity occurred in 145 of 200 patients (72.5%).

RESULTS

In the logistic regression analysis adjusted for confounding factors, the overdominant model (CT vs CC + TT) of 2 single nucleotide polymorphisms (ie, SCN4A-rs2302237 and SCN10A-rs1263292) emerged as being significantly associated with an increased incidence of acute OXAIPN (rs2302237: odds ratio of 2.62 [95% confidence interval (95% CI), 1.15-6.00]; P = .019; and rs12632942: OR of 0.39 [95% CI, 0.17-0.88]; P = .023). However, only SCN4A-rs2302237 emerged as also being predictive of the clinical severity of acute OXAIPN (OR, 2.50 [95% CI, 1.35-4.63]; P = .0029) and the occurrence of cumulative/chronic OXAIPN (OR, 2.47 [95% CI, 1.04-5.85]; P = .037).

CONCLUSIONS

The results of the current study provide evidence to support a causal relationship between SCNA polymorphisms and OXAIPN. However, further studies from independent groups are warranted to confirm these results. Cancer 2013;119:3570–3577.. © 2013 American Cancer Society.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Oxaliplatin (OXA)-based combination regimens, either in the form of leucovorin, 5-fluorouracil, and oxaliplatin (FOLFOX) or oxaliplatin plus capecitabine (XELOX), have demonstrated prolonged disease progression-free and overall survival in patients with colorectal cancer (CRC) in both the adjuvant and advanced or metastatic setting.[1, 2] Peripheral neuropathy (PN) is currently recognized to be among the major and dose-limiting nonhematological adverse events of OXA treatment.[3]

OXA-induced peripheral neuropathy (OXAIPN) presents as 2 clinically distinct syndromes. The acute, neuromyotonia-like, transient syndrome occurs in the majority of patients with cold-related paresthesias, pharyngolaryngeal dysesthesias, jaw spasms, and cramps. Conversely, the dose-dependent, chronic form occurs at a threshold dose of 600 to 700 mg/m2 and is a pure sensory, axonal neuropathy with a stocking-and-glove distribution that affects between 50% and 70% of patients.[4]

Although clinical predictors for both acute and chronic OXAIPN have been suggested, to the best of our knowledge no reliable genetic or molecular biomarkers have been identified to date with which to detect those patients at high risk of developing OXAIPN.[5-7] The voltage-gated sodium channels (SCNAs) are fundamental to facilitate the initiation and propagation of action potentials in neurons and other electrically excitable cells. These membrane proteins are encoded by > 10 genes in mammals, whereas mutations in SCNAs are associated with diseases of both the central and peripheral nervous system (PNS).[8]

Briefly, mutations in the SCN1A and SCN2A genes have been associated with several seizure and migraine disorders. SCN3A is found in a cluster of 5 α subunit genes on chromosome 2. The SCN4A gene is expressed in skeletal muscle, and its mutations have been linked to several myotonias and periodic paralysis disorders. The integral membrane protein encoding the SCN5A gene is found primarily in cardiac muscle and defects in this gene cause autosomal-dominant cardiac disease. Mutations in the SCN8A gene are associated with mental retardation, pancerebellar atrophy, and ataxia; mutations in the SCN9A gene play a significant role in nociception signaling and have been associated with channelopathy-associated insensitivity to pain and paroxysmal extreme pain disorder, whereas the protein encoded by the SCN10A gene is a tetrodotoxin-resistant SCNA α subunit that may be involved in painful PN. Finally, SCN11A mediates voltage-dependent gating and conductance.[9-11]

Previous pharmacogenetic studies focused on OXA presented results that were controversial and inconclusive.[5] Lack of a prestudy hypothesis based on the known role of the investigated targets in the PNS and the inappropriate outcome measure for neurological impairment are major drawbacks. Moreover, the majority of these studies were retrospective and based on a post hoc analysis of oncology-based databases of different, not preplanned, size.[5] The current study was designed to investigate in an adequately powered, prospective cohort of well-characterized patients a series of single nucleotide polymorphisms (SNPs) in genes coding for neurologically relevant targets.

Considering that differences in nerve excitability measures bolster the critical involvement of SCNAs in the pathogenesis of acute OXAIPN,[12] the objective of the current hypothesis-driven study was to prospectively investigate whether SNPs of SCNA genes, which can account for the clinical features of acute but also of cumulative/chronic OXAIPN (ie, SCN4A, SCN9A, and SCN10A) might confer liability to the increased incidence and severity of OXAIPN in a large and homogenous cohort of patients with CRC treated with either FOLFOX or XELOX.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Study Design

A prospective, multicenter study (4 sites in 3 European countries) was launched after approval of the study protocol by the Institutional Review Boards at each site. Patients provided written informed consent before study entry.

