SEARCH

SEARCH BY CITATION

Keywords:

  • thyroid cancer;
  • estrogen receptors;
  • peroxisome proliferator-activated receptor gamma;
  • apoptosis;
  • rosiglitazone

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

BACKGROUND

Estrogen receptor (ER) and peroxisome proliferator-activated receptor gamma (PPARγ) are associated with thyroid tumorigenesis and treatment. However, the interaction between them has not been studied.

METHODS

The impact of ER over-expression or down-expression by DNA/small interfering RNA (siRNA) transfection, ERα agonists, and the ERβ agonist diarylpropiolnitrile (DPN) on PPARγ expression/activity was examined in papillary thyroid carcinoma (PTC) and anaplastic thyroid carcinoma (ATC) cells. The effects of PPARγ modulation by rosiglitazone (RTZ), a PPARγ ligand, and of PPARγ siRNA on ER expression were determined. Cellular functions reflected by cell proliferation and migration were assayed. Apoptosis was analyzed by terminal deoxynucleotidyl transferase dUTP nick-end labeling, and apoptotic-related proteins were evaluated by Western blot analysis.

RESULTS

PPARγ protein and activity were reduced by the over-expression of either ERα or ERβ, whereas repression of ERα or ERβ increased PPARγ expression. The administration of RTZ counteracted the effects of ER and also reduced their expression, particularly in PTC cells. Moreover, knockdown of PPARγ increased ER expression and activity. Functionally, ERα activation offset the inhibitory effect of PPARγ on cellular functions, but ERβ activation aggregated it and induced apoptosis, particularly in PTC cells. Finally, the interaction between ERβ and PPARγ enhanced the expression of proapoptotic molecules, such as caspase-3 and apoptosis-inducing factor.

CONCLUSIONS

This study provides evidence supporting a cross-talk between ER and PPARγ. The reciprocal interaction between PPARγ and ERβ significantly inhibits the proliferation and migration of thyroid cancer cells, providing a new therapeutic strategy against thyroid cancer. Cancer 2014;120:142–153. © 2013 American Cancer Society.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Epidemiologic studies have indicate that an increase in estrogen levels or in estrogen-related molecules plays a role in the development of thyroid cancer.[1] Estrogen executes its function typically through its traditional receptors: estrogen receptor alpha (ERα) and ERβ.[2] When estrogen binds to its receptors, it forms an estrogen-ER complex, which binds to estrogen response element (ERE) sequences in the promoter region of estrogen-responsive genes. Previous studies have demonstrated that ERα stimulates the proliferation of papillary thyroid carcinoma (PTC) cells,[3] whereas apoptosis of thyroid cancer cells is positively associated with ERβ.[4] The subcellular localization of ERα and ERβ may contribute to the different pathogenesis of PTC cells and anaplastic thyroid carcinoma (ATC) cells.[5] Recently, low ERβ expression was correlated with poor survival in patients with thyroid carcinoma.[6]

Peroxisome proliferator-activated receptor γ (PPARγ, a nuclear hormone receptor, binds to peroxisome proliferator responsive element (PPRE) as a heterodimer with the retinoid X receptor (RXR).[7] The activation of PPARγ can lead to the apoptosis of thyroid cancer cells,[8, 9] and its activity appears to be down-regulated in thyroid cancer,[10, 11] supporting the concept that the promotion of PPARγ is a potential therapeutic mediation in thyroid cancer treatment.

Both PPARγ and ER belong to the hormone receptor superfamily. Recently, it has been reported that signal cross-talk exists bidirectionally between PPARγ and ER. Either ERα or ERβ is capable of inhibiting PPAR-mediated activation in breast cancer cells.[12] Therapeutically, PPARγ agonists and ligands have been proposed for the treatment of estrogen-responsive malignancies, such as breast cancer,[13] as well as thyroid cancer.[14-16] However, the ability of the ER to interact with the signal-transduction pathway of PPARγ in thyroid cancer cells remains unknown. Thus, the objective of this study was to examine the interaction between ER and PPARγ and to determine how the interaction affects the apoptosis of thyroid cancer cells.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Cell Culture and Reagents

Human PTC cells (K1 and BCPAP), ATC cells (FRO and KAT18) and immortalized normal thyroid cells (Nthy-ori 3-1, NTHY) were cultured in RPMI 1640 (Invitrogen, Carlsbad, Calif) as previously reported.[3] The ERα agonist propyl pyrazole triol (PPT) and the ERβ agonist diarylpropiolnitrile (DPN) were purchased from Tocris Bioscience (Ellisville, Mo), whereas the PPARγ agonist RTZ was kindly provided by GlaxoSmithKline (Brentford, United Kingdom). All the agonists were dissolved with dimethyl sulfoxide (DMSO) as recommended by the manufacturers.

