Prognostic significance of cytoskeleton-associated membrane protein 4 and its palmitoyl acyltransferase DHHC2 in hepatocellular carcinoma

Authors

  • Shuang-Xi Li MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    3. Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, China
    Search for more papers by this author
    • The first 3 authors contributed equally to this work.

  • Gu-Sheng Tang MD,

    1. Department of Laboratory Medicine, Changhai Hospital, Second Military Medical University, Shanghai, China
    Search for more papers by this author
    • The first 3 authors contributed equally to this work.

  • Dong-Xun Zhou MD,

    1. Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, China
    Search for more papers by this author
    • The first 3 authors contributed equally to this work.

  • Yu-Fei Pan PhD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Ye-Xiong Tan PhD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Jian Zhang MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Bo Zhang MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Zhi-Wen Ding MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Li-Juan Liu MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • Tian-Yi Jiang MD,

    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    Search for more papers by this author
  • He-Ping Hu MD,

    Corresponding author
    1. Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, China
    • Corresponding author: Hong-yang Wang, MD, and Li-wei Dong, PhD, International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2165566851; hywangk@vip.sina.com, donliwei@126.com; and He-ping Hu, MD, Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2181875141; hp-hu@medmail.com.cn.

    Search for more papers by this author
  • Li-Wei Dong PhD,

    Corresponding author
    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    • Corresponding author: Hong-yang Wang, MD, and Li-wei Dong, PhD, International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2165566851; hywangk@vip.sina.com, donliwei@126.com; and He-ping Hu, MD, Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2181875141; hp-hu@medmail.com.cn.

    Search for more papers by this author
  • Hong-Yang Wang MD

    Corresponding author
    1. International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, Shanghai, China
    2. National Center for Liver Cancer, Shanghai, China
    3. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, Shanghai Jiaotong University School of Medicine, China
    • Corresponding author: Hong-yang Wang, MD, and Li-wei Dong, PhD, International Cooperation Laboratory on Signal Transduction, Eastern Hepatobiliary Surgery Institute, the Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2165566851; hywangk@vip.sina.com, donliwei@126.com; and He-ping Hu, MD, Department of Liver Medicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, 225 Changhai Rd, 200438, Shanghai, China; Fax: (011) 86 2181875141; hp-hu@medmail.com.cn.

    Search for more papers by this author

Abstract

BACKGROUND

The functions of cytoskeleton-associated membrane protein 4 (CKAP4), one kind of type II transmembrane protein, are associated with the palmitoyl acyltransferase DHHC2. The objective of the current study was to investigate CKAP4/DHHC2 expression and its prognostic significance in patients with hepatocellular carcinoma (HCC).

METHODS

Two independent cohorts of 416 patients with HCC were enrolled. All the patients included had defined clinicopathologic and follow-up data. Using real-time polymerase chain reaction and immunohistochemical assay, CKAP4 and DHHC2 expression were evaluated. The association between CKAP4/DHHC2 expression and HCC-specific disease-free survival and overall survival was analyzed by Kaplan-Meier curves, the log-rank test, and Multivariate Cox regression analyses.

RESULTS

The data documented that CKAP4 expression was much higher in HCC tumor tissues compared with adjacent normal tissues and its expression was significantly correlated with tumor size, intrahepatic metastases, portal venous invasion, and Barcelona Clinic Liver Cancer stage of disease in 2 cohorts of patients. On survival analysis, patients with high CKAP4 expression appeared to have a favorable overall survival and a longer disease-free survival compared with those with low expression. DHHC2 expression was also examined in tissue microarray analysis by immunohistochemistry and the results demonstrated that 87.6% of the cases had low expression of DHHC2. Kaplan-Meier analysis indicated that a high level of DHHC2 expression predicted favorable overall survival and disease-free survival rates in both the training cohort and validation set. Furthermore, the combination of CKAP4 and DHHC2 was found to have a more powerful efficiency in prognosis prediction than either one alone.

CONCLUSIONS

To the best of our knowledge, the current study is the first to demonstrate that the expression of CKAP4 and its palmitoyl acyltransferase DHHC2 correlates with disease progression and metastasis in patients with HCC and may provide prognostic and therapeutic value. Cancer 2014;120:1520–1531. © 2014 American Cancer Society.