Patient Selection

A total of 200 adult, chemotherapy-naive patients with a histologically confirmed diagnosis of CRC were recruited during an 18-month period. Only patients scheduled to receive adjuvant or first-line OXA-based chemotherapy with either FOLFOX or XELOX were included. As such, 200 blood samples, obtained at baseline before the initiation of chemotherapy from an equal number of patients, were genotyped.

Patients were free from a history of PN, systemic or collagen diseases, or any other condition that would interfere with or complicate clinical assessments. Patients were enrolled only if their life expectancy was > 9 months, if they had a Karnofsky performance score ≥ 70, and if they were able to fully understand the study information provided by investigators.

A total of 254 patients were screened initially and a total of 200 subjects were eventually included in the study. During screening, 54 patients were excluded for preexisting neuropathy (23 patients), change in the treatment plan (12 patients), conditions that would have complicated accurate assessment (11 patients), patient refusal (6 patients), and other reasons (2 patients).

Patients who were included in the study were clinically evaluated at baseline (visit 1) at the time of the screening visit and/or at a maximum of up to 2 days after the first chemotherapy course to capture the incidence of acute OXAIPN.

Outcome Measures

Patients were asked about acute and cumulative symptoms of OXAIPN during the same encounter and by the same researcher. The incidence and severity of cumulative/chronic OXAIPN was graded using the clinical version of the Total Neuropathy Score (TNSc) and the neurosensory National Cancer Institute Common Toxicity Criteria (version 3.0), as previously described.[13] The TNSc is a 7-item composite neuropathy scale validated for chemotherapy-induced PN that includes aspects of symptoms, signs, and ability. It scores each item on a scale from 0 (no deficit) to 4 (absence of function/severe deficit), for a total range score from 0 to 28.[14] According to the TNSc, the severity of cumulative OXAIPN was classified for the purposes of the current study as grade 1 (scores of 1-7), grade 2 (scores of 8-14), grade 3 (scores of 15-21), and grade 4 (scores > 21).

The incidence and severity of acute OXAIPN was summarized by means of a descriptive questionnaire (yes/no response format), assessing the presence of the 11 most common hyperexcitability symptoms, as previously described.[15] The severity of acute neurotoxicity was ranged as grade 1 (1-2 symptoms), grade 2 (3-4 symptoms), grade 3 (5-8 symptoms), and grade 4 (9-11 symptoms).

All the aforementioned clinical evaluations performed at baseline were repeated after 6 (OXA planned dose, 510 mg/m2) and 12 (OXA planned dose, 1020 mg/m2) courses of chemotherapy for FOLFOX regimens and after 4 (OXA planned dose, 520 mg/m2) and 8 (OXA planned dose, 1040 mg/m2) courses of XELOX. The collection of whole-blood samples was performed once, at baseline, strictly prior to the first course of OXA-based chemotherapy.

Chemotherapy Regimen and Dose Modification

Patients were treated with the formal FOLFOX4, FOLFOX6, or XELOX regimens.[16, 17] No prophylactic or symptomatic treatment was administered for neurotoxicity during chemotherapy. Dose adjustments or treatment delays were calculated as previously described both for general toxicities and neurotoxicity.[13, 15]

Genotyping

The sequences for the design of the genotyping assays were obtained from the SNP database (SCN10A-rs12632942, SCN10A-rs6800541, SCN9A-rs6746030, and SCN4A-rs2302237) of the National Center for Biotechnology Information. Both SCN10A SNPs (ie, rs12632942 [changes residue at position 1092 from leucine to proline] and rs6800541 [an intronic SNP C/T]) were chosen because they may be associated with the partial response interval as shown in previous studies, suggesting an important role regarding the final protein product.[18] With regard to SCN4A, the intronic SNP rs2302237 was chosen after searching the SNP database at the National Center for Biotechnology Information for SNPs with a known frequency in the European population and a minor allele frequency > 0.1. Finally, SCN9A-rs6746030 was chosen due to its association with an altered pain threshold.[19]