Western Blot Analysis

Total protein and cytosolic and mitochondrial fractions were isolated and subjected to Western blot analysis, which was performed according to previous publications.[5, 6, 17] Antibodies against PPARγ, ERα, ERβ, BCL2-associated X protein (Bax), caspase-3, apoptosis-inducing factor (AIF), cytochrome c, actin, and prohibitin were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, Calif). The immunoreactive signals were developed on Amersham Hyperfilm ECL film (Amersham plc., Little Chalfont, United Kingdom), and the relative density index was calculated.

Quantitative Polymerase Chain Reaction

Total RNA was isolated from human thyroid cell lines using the RNeasy Mini Kit (Qiagen, Hilden, Germany). The levels of PPARγ (forward, 5′-GCTGTGATT ATTCTCAGTGGAGACC-3′; reverse, 5′-CAACTGG AAGAAGGGAAATGTTGG-3′), ERα (forward, 5′-AT ATGTGTCCAGCCACCAAC-3′; reverse, 5′-CCAACA AGGCACTGACCATC-3′), and ERβ (forward, 5′-GCA TGGAACATCTGCTCAAC-3′; reverse, 5′-ACGCTTC AGCTTGTGACCTC-3′) were measured using quantitative polymerase chain reaction, as previously described.[18] All reactions were done at least twice, and the products were analyzed using the ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, Calif). Actin was included in all reactions as an internal house-keeping control.

Modulation of Estrogen Receptor-α, Estrogen Receptor-β, and Peroxisome Proliferator-Activated Receptor-γ Levels

Over-expression of ERα and ERβ was evaluated using adenovirus-carried ERα (ADERα) or ERβ (ADERβ) DNAs. K1 and FRO cells were cultured in RPMI 1640 for 24 hours followed by infecting with adenovirus-lacZ vector (ADlacZ), or ADERα, or ADERβ for 24 hours. Small interfering RNA (siRNA) was used to suppress ER and PPARγ, respectively. siRNAs for ERα and ERβ were purchased from Santa Cruz Biotechnology, Inc. next, 25 nM of the designated siRNA or scramble control were used to treat cells for 4 hours. FlexiTube siRNA premix for PPARγ was provided by Qiagen, and cells were transfected with 25 nM of the designated siRNA or scramble control for 48 hours. After incubation, the efficacy of gene over-expression or silencing was evaluated by Western blot analysis as described above.

Transfection and Luciferase Reporter Assay

Cells at 90% confluence were transiently transfected with 1 μg purified PPRE-tk-Luc plasmid or 3 times ERE-TATA-Luc plasmid (Addgene, Cambridge, Mass) or with pGL3-basic or pGL3-control plasmid as a positive control for transfection efficiency and luciferase activity[19] in serum-free medium using Lipofectamine 2000 reagent (Invitrogen). After 48 hours, promoter activity was assessed using a luciferase reporter assay system (Promega, Madison, Wis) to measure the intensity of chemiluminescence in a luminometer (Thermo, Waltham, Mass). All experiments were performed in duplicate and were repeated at least 3 times.

3-(4,5-Dimethylthiazol-2-yl)−2,5-Diphenyltetrazolium Bromide Assay and Wound-Healing Assay

A 3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyltetrazolium bromide (MTT) assay was used to assess cell proliferation. After the infected cells were treated with 1 μM PPT, or 10 μM DPN, or 10 μM RTZ with or without ERα/ERβ over-expression, MTT was added, and the resulting signals were measured. All experiments were performed in triplicate and were repeated at least 3 times. A wound-healing assay was performed to determine cell migration, which was done by measuring the movement of cells into a scrape wound in a cellular area. The speed of wound closure was monitored after 12 hours. The wound healing was monitored under a light microscope, and images were taken consequently. The experiments were repeated twice.

Detection of Apoptosis

K1 and FRO cells were seeded onto 6-well plates and incubated overnight to allow cells to attach to the plate. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) was conducted using the APO-DIRECT TUNEL assay kit (BD Biosciences, San Jose, Calif). Apoptosis was measured according to the protocol provided by the kit, and the results were presented as the folds of control conditions. All experiments were performed in duplicate and were repeated twice.