DNA was extracted from whole-blood samples using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, Calif). Samples were genotyped by real-time polymerase chain reaction (PCR) in an MX3000p PCR cycler (Stratagene, La Jolla, Calif) using locked nucleic acid hydrolysis probes for rs6746030 and allele-specific primers for rs2302237, rs6800541, and rs12632942 (Table 1), as previously described.[8] Primers were synthesized by Metabion International AG (Martinsried, Germany) and probes were synthesized by Integrated DNA Technologies (Leuven, Belgium). Reactions were performed in duplicate using either the Kapa Probe Fast qPCR Kit Master Mix (2X) Universal or the Kapa Sybr Fast Universal 2X qPCR Master Mix (Kapa Biosystems Inc, Woburn, Mass). The primers and probes in the concentrations are shown in Table 1. Interpretation of results was further verified for accuracy using DNA sequencing on randomly selected samples at an independent center belonging to the University of Thessaly (Larissa, Greece).

Table 1. Description of Primers and Probes for Genotyping Assays
Protein/SNPOligonucleotideSequence (5′-3′)a, bConcentration in PCR, μM
  1. Abbreviations: 6-FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1; HEX, hexachlorofluorescein; PCR, polymerase chain reaction; SCN, voltage-gated sodium channel; SNP, single nucleotide polymorphism.

  2. a

    A “+” symbol before a base denotes a locked nucleic acid base.

  3. b

    Italics denote the GC tails.

SCN4A
rs2302237Forward TTGGTACCCCCAATTTCTTGGA1.0
Forward CGCGGGCAGGGCGGCGGGGGCGGGTACCCCCAATTTCTTGGG0.3
ReverseAGGACAGAAATCAGGGCTCCTCC0.3
SCN9A
rs6746030ForwardGTTCAACAATCTTGTAGCAGGT0.3
ReverseGTTGAGGGAGTATCACAGAAAG0.3
Probe G6-FAM CC+TCC+G+T+AC+ACAA BHQ10.1
Probe AHEX AACCTC+C+A+TACACAACC BHQ10.1
SCN10A
rs6800541Forward CGCGGGCAGGGCGGCGGGGGCGGGCTTGCATTAGGCTATGATTC1.1
Forward TGCGGGCGGCTTGCATTAGGCTATGAAAT0.2
ReverseTCTAAAACTGAGTAACTGACCCCAATAAAGG0.3
rs12632942Forward GGCGGGCAGGGCGGCGGGGGCGCTCAGGATTTCCTCAGGATGTG1.1
Forward ACTCAGGATTTCCTCAGGATCAA0.2
ReverseGTGGACGACACAAGCTCCTCTG0.3

Genotyping was performed by a single investigator to ensure reproducibility and results were analyzed independently by the same investigator and by a senior investigator, with full accordance for all samples. Both investigators were blinded to patients' clinical status with regard to peripheral nerve function (neurotoxicity vs no neurotoxicity) until the finalization of genotyping analysis. The entire procedure in relation to primer design and genotyping was performed in the Laboratory of Molecular Oncology at the University of Patras Medical School.

Statistical Analysis

The Hardy-Weinberg equilibrium for each SNP was verified using the Fisher exact test as implemented in the Finetti program (ihg.gsf.de/cgi-bin/hw/hwa1.pl). Binary logistic regression analysis with adjustments for confounding covariates was performed to evaluate the association between genetic variants and the risk of acute or cumulative OXAIPN, respectively. For the selected polymorphisms, we considered either a dominant, overdominant, or recessive model of inheritance. Potential covariates to be included in the adjusted models were sex, age, type of chemotherapy schedule, single OXA dose (in mg), cumulative OXA dose (in mg), and site. Stepwise backward elimination with a P value < .15 as the threshold was used to develop a final model to control for potential confounders. The McFadden rho2 value for each logistic regression model was used to assess the goodness of fit. Odds ratios (ORs) and their 95% confidence intervals (95% CIs) were used as estimates of relative risk. A P value < .05 was considered to be statistically significant. All clinical and genotype data were managed with the SYSTAT statistical software package for Windows (version 12; Systat Software Inc, Chicago, Ill). Given the sample size of controls (93 patients with grade 0-1 acute OXAIPN) and cases (107 patents with grade 2-3 acute OXAIPN) and assuming a power of 80% and a level of significance of 0.05, the minimal detectable OR for the investigated SNPs (Minor allele frequency (MAF): 0.18-0.41) was 2.3 and 2.6, respectively, under the dominant and recessive models of inheritance. Power calculations were performed using Quanto software (hydra.usc.edu/gxe/).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

There were no significant differences with regard to age or sex noted between patients with OXAIPN and those without neurotoxicity. The overall demographic and clinical characteristics of the sample size are presented in Table 2.