Statistical Analysis

All results are represented as mean ± standard deviation. Statistical comparisons were performed using a 1-way analysis of variance followed by post-hoc Bonferroni tests using the SPSS statistical package (SPSS Inc., Chicago, Ill), and P < 0.05 was considered statistically significant.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

Expression of Estrogen Receptor-α, Estrogen Receptor-β, and Peroxisome Proliferator-Activated Receptor-γ

We determined the messenger RNA (mRNA) expression of 3 molecules using quantitative polymerase chain reaction and observed that ERβ and PPARγ were present in all thyroid cell lines tested. However, ERα was absent in the normal thyroid cell line NTHY (Fig. 1a). Western blot analysis revealed that ERα expression was not detected in normal thyroid cells but was present in cancer cells. ERβ and PPARγ proteins did not differ significantly among the 3 cell lines (P > .05) (Fig. 1b).

image

Figure 1. The expression of estrogen receptor alpha (ERα), estrogen receptor beta (ERβ), and peroxisome proliferator-activated receptor gamma (PPARγ) is illustrated. (a) Messenger RNA (mRNA) expression of ERα, ERβ, and PPARγ were detected at (a) the mRNA level and (b) the protein level by quantitative polymerase chain reaction and Western blot analyses, respectively. Breast cancer cells (MCF7) and lung cancer cells (NCI-H23) were used as positive controls for ER and PPARγ, respectively. The densities of protein bands were determined, and the ratio of target to actin was calculated. This ratio in the control MCF7 or NCI-H23 cells was normalized to 1. NTHY indicates an immortalized normal thyroid cell line; K1, a human papillary thyroid carcinoma cell line; BCPAP, a human papillary thyroid carcinoma cell line; FRO, an anaplastic thyroid carcinoma cell line; KAT19, an anaplastic thyroid carcinoma cell line.

Download figure to PowerPoint

Effects of Propyl Pyrazole Triol, Diarylpropiolnitrile, and Rosiglitazone on Protein Expression and Cell Proliferation

Cells were infected with ADlacZ, or ADERα, or ADERβ followed by 12 to 72 hours of treatment with either DMSO control (ADlacZ) or 3 agonists (ADERs). ERα and ERβ displayed significant protein over-expression after 1 μM PPT or 10 μM DPN stimulation for 48 hours, and their levels were further elevated after ADERα and ADERβ infection, respectively (Fig. 2a,b). The expression of PPARγ protein also was increased after treatment with the PPARγ agonist RTZ (Fig. 2c). For cell proliferation, the MTT assay demonstrated a significant increase in cell counts in PPT-treated K1 cells and FRO cells, especially when the cells were infected with ADERα (Fig. 2a); whereas decreased cell proliferation was observed after cells were treated with either DPN or RTZ. The inhibitory effect of DPN was more obvious in K1 cells, whereas RTZ produced similar results in both K1 cells and FRO cells (Fig. 2b,c).

image

Figure 2. Cell proliferation is illustrated after treatment with estrogen receptor alpha (ERα), estrogen receptor beta (ERβ), and peroxisome proliferator-activated receptor gamma (PPARγ) agonists. Proliferation of the infected cells that were treated with (a) propyl pyrazole triol (PPT), (b) diarylpropiolnitrile (DPN), or (c) and rosiglitazone (RTZ) was measured by using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. A single asterisk indicates P < .05 for a comparison between dimethyl sulfoxide (DMSO)-treated cells versus cells that were treated with PPT, DPN, or RTZ. Total protein was isolated and subjected to Western blot analysis for (a) ERα, (b) ERβ, and (c) PPARγ. The density of positive bands was determined, and the ratio of target to actin was calculated. This ratio in the positive control MCF7 or NCI-H23 cells was normalized to 1. A single asterisk indicates P < .05 compared with dimethyl sulfoxide (DMSO)-treated cells; double asterisks, P < .01 compared with DMSO-treated cells. ADlacZ indicates adenovirus-lacZ vector; ADERα, adenovirus ERα; ADERβ, adenovirus ERβ.

Download figure to PowerPoint

Effects of Estrogen Receptor-α and Estrogen Receptor-β Over-Expression on Peroxisome Proliferator-Activated Receptor-γ Activity and Expression

We used the luciferase reporter assay to determine PPARγ activity after ERα and ERβ were up-regulated. Cells infected with either ADERα/ADERβ or ADERα/ADERβ in the presence of their agonists manifested a significant reduction in PPARγ promoter activity compared with a ADlacZ control in K1 cells (Fig. 3a). The reduction was markedly rescued by RTZ to a level much higher than that produced in the ADlacZ control. Although PPARγ promoter activity changed little in FRO cells infected with ADERα or ADERβ, RTZ treatment also was able to significantly increase the activity.

image

Figure 3. Peroxisome proliferator-activated receptor gamma (PPARγ) activity and expression are illustrated in cells with estrogen receptor alpha (ERα) and ERβ over-expression. (a) Cells were transiently transfected with a peroxisome proliferator responsive element (PPRE)-mediated luciferase reporter plasmid for 24 hours followed by infection with adenovirus ERα (ADERα)/ADERβ with or without costimulation with 1 μM propyl pyrazole triol (PPT)/10 μM diarylpropiolnitrile (DPN)/10 μM rosiglitazone (RTZ) or with PPT/DPN either alone or with the addition of RTZ. The luciferase activity of adenovirus-lacZ vector (ADlacZ)-infected cells was set to 1. The relative luciferase activity was defined as the fold change of each treatment over the ADlacZ control. A single asterisk indicates P < .05 compared with the ADlacZ control; double asterisks, P < .01 compared with the ADlacZ control. (b) Total protein was isolated from cells that received different treatments, as indicated. The expression of PPARγ was determined by Western blot analysis. Actin was used as an equal loading control. The density of protein bands was determined, and the ratio of target to actin was calculated. This ratio in cells with ADlacZ was normalized to 1. A single asterisk indicates P < .05 in a comparison between groups, as indicated. (c,d) Total protein was isolated and subjected to Western blot analysis of (c) ERα expression or (d) ERβ expression. The density of protein bands was determined. This ratio in cells with ERα or ERβ was normalized to 1. A single asterisk indicates P < .05 in a comparison between groups, as indicated.

Download figure to PowerPoint

The effect of ERα and ERβ on PPARγ protein was assessed by Western blot analysis. PPARγ expression was reduced significantly in K1 cells infected with ADERα or ADERα in the presence of PPT (Fig. 3b). RTZ alone significantly increased the expression of PPARγ in K1 cells, but the positive effect of RTZ disappeared when it was used in combination with other agents. PPARγ expression was reduced in FRO cells infected either with ADERα in the presence of PPT or with ADERβ in the presence of DPN or DPN plus RTZ. Although RTZ alone increased the expression of PPARγ, the increase was not significant.

RTZ treatment demonstrably inhibited the ERα protein in both cell lines infected with ADERα (Fig. 3c), and the decreased expression of ERα also was observed in ADERα-infected K1 cells treated with RTZ plus PPT. RTZ alone also was able to reduce the ERβ protein in K1 cells, but not in FRO cells, infected with ADERβ (Fig. 3d)

Effect of Estrogen Receptor Knockdown on Peroxisome Proliferator-Activated Receptor-γ Expression

After examining how ER over-expression affected PPARγ, we tested the effect of ER down-regulation on PPARγ. First, we confirmed that ERα siRNA and ERβ siRNA could down-regulate ERα (65% knockdown efficiency in K1 cells and 54% in FRO cells) and ERβ (52% knockdown efficiency in K1 cells and 63% in FRO cells), respectively, compared with their respective scramble siRNA controls (Fig. 4a,b). PPARγ protein expression was up-regulated in both cell lines treated with either ERα siRNA or ERβ siRNA (Fig. 4c).

image

Figure 4. Peroxisome proliferator-activated receptor gamma (PPARγ) expression after estrogen receptor (ER) knockdown is illustrated. After cells were treated with ERα small interfering RNA (siRNA) (siERα), or ERβ siRNA (siERβ), or scramble siRNA (control), total protein was isolated and subjected to Western blot analysis to measure the expression of (a) ERα, (b) ERβ, and (c) PPARγ. Actin was measured and used as an equal loading control. The density of positive protein bands was determined, and the ratio of target to actin was calculated. This ratio in cells that were treated with RNase-free water control was normalized to 1. An asterisk indicates P < .05 compared with the scramble siRNA control.

Download figure to PowerPoint

Effect of Peroxisome Proliferator-Activated Receptor-γ Knockdown on Estrogen Receptor Activity and Expression

To determine the reciprocal interaction of ER and PPARγ, we knocked down the PPARγ gene and then assessed ER activity and expression. With PPARγ siRNA (target sequence: GAGGGCGATCTTGACAGGAAA), there was a distinct reduction in PPARγ protein expression (Fig. 5a): 65% of PPARγ protein was down-regulated in K1 cells, and 72% of PPARγ protein was down-regulated in FRO cells. It is noteworthy that ER activity was markedly increased compared with controls (Fig. 5b), as evident from the approximately 3-fold increase in K1 cells and the approximately 2-fold increase in FRO cells. Western blot analysis further demonstrated the elevation of ERα and ERβ proteins after the knockdown of the PPARγ gene (Fig. 5c,d).

image

Figure 5. The effect of peroxisome proliferator-activated receptor gamma (PPARγ) knockdown on estrogen receptor (ER) activity and expression is illustrated. (a) PPARγ was transiently knocked down using PPARγ small interfering RNA (siRNA) (siPPARγ). Cells that were treated with scramble siRNA were used as the control. Forty-eight hours after siRNA treatment, total protein was isolated and subjected to Western blot analysis of PPARγ. Actin was measured and used as an equal loading control. The density of target protein bands was determined, and the ratio of target to actin was calculated. This ratio in cells that were treated with RNase-free water control was normalized to 1. A single asterisk indicates P < .05 compared with the scramble siRNA control. (b) Cells were transiently transfected with an estrogen response element (ERE)-mediated luciferase reporter plasmid for 24 hours followed by treatments with water/scramble controls or siPPARγ. The luciferase report activity was measured. A single asterisk indicates P < .05 compared with the scramble siRNA control. (c,d) The expression of PPARγ was knocked down by siPPARγ, as described for a above. Total protein was isolated and subjected to Western blot analysis of (c) ERα protein and (d) and ERβ protein. A single asterisk indicates P < .05 compared with the scramble siRNA control.