Table 2. Baseline Clinical Characteristics of the Patients
VariableStudy Sample (n = 200) No. (%)
  1. Abbreviations: FOLFOX, leucovorin, 5-fluorouracil, and oxaliplatin; OXA, oxaliplatin, SD, standard deviation; XELOX, capecitabine plus oxaliplatin.

Sex 
Female80 (40)
Male120 (60)
Age ± SD (range) y63.7 ± 8.9 (38–84)
Height ± SD (range), cm164.8 ± 8.4 (137–183)
Type of chemotherapy 
FOLFOX4102 (51.0)
FOLFOX611 (5.5)
XELOX87 (43.5)
Disease setting 
Adjuvant122 (61.0)
Metastatic78 (39.0)
Median no. of single doses of OXA per course of FOLFOX (range), mg149 (80–190)
Median no. of single doses of OXA per course of XELOX (range), mg221 (138–260)
Median no. of cumulative doses of OXA after 12 courses of FOLFOX (range), mg1651 (900–2280)
Median cumulative doses of OXA after 8 courses of XELOX (range), mg1635 (848–2100)

Incidence and Severity and Genotyping in Relation to Acute OXAIPN

After the discontinuation of treatment, acute OXAIPN was diagnosed in 169 of 200 patients (84.5%). The severity of the acute OXAIPN was graded at the time of final follow-up as grade 1 in 62 patients (36.7%),grade 2 in 46 patients (27.2%), and grade 3 in 61 patients (36.1%). The univariate logistic regression analysis revealed that none of the clinical variables, including age, sex, chemotherapy regimen, and OXA single and cumulative dose, was significantly associated with acute OXAIPN.

With regard to genotyping, all SNPs conformed to expectations based on Hardy-Weinberg analysis (P > .05) when stratified for the center of enrollment. Table 3 presents the overall distribution of SNPs according to the grade of acute OXAIPN.

Table 3. Association Between SNPs and Acute OXAIPN Under the Overdominant Model of Inheritance (eg, CT vs CC+TT)
     Incidence (Grade 0 vs Grade 1–3)Clinically Relevant (Grade 0–1 vs Grade 2–3)
SNPNo. of Grade 0No. of Grade 1No. of Grade 2No. of Grade 3Crude OR (95% CI; P)Adjusted ORa (95% CI; P)Crude OR (95% CI; P)Adjusted ORb (95% CI; P)
  1. 95% CI, 95% confidence interval; OR, odds ratio; OXAIPN, oxaliplatin-induced peripheral neuropathy; SCN, voltage-gated sodium channel; SNP, single nucleotide polymorphism.

  2. a

    Individually adjusted by center of enrollment and patient age.

  3. b

    Individually adjusted by center of enrollment, chemotherapy type, and single dose.

SCN4A-rs2302237
CC152613202.392.622.042.50
CT11303036(1.08–5.30; .028)(1.15–6.00; .019)(1.16–3.59; .013)(1.35–4.63; .0029)
TT5635    
SCN10A-rs12632942
AA143931360.450.390.840.84
AG16191422(0.21–0.98; .045)(0.17–0.88; .023)(0.47–1.50; .56)(0.45–1.57; .59)
GG1413    
SCN10A-rs6800541
TT132010221.421.421.161.04
TC14332632(0.66–3.06; .37)(0.65–3.13; .38)(0.66–2.02; .60)(0.58–1.88; .90)
CC49107    
SCN9A-rs67406030
GG214624481.171.051.141.02
GA7151711(0.47–2.91; .73)(0.41–2.66; .92)(0.60–2.18; .68)(0.51–2.05; .95)
AA3152    

The overdominant model (CT vs CC + TT) of 2 SNPs (ie, SCN4A-rs2302237 and SCN10A-rs1263292) emerged from the univariate logistic regression analysis as being significantly associated with an increased incidence of acute OXAIPN (rs2302237: OR, 2.39 [95% CI, 1.08-5.3]; P = .028; and rs1263292: OR, 0.45 [95% CI, 0.21-0.98]; P = .045). Both SNPs retained their predictive role for the incidence of acute OXAIPN after correction for confounding factors (rs2302237: OR, 2.62 [95% CI, 1.15-6.00]; P = .019 and rs12632942: OR: 0.39 [95%CI, 0.17-0.88]; P = .023).

We then tested whether the selected SNPs were correlated with the clinical significance of acute OXAIPN. When patients were stratified for this item (grade 0-1 vs grade 2-3), only the rs2302237 SNP under the overdominant model (Table 3) retained its statistical significance both on the univariate (OR, 2.04 [95% CI, 1.16-3.59]; P = .013) and the adjusted analysis (OR, 2.50 [95% CI, 1.35-4.63]; P = .0029).

Incidence, Severity, and Genotyping in Relation to Cumulative OXAIPN

The cumulative/chronic form of neurotoxicity occurred in 145 of 200 patients (72.5%). According to the TNSc, the severity of cumulative OXAIPN at the final follow-up was grade 1 in 50 of 145 patients (34.5%), grade 2 in 59 patients (40.6%), and grade 3 in 36 patients (24.8%).

All SNPs were found to be in Hardy-Weinberg equilibrium when stratified for center of enrollment. The distribution of SNPs in the entire set of patients and after stratification according to cumulative OXAIPN is presented in Table 4. Similar to acute OXAIPN, only the CT genotype of SCN4A-rs2302237 was found to be significantly associated (OR, 2.23 [95% CI, 1.18-4.18]; P = .012) with an increased incidence of cumulative OXAIPN. The adjusted analysis revealed that the overdominant model (CT vs CC + TT) of SCN4A-rs2302237 was independently associated with an increased incidence of cumulative/chronic OXAIPN (OR, 2.47 [95% CI, 1.04-5.85]; P = .037), retaining as such its predictive role.

Table 4. Association Between SNPs and Chronic OXAIPN Under the Overdominant Model of Inheritance (eg, CT vs CC+TT)
     Incidence (Grade 0 vs Grade 1–3)Clinically Relevant (Grade 0–1 vs Grade 2–3)
SNPNo. of Grade 0No. of Grade 1No. of Grade 2No. of Grade 3Crude OR (95% CI; P)Adjusted ORa (95% CI; P)Crude OR (95% CI; P)Adjusted ORa (95% CI; P)
  1. 95% CI, 95% confidence interval; OR, odds ratio; OXAIPN, oxaliplatin-induced peripheral neuropathy; SCN, voltage-gated sodium channel; SNP, single nucleotide polymorphism.

  2. a

    Individually adjusted by center of enrollment, cumulative dose, and acute OXAIPN toxicity.

SCN4A-rs2302237
CC261721102.232.471.521.03
CT21303422(1.18–4.18; .012)(1.04–5.85; .037)(0.87–2.66; .14)(0.51–2.10; .93)
TT8344    
SCN10A-rs12632942
AA313531230.801.281.331.68
AG22122611(0.42–1.51; .49)(0.51–3.20; .60)(0.75–2.38; .33)(0.79–3.59; .18)
GG2322    
SCN10A-rs6800541
TT18162471.271.261.010.85
TC26292624(0.68–2.36; .45)(0.54–2.93; .59)(0.58–1.76; .97)(0.42–1.71; .65)
CC11595    
SCN9A-rs67406030
GG393637271.001.271.271.31
GA1311188(0.49–2.04; 1.00)(0.47–3.44; .63)(0.67–2.41; .46)(0.59–2.94; .50)
AA3341    

As can be seen in Table 4, no significant associations emerged between any of the analyzed SNPs and the severity of cumulative OXAIPN when patients were divided according to the TNSc into clinically significant (grade 0-grade 1 vs grade 2-grade 3) neurotoxicity grades.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Despite the progress in research, the mechanism of OXAIPN remains elusive. Existing knowledge had demonstrated that the acute neuromyotonia-like syndrome after OXA infusion could be considered as a channelopathy because of the interaction between OXA-induced oxalate and ion channels located in the cellular membrane. OXA appears for the most part to impair the calcium-dependent lymph node axonal SCNAs rather than potassium channels, thereby resulting in hyperexcited motor sensory nerves and muscles because of the reduction in the overall sodium current.[6, 20] To our knowledge to date, there is no evidence that the other cytotoxic drugs contained in the FOLFOX or XELOX regimens (5-fluorouracil or capecitabine) may affect the ion channels.