Download figure to PowerPoint

Impact of Estrogen Receptor Over-Expression on Rosiglitazone-Induced Changes in Cell Functions

The over-expression of ERα significantly increased cell proliferation, as discussed above; whereas either ERβ over-expression or PPARγ up-regulation induced a significant decrease in cell counts. Therefore, it would be interesting to determine how the over-expression of ERα and ERβ modulates the effect of RTZ on cell functions. We observed that the proliferation in cells with ERα over-expression was similar between the PPT and PPT + RTZ groups, but both groups had much higher proliferation compared with that in the cells with ERβ over-expression (Fig. 6a). Cell proliferation was drastically reduced in ERβ–over-expressed K1 cells treated with RTZ versus the cells without RTZ treatment, but the reduction was not obvious in FRO cells (Fig. 6a). A wound-healing assay was performed to determine the cell migration within 12 hours. Compared with the ADlacZ control, migration was faster in cells with ERα over-expression, whereas migration was slower in cells with ERβ over-expression (Fig. 6b). In the presence of PPT, RTZ treatment partially overcame the promotional effect of ERα on cell migration in both cell lines, although the change was statistically significant only in K1 cells. In contrast to ERα, RTZ treatment facilitated ERβ-mediated inhibition of migration in both cell lines, although the effect was significant only in K1 cells.

image

Figure 6. The effects of estrogen receptor alpha (ERα) and ERβ over-expression are illustrated on rosiglitazone (RTZ)-induced changes in cell functions. Cell functions were determined by assessing cell proliferation and migration. (a) Cells were infected with ERα or ERβ for 24 hours followed by treatment with propyl pyrazole triol (PPT)/diarylpropiolnitrile (DPN) either alone or combined with RTZ. Cells that were infected with adenovirus-lacZ vector (ADlacZ) and treated only with RTZ also were included (data not shown to simplify the linear illustration). After the treatment, a (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (MTT) assay was used to determine cell proliferation. A single asterisk indicates P < .05 for a comparison between ERβ-infected cells that were treated with RTZ and without RTZ; double pound signs, P < .01 for a comparison between cells that were treated with adenovirus ERα (ADERα) + PPT plus ADERβ + DPN/ADERβ + DPN + RTZ and ADERα + PPT + RTZ and cells that were treated with ADERβ + DPN/ADERβ + DPN + RTZ. (b) Cells were treated with various agents, as indicated. At the end of the treatment, a wound-healing assay was done by measuring the movement of cells into a scrape wound. The speed of wound closure was monitored using a light microscope by taking sequential images. The relative cell migration rate of ADlacZ-infected cells was set to 1. A single asterisk indicates P < .05 for a comparison between cells that were treated with RTZ and without RTZ; double pound signs, P < .01 for a comparison between cells that were treated with ADERα + PPT plus ADERβ + DPN/ADERβ + DPN + RTZ and ADERα + PPT + RTZ and cells that were treated with ADERβ + DPN/ADERβ + DPN + RTZ.

Download figure to PowerPoint

Induction of Apoptosis by Peroxisome Proliferator-Activated Receptor-γ Ligand and Estrogen Receptor-β but Not by Estrogen Receptor-α

Previous studies have indicated that ERβ agonists or PPARγ ligands induce apoptosis of thyroid cancer cells, whereas ERα agonists inhibit it.[2, 14-16] To our knowledge, the effect of PPARγ and ERα/ERβ in combination on thyroid cancer cells has not been previously reported. Here, we demonstrated that the application of ADERβ, DPN, or RTZ alone could significantly induce apoptosis in both cancer cell lines compared with an ADlacZ control (Fig. 7). Any set of 2 from these 3 agents could exert a stronger induction of apoptosis than any single agent alone. The strongest effect was obtained when the cells—particularly K1 cells—were cotreated with ADERβ, DPN, and RTZ, resulting in a 5.5-fold increase in apoptosis compared with the ADlacZ control (Fig. 7b). It is noteworthy that the induction of apoptosis by DPN, RTZ, or both agents combined was disabled in both lines among the cells that had ERα over-expression.