The pathogenic hallmark of cumulative OXAIPN is the decreased cellular metabolism and axoplasmic transport resulting from the accumulation of OXA in dorsal root ganglia (DRG) cells, together with mitochondrial dysfunction and oxidative stress, thus producing DRG neuron apoptosis.[6]

There is a lack of a reliable and sensitive molecular or genetic predictive surrogate marker to demonstrate a causal relationship with the development of OXAIPN.[5, 21] The objective of the current study was to provide mechanistic insight into the significant clinical problem of OXAIPN, and to possibly elucidate new therapeutic targets for improved treatments.

The main finding of the current study was that the overdominant model (CT vs CC + TT) of the skeletal muscle SCN4A-rs2302237 and the tetrodotoxin-resistant SCN10A-rs1263292 polymorphisms have emerged as being significantly associated with an increased incidence of acute OXAIPN. The overdominant model of SCN4A-rs2302237 was also able to predict the severity of acute OXAIPN. A weaker association was found between the overdominant model of SCN4A-rs2302237 and the development of cumulative OXAIPN.

The skeletal muscle channelopathies are caused by sodium channel, chloride channel, or calcium channel defects. It has been previously demonstrated that mutations in the SCN4A gene confer liability to various combinations of both typical and atypical hyperexcitability syndromes of skeletal muscles, including cold-induced myotonia, periodic paralysis, and paramyotonia congenita.[22] The finding that another tetrodotoxin-resistant SCNA SNP (ie, SCN10A-rs1263292), which is known to be linked with neuropathic pain, was associated with the incidence of acute OXAIPN points to a complex phenomenon and reinforces the findings of the current study. These results, together with recent findings suggesting that SCN8A plays a central role in mediating acute cooling-exacerbated symptoms following OXA, put sodium channels center stage in the pathogenesis of OXAIPN.[23]

The latter genetic susceptibility supports the results of the current study because acute OXAIPN is considered to be a cold-related channelopathy, mostly related to sodium channel dysfunction. In addition, it clinically resembles a neuromyotonia-like syndrome evoking clinical symptoms such as cold-induced paresthesias, jaw spasm, fasciculations, and muscle cramps due to its effect on both neurons and muscle cells.

Nonetheless, the findings of the current study may seem at odds for 2 reasons. First, heterozygous (CT) patients have a higher possibility of developing OXAIPN, thereby suggesting that the risk follows an overdominant trait. This heterozygote advantage is not common and as such one could argue that the rare inheritance mode reported herein might be peculiar. However, there are instances present in the literature describing an overdominant behavior in other diseases or conditions, such as sickle cell anemia, cystic fibrosis, and resistance to hepatitis C virus infection.[24, 25] Based on the results of the current study, it appears that the heterozygote genotype of the skeletal muscle sodium channel (rs2302237) has a higher relative fitness than either the homozygote-dominant or homozygote-recessive genotype in the context of OXAIPN. Therefore, the current study data either suggest that there is a disadvantage to expressing both forms of sodium channel in a cell, possibly due to a different activation mode, or that the 2 homozygous traits are protective for different reasons, similar to the case for sickle cell anemia.

Second, we found that the CT allele of 2 SCNA SNPs might be able to identify patients at high risk of developing first the acute and eventually the cumulative/chronic form of OXAIPN. Taking into account the different putative mechanisms conferring acute and cumulative/chronic OXA-induced neurotoxicity, this finding might appear to be strange. However, there is evidence at least in the clinical setting that acute OXAIPN may predispose patients to the cumulative/chronic neurotoxicity.[15, 26, 27]

From the theoretical pathogenic point of view, the interrelation between acute and cumulative OXAIPN might be because of the cellular stress affecting the sensory nerve cells as a result of the prolonged activation of SCNAs superimposed with the decreased cellular metabolism and axoplasmic transport in the DRG cells.[6] The latter pathogenetic hypothesis is supported by preclinical results that are in keeping with alterations in sodium channel inactivation kinetics of the sural nerve after OXA application and prolonged opening of sodium channels resulting in an increase in sodium currents.[28] This pathogenic hypothesis, although speculative, could also partly explain the lack of correlation with the severity of cumulative OXAIPN because other mechanisms, such as platinum detoxification and DNA repair enzymes, could modulate the severity of the cumulative neurotoxicity, and the cellular stress induced by the hyperexcitability might only be a trigger of this process.

We acknowledge that the causal relationship between acute and chronic OXAIPN is still unproven, although the results of the current study suggest that this relationship might occur. In any case, the possibility that acute and cumulative neurotoxicity share, at least in part, the same genetic susceptibility requires further investigation.

The lack of a validation population represents a limitation of the current study. This limitation aside, the current study has several advantages. It was a multicenter, international study that tested the genetic susceptibility of selected SCNAs in a homogenous cohort of patients with CRC. Our series is larger than most of existing relevant publications. Contrary to previous studies focusing on the pharmacogenetics of OXAIPN, which applied an oncology-oriented approach on the basis of mechanistic hypotheses relevant mainly to cancer cells and not to cells of the PNS,[5, 29, 30] the current study was hypothesis-driven based on a neurologically rational assumption, at least as far as the acute form of OXAIPN is concerned. In addition, it focused exclusively on OXAIPN by applying prospective and detailed neurological examinations with validated grading tools such as TNSc, in addition to the National Cancer Institute Common Toxicity Criteria.[14]

Finally, we tried to ensure the best-quality results by applying duplicate analysis of samples by real-time PCR and sending randomly selected samples for retesting and validation of results using DNA sequencing at an independent institution. To the best of our knowledge, the external control of pharmacogenetic results has hardly ever been performed.

The results of the current study demonstrated that the overdominant model of the skeletal muscle sodium channel SCN4A-rs2302237 and the tetrodotoxin-resistant SCN10A-rs1263292 polymorphisms appear to be related to the development of acute OXAIPN. The association between the overdominant model of SCN4A-rs2302237 and the development of cumulative OXAIPN, which we also found, requires further data to be fully accredited. The rs2302237 polymorphism was also able to detect patients at high risk of developing clinically significant acute OXAIPN. The results of the current study provide evidence to support a causal relationship between SCNA SNPs and OXAIPN. Further studies from independent groups are warranted to test these results and, if confirmed, to be the basis for further research toward the elucidation of new therapeutic targets for improved treatment against OXAIPN.