image

Figure 7. The effects of peroxisome proliferator-activated receptor gamma (PPARγ) ligand, estrogen receptor beta (ERβ), and estrogen receptor alpha (ERα) on apoptosis are illustrated. Cells were treated with various agents, as listed, for 48 hours. At the end of the treatment, apoptotic cells were measured using the APO-DIRECT terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay kit (BD Biosciences, San Jose, Calif). (a) Representative diagrams of the TUNEL assay of K1 cells are shown. Controls treated with ERα/ERβ/propyl pyrazole triol (PPT)/diarylpropiolnitrile (DPN) either alone or with the addition of rosiglitazone (RTZ) also were included (data not shown). (b) The proportion of apoptotic cells was determined relative to the cells infected with adenovirus-lacZ vector (ADlacZ). The apoptotic rate of ADlacZ was set to 1. A single asterisk indicates P < .05; double asterisks, P < .01 compared with the ADlacZ control. ADERα indicates adenovirus ERα; ADERβ, adenovirus ERβ.

Download figure to PowerPoint

Alternations of Caspase-3, Cytochrome C, Apoptosis-Inducing Factor, and BCL2-Associated X Protein Expression

Having demonstrated the increase in apoptosis by RTZ, ERβ, and DPN, we tried to explore relevant apoptotic proteins that were previously known to be altered in thyroid cancer.[3, 5, 17] These proteins included caspase-3, AIF, and cytochrome c in the cytoplasm and Bax in the mitochondria. Our results indicated that the level of caspase-3 was significantly increased in K1 cells that were treated with ADERβ + DPN, or ADERβ + DPN + RTZ, or AdERβ alone, or DPN alone, or DPN + RTZ (Fig. 8a); but the caspase-3 level changed little in FRO cells (Fig. 8b). The level of cytochrome c was increased in a very similar fashion to that of caspase-3 in both cell lines. A change in the AIF level also occurred that was similar to the change in caspase-3 expression among K1 cells, but the increase did not reach a significant point. A significant increase in Bax was observed in both cell lines treated with ADERβ + DPN + RTZ. We noted that the decrease in cytochrome c was observed in cells treated with ADERα or PPT in both cell lines and that the decrease in AIF occurred in K1 cells treated with ADERα or PPT (Fig. 8).

image

Figure 8. The expression of apoptosis-related proteins is illustrated. Cells were treated with various agents, as listed, for 48 hours. At the end of the treatment, cytoplasmic and mitochondrial fractions were isolated. Western blot analysis was used to detect cytoplasmic caspase-3, cytochrome c (Cyto c), apoptosis-inducing factor (AIF), and mitochondrial BCL2-associated X protein (Bax) in (a) K1 cells and (b) FRO cells. Actin was used as an equal loading control for the cytoplasmic protein and as prohibition for the mitochondrial protein. The density of Western blot bands was determined. In a and b, the typical Western blot bands (Top) and a summary of protein band densities (Bottom) are indicated. A single asterisk indicates P < .05; double asterisks, P < .01 compared with the adenovirus-lacZ vector (ADlacZ) control. ADERα indicates adenovirus estrogen receptor alpha; ADERβ, adenovirus estrogen receptor beta; PPT, propyl pyrazole triol; RTZ, rosiglitazone; DPN, diarylpropiolnitrile.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

PPARγ, ERα, and ERβ are established as contributors to the pathogenesis of thyroid cancer. The levels/activities of PPARγ and ERβ are decreased, whereas the level of ERα is increased in thyroid cancer,[5, 6, 10, 11, 20-22] indicating that these molecules are potential targets for thyroid cancer treatment. Indeed, the enhancement of ERβ by its agonists or the activation of PPARγ by its ligands induces apoptosis of thyroid cancer cells and inhibits tumor growth,[3, 4, 8, 9] and the enhancement of ERα facilitates the proliferation and growth of thyroid cancer cells.[3] However, all of those studies were performed using a single agent related to either PPARγ or ER. Because both molecules belong to the nuclear receptor family and possess very similar (PPARγ and ERβ) or opposite (PPARγ and ERα) functions in term of cell proliferation and apoptosis, it is important to examine the reciprocal impact of both molecules on thyroid cancer growth and treatment. In this study, we determined whether the over-expression of either ERα or ERβ could modulate PPARγ activity and protein expression. The results of the PPRE-mediated luciferase reporter assay demonstrated a significant decrease of PPARγ activity in PTC K1 cells and a slight decrease in ATC FRO cells. In agreement with the transcription results, Western blot analysis revealed a decrease in PPARγ expression. It is noteworthy that the ER-mediated reduction of PPARγ activity and protein expression could be restored after treatment with the PPARγ agonist RTZ, and such a counteractive effect was stronger in ERα-transfected cells than in ERβ-transfected cells and was more obvious in PTC cells than in ATC cells. Moreover, RTZ treatment led to a significant inhibition of ERα protein expression in both PTC cells and ATC cells. These findings suggest that interaction between PPARγ and ER is reciprocally inhibitory, especially for PPARγ and ERα in PTC cells. Such a reciprocal inhibition relation is further supported by 2 sets of knockdown experiments. When ERα or ERβ was knocked down by siRNA, the expression of PPARγ protein was up-regulated; whereas, when PPARγ was blocked by siRNA, the expression of ERα or/and ERβ protein was elevated. Functionally, both PTC cells and ATC cells with ERα over-expression were more proliferative and more capable of migration than the control cells. In contrast, cells with ERβ over-expression were less proliferative and less capable of migration than the control cells. The administration of RTZ offset the promotional effect of ERα, whereas it enhanced the inhibitory effect of ERβ, particularly in PTC cells. These data indicate that there is a negative reciprocal relation between ER and PPARγ in terms of protein expression. However, cell functional studies have demonstrated that the negative reciprocal relation exists only between ERα and PPARγ. Instead, ERβ and PPARγ in combination offer a positive reciprocal collaboration to enhance the inhibitory effect on cell proliferation and migration, particularly in PTC cells.

Another clear observation of our study is that the reciprocal inhibition by PPARγ and ERβ is much stronger in PTC than in ATC. Furthermore, we observed that, although ERβ and PPARγ were located in both nuclear and cytoplasmic/mitochondrial fractions in PTC cells and ATC cells, ERα was present in both nuclear and cytoplasmic/mitochondrial fractions in PTC cells only, and it was mainly expressed in cytoplasmic/mitochondrial fractions in ATC cells (data not shown). This pattern of distribution suggests that the ER genomic pathway and the ER nongenomic pathway may function differentially between PTC and ATC, thus possibly offering some clues regarding the different manifestations of PTC cells and ATC cells in terms of the reciprocal inhibition offered by PPARγ and ERβ. The different responses of PTC and ATC cells to the reciprocal interaction of PPARγ and ERβ are line with recent studies of both forms of thyroid cancers at the mRNA and protein levels, in which mRNA and proteomic signatures of ATC were associated much more closely with a high proliferation rate, epithelial to mesenchymal transition, invasion, dedifferentiation, glycolysis, lactate generation, and chemoresistance.[23-25]

Although we did not observe a direct protein-protein interaction between ER and PPARγ through coimmunoprecipitation experiments (data not shown), an indirect contact or communication between them could not be excluded. ERE, which drives the expression of the vitellogenin A2 gene, can also function as a PPRE to be bound by a PPAR/RXR heterodimer, and such a PPAR/RXR heterodimer inhibits transactivation by the ER through competition for ERE binding.[26] Another study demonstrated that the inhibitory effect of PPARγ ligands on collagen biosynthesis in endometrial adenocarcinoma cells requires functional ER.[27] Those studies all indicated that a contact or communication between PPARγ and ER is necessary for some PPARγ-mediated functions.