CONFLICT OF INTEREST DISCLOSURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Drs. Bruna, Velasco, and Santos have been supported by grant PI070493 from ISCIII, Spanish Health Ministry.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SUPPORT
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES
  • 1
    Kalofonos HP, Aravantinos G, Kosmidis P, et al. Irinotecan or oxaliplatin combined with leucovorin and 5-fluorouracil as first-line treatment in advanced colorectal cancer: a multicenter, randomized, phase II study. Ann Oncol. 2005;16:869877.
  • 2
    Schmoll HJ, Van Cutsem E, Stein A, et al. ESMO Consensus Guidelines for management of patients with colon and rectal cancer. A personalized approach to clinical decision making. Ann Oncol. 2012;23:24792516.
  • 3
    Argyriou AA, Polychronopoulos P, Iconomou G, Chroni E, Kalofonos HP. A review on oxaliplatin-induced peripheral nerve damage. Cancer Treat Rev. 2008;34:368377.
  • 4
    Argyriou AA, Zolota V, Kyriakopoulou O, Kalofonos HP. Toxic peripheral neuropathy associated with commonly used chemotherapeutic agents. J BUON. 2010;15:435446.
  • 5
    Cavaletti G, Alberti P, Marmiroli P. Chemotherapy-induced peripheral neurotoxicity in the era of pharmacogenomics. Lancet Oncol. 2011;12:11511161.
  • 6
    Argyriou AA, Bruna J, Marmiroli P, Cavaletti G. Chemotherapy-induced peripheral neurotoxicity (CIPN): an update. Crit Rev Oncol Hematol. 2012;82:5177.
  • 7
    Antonacopoulou AG, Argyriou AA, Scopa CD, et al. Integrin beta-3 L33P: a new insight into the pathogenesis of chronic oxaliplatin-induced peripheral neuropathy? Eur J Neurol. 2010;17:963968.
  • 8
    Catterall WA. From ionic currents to molecular mechanisms: the structure and function of voltage-gated sodium channels. Neuron. 2000;26:1325.
  • 9
    Akopian AN, Souslova V, England S, et al. The tetrodotoxin-resistant sodium channel SNS has a specialized function in pain pathways. Nat Neurosci. 1999;2:541548.
  • 10
    Yu FH, Catterall WA. Overview of the voltage-gated sodium channel family. Genome Biol. 2003;4:207.
  • 11
    Catterall WA, Goldin AL, Waxman SG; International Union of Pharmacology. International Union of Pharmacology. XXXIX. Compendium of voltage-gated ion channels: sodium channels. Pharmacol Rev. 2003;55:575578.
  • 12
    Krishnan AV, Goldstein D, Friedlander M, Kiernan MC. Oxaliplatin-induced neurotoxicity and the development of neuropathy. Muscle Nerve. 2005;32:5160.
  • 13
    Argyriou AA, Velasco R, Briani C, et al. Peripheral neurotoxicity of oxaliplatin in combination with 5-fluorouracil (FOLFOX) or capecitabine (XELOX): a prospective evaluation of 150 colorectal cancer patients. Ann Oncol. 2012;23:31163122.
  • 14
    Cavaletti G, Cornblath DR, Merkies IS, et al; the CI-PeriNomS Group. The chemotherapy-induced peripheral neuropathy outcome measures standardization study: from consensus to the first validity and reliability findings. Ann Oncol. 2013;24:454462.
  • 15
    Argyriou AA, Cavaletti G, Briani C, et al. Clinical pattern and associations of oxaliplatin acute neurotoxicity: a prospective study in 170 patients with colorectal cancer. Cancer. 2013;119:438444.
  • 16
    de Gramont A, Figer A, Seymour M, et al. Leucovorin and fluorouracil with or without oxaliplatin as first-line treatment in advanced colorectal cancer. J Clin Oncol. 2000;18:29382947.
  • 17
    Cassidy J, Tabernero J, Twelves C, et al. XELOX (capecitabine plus oxaliplatin): active first-line therapy for patients with metastatic colorectal cancer. J Clin Oncol. 2004;22:20842091.
  • 18
    Pfeufer A, van Noord C, Marciante KD, et al. Genome-wide association study of PR interval. Nat Genet. 2010;42:153159.
  • 19
    Reimann F, Cox JJ, Belfer I, et al. Pain perception is altered by a nucleotide polymorphism in SCN9A. Proc Natl Acad Sci U S A. 2010;107:51485153.
  • 20
    Grolleau F, Gamelin L, Boisdron-Celle M, Lapied B, Pelhate M, Gamelin E. A possible explanation for a neurotoxic effect of the anticancer agent oxaliplatin on neuronal voltage-gated sodium channels. J Neurophysiol. 2001;85:22932297.
  • 21
    Grisold W, Cavaletti G, Windebank AJ. Peripheral neuropathies from chemotherapeutics and targeted agents: diagnosis, treatment, and prevention. Neuro Oncol. 2012;14(suppl 4):iv45iv54.
  • 22
    Burge JA, Hanna MG. Novel insights into the pathomechanisms of skeletal muscle channelopathies. Curr Neurol Neurosci Rep. 2012;12:6269.
  • 23
    Sittl R, Lampert A, Huth T, et al. Anticancer drug oxaliplatin induces acute cooling-aggravated neuropathy via sodium channel subtype Na(V)1.6-resurgent and persistent current. Proc Natl Acad Sci U S A. 2012;109:67046709.
  • 24
    Hogenauer C, Santa Ana CA, Porter JL, et al. Active intestinal chloride secretion in human carriers of cystic fibrosis mutations: an evaluation of the hypothesis that heterozygotes have subnormal active intestinal chloride secretion. Am J Hum Genet. 2000;67:14221427.
  • 25
    Pace BS, Ofori-Acquah SF, Peterson KR. Sickle cell disease: genetics, cellular and molecular mechanisms, and therapies. Anemia. 2012;2012:143594.
  • 26
    Park SB, Goldstein D, Lin CS, Krishnan AV, Friedlander ML, Kiernan MC. Acute abnormalities of sensory nerve function associated with oxaliplatin-induced neurotoxicity. J Clin Oncol. 2009;27:12431249.
  • 27
    Park SB, Lin CS, Krishnan AV, Goldstein D, Friedlander ML, Kiernan MC. Oxaliplatin-induced neurotoxicity: changes in axonal excitability precede development of neuropathy. Brain. 2009;132(pt 10):27122723.
  • 28
    Adelsberger H,Quasthoff S, Grosskreutz J, et al. Alteration of sodium channel inactivation kinetics on rat sural nerve by the chemotherapeutic agent oxaliplatin. Biol Chem. 1999;380S:123.
  • 29
    Won HH, Lee J, Park JO, et al. Polymorphic markers associated with severe oxaliplatin-induced, chronic peripheral neuropathy in colon cancer patients. Cancer. 2012;118:28282836.
  • 30
    Cecchin E, D'Andrea M, Lonardi S, et al. A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin(FOLFOX4) regimen [published online ahead of print August 7, 2012]. Pharmacogenomics J. doi:10.1038/tpj.2012.31.