FUNDING SOURCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES

This work was supported by direct grants from the Chinese University of Hong Kong (reference no. 2009.1.054 and 2009.2.026).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING SOURCES
  8. CONFLICT OF INTEREST DISCLOSURES
  9. REFERENCES
  • 1
    Rahbari R, Zhang L, Kebebew E. Thyroid cancer gender disparity. Future Oncol. 2010;6:1771-1779.
  • 2
    Chen GG, Zeng Q, Tse GM. Estrogen and its receptors in cancer. Med Res Rev. 2008;28:954-974.
  • 3
    Lee ML, Chen GG, Vlantis AC, et al. Induction of thyroid papillary carcinoma cell proliferation by estrogen is associated with an altered expression of Bcl-xL. Cancer J. 2005;11:113-121.
  • 4
    Zeng Q, Chen GG, Vlantis AC, van Hasselt CA. Oestrogen mediates the growth of human thyroid carcinoma cells via an oestrogen receptor-ERK pathway. Cell Prolif. 2007;40:921-935.
  • 5
    Zeng Q, Chen G, Vlantis A, Tse G, van Hasselt C. The contributions of oestrogen receptor isoforms to the development of papillary and anaplastic thyroid carcinomas. J Pathol. 2008;214:425-433.
  • 6
    Heikkila A, Hagstrom J, Maenpaa H, et al. Loss of estrogen receptor beta expression in follicular thyroid carcinoma predicts poor outcome. Thyroid. 2013;23:456-465.
  • 7
    Gearing KL, Gottlicher M, Teboul M, Widmark E, Gustafsson JA. Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci U S A. 1993;90:1440-1444.
  • 8
    Chen Y, Wang SM, Wu JC, Huang SH. Effects of PPARgamma agonists on cell survival and focal adhesions in a Chinese thyroid carcinoma cell line. J Cell Biochem. 2006;98:1021-1035.
  • 9
    Copland JA, Marlow LA, Kurakata S, et al. Novel high-affinity PPARgamma agonist alone and in combination with paclitaxel inhibits human anaplastic thyroid carcinoma tumor growth via p21WAF1/CIP1. Oncogene. 2006;25:2304-2317.
  • 10
    Aldred MA, Morrison C, Gimm O, et al. Peroxisome proliferator-activated receptor gamma is frequently downregulated in a diversity of sporadic nonmedullary thyroid carcinomas. Oncogene. 2003;22:3412-3416.
  • 11
    Ying H, Suzuki H, Zhao L, Willingham MC, Meltzer P, Cheng SY. Mutant thyroid hormone receptor beta represses the expression and transcriptional activity of peroxisome proliferator-activated receptor gamma during thyroid carcinogenesis. Cancer Res. 2003;63:5274-5280.
  • 12
    Wang X, Kilgore MW. Signal cross-talk between estrogen receptor alpha and beta and the peroxisome proliferator-activated receptor gamma1 in MDA-MB-231 and MCF-7 breast cancer cells. Mol Cell Endocrinol. 2002;194:123-133.
  • 13
    Catalano S, Mauro L, Bonofiglio D, et al. In vivo and in vitro evidence that PPARgamma ligands are antagonists of leptin signaling in breast cancer. Am J Pathol. 2011;179:1030-1040.
  • 14
    Kebebew E, Lindsay S, Clark OH, et al. S. Results of rosiglitazone therapy in patients with thyroglobulin-positive and radioiodine-negative advanced differentiated thyroid cancer. Thyroid. 2009;19:953-956.
  • 15
    Smallridge RC, Copland JA, Brose MS, et al. Efatutazone, an oral PPAR-γ agonist, in combination with paclitaxel in anaplastic thyroid cancer: results of a multicenter phase 1 trial. J Clin Endocrinol Metab. 2013;98:2392-2400.
  • 16
    Antonelli A, Fallahi P, Ulisse S, et al. New targeted therapies for anaplastic thyroid cancer. Anticancer Agents Med Chem. 2012;12:87-93.
  • 17
    Chen GG, Liu ZM, Vlantis AC, et al. Heme oxygenase-1 protects against apoptosis induced by tumor necrosis factor-alpha and cycloheximide in papillary thyroid carcinoma cells. J Cell Biochem. 2004;92:1246-1256.
  • 18
    Liu ZM, Hasselt CA, Song FZ, et al. Expression of functional metallothionein isoforms in papillary thyroid cancer. Mol Cell Endocrinol. 2009;302:92-98.
  • 19
    Li MY, Lee TW, Yim AP, Chen GG. Function of PPARgamma and its ligands in lung cancer. Crit Rev Clin Lab Sci. 2006;43:183-202.
  • 20
    Di Vito M, De Santis E, Perrone GA, et al. Overexpression of estrogen receptor-alpha in human papillary thyroid carcinomas studied by laser-capture microdissection and molecular biology. Cancer Sci. 2011;102:1921-1927.
  • 21
    Magri F, Capelli V, Rotondi M, et al. Expression of estrogen and androgen receptors in differentiated thyroid cancer: an additional criterion to assess the patient's risk. Endocr Relat Cancer. 2012;19:463-471.
  • 22
    Dong W, Li J, Huang Y, Zhang H, Shan Z, Teng W. Differential expression patterns of estrogen receptor (ER)-β splice variants between papillary thyroid cancer and nodular thyroid goiter. Med Sci Monit. 2012;18:BR351-BR355.
  • 23
    Hebrant A, Dom G, Dewaele M, et al. mRNA expression in papillary and anaplastic thyroid carcinoma: molecular anatomy of a killing switch [serial online]. PLoS One. 2012;7:e37807.
  • 24
    Evans JJ, Crist HS, Durvesh S, Bruggeman RD, Goldenberg D. A comparative study of cell cycle mediator protein expression patterns in anaplastic and papillary thyroid carcinoma. Cancer Biol Ther. 2012;13:776-781.
  • 25
    Russo R, Di Cara G, Albanese NN, et al. Differential proteomic and phenotypic behaviour of papillary and anaplastic thyroid cell lines. J Proteomics. 2013;90:115-125.
  • 26
    Keller H, Givel F, Perroud M, Wahli W. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements. Mol Endocrinol. 1995;9:794-804.
  • 27
    Surazynski A, Jarzabek K, Miltyk W, Wolczynski S, Palka J. Estrogen-dependent regulation of PPAR-gamma signaling on collagen biosynthesis in adenocarcinoma endometrial cells. Neoplasma. 2009;56:448-454.