INTRODUCTION

Hepatocellular carcinoma (HCC) is one of the most common cancers diagnosed worldwide. Although many patients with HCC can be treated with surgical excision or transcatheter arterial chemoembolization, the prognosis of this disease remains dismal.[1, 2] HCC tumors that grow rapidly with early vascular invasion are highly resistant to chemotherapy. The extremely poor prognosis of patients with HCC is largely due to the high frequency of disease recurrence or distant metastasis after surgical resection. Therefore, a most critical issue is to search for molecular markers related to disease recurrence or metastasis, which will provide new targets for intervention to prevent progression of HCC.

Cytoskeleton-associated membrane protein 4 (CKAP4), also known as P63, with a molecular weight 63 kilodaltons, is a type of type II transmembrane protein that is located in the endoplasmic reticulum.[3, 4] Early studies have shown that CKAP4 plays an important role in maintaining the structure of the endoplasmic reticulum.[4-6] Recently, it has been identified as a cell surface receptor for tissue plasminogen activator and surfactant protein A, as well as antiproliferative factor.[3, 7-9] It has been shown that CKAP4 may inhibit the proliferation of bladder cancer cells by combining its ligand antiproliferative factor, whose mechanism may be related to the Wnt signaling pathway. Recent studies have shown that palmitoylation by DHHC2, a putative tumor suppressor, is required for CKAP4 trafficking from the endoplasmic reticulum to the plasma membrane and for its nuclear localization.[10] Additional studies have reported that CKAP4 contributes to gentamicin-induced apoptosis in proximal tubule cells, likely through dimerization of CKAP4, which is dependent on its palmitoylation.[11]

In the current study, we examined the pattern of expression of CKAP4 and DHHC2 in HCC tumor tissues and normal-like specimens. Together with the known function, it is therefore of interest to investigate the clinical significance of CKAP4 and DHHC2 in the prognosis of patients with HCC.

MATERIALS AND METHODS

Patients and Follow-Up

We recruited 139 consecutive patients with HCC to a training cohort from January 2000 to June 2002 at Eastern Hepatobiliary Surgery Hospital, Second Military Medical University in Shanghai, China. A validation cohort comprising 277 patients with HCC was also recruited from Eastern Hepatobiliary Surgery Hospital between July 2002 and December 2005. The selection of this specific material was performed to include patients who underwent surgery alone without chemotherapy or radiotherapy at a time when these adjunctive therapies were not the standard of treatment. The patients included in the series also had available paraffin-embedded tumor tissues. The follow-up period was defined as the interval from the date of surgery to the date of death or last follow-up. Deaths from other causes were treated as censored cases. All patients were observed until June 2012 (range, 1 month-102 months; median, 22 months). Overall survival (OS) was defined as the interval between the dates of surgery and death. Disease-free survival (DFS) was defined as the interval between the dates of surgery and disease recurrence; if disease recurrence was not diagnosed, patients were censored at the date of death or last follow-up. Sixty-eight pairs of HCC specimens were recruited to the testing set for polymerase chain reaction (PCR) and Western blot analysis. Eighteen normal liver tissues were collected from patients with hemangioma as normal controls at Eastern Hepatobiliary Surgery Hospital. The International Union Against Cancer TNM classification and staging system was applied to each case. Patient samples were obtained after informed consent was provided according to an established protocol approved by the Ethics Committee of Eastern Hepatobiliary Surgery Hospital.

Tissue Microarray and Immunohistochemistry

After screening hematoxylin and eosin-stained slides for optimal tumor content, tissue microarray analysis (TMA) slides were constructed (Shanghai Biochip Company Ltd, Shanghai, China). Immunohistochemistry was performed as described previously.[12] The sections were incubated in primary polyclonal antibodies against CKAP4 (HPA000792; Sigma Chemical Company, St. Louis, Mo) and DHHC2 (sc-292338; Santa Cruz Biotechnology, Dallas, Tex) that were applied at a 1:100 dilution. Finally, the visualization signal was developed with diaminobenzidine and the slides were counterstained in hematoxylin.

Stained sections were evaluated in a blinded manner without prior knowledge of the clinical information using the German Immunoreactive Score (IRS) as described previously.[13] Briefly, the IRS assigns subscores for immunoreactive distribution (0-4) and intensity (0-3) and then multiplies them to yield the IRS score. The percent positivity was scored as 0 (< 5%), 1 (5%-25%), 2 (25%-50%), 3 (50%-75%), or 4 (> 75%). The staining intensity was score as 0 (no staining), 1 (weakly stained), 2 (moderately stained), or 3 (strongly stained). Cases with discrepancies in the IRS score were discussed together with other pathologists until consensus was reached.

Western Blot Analysis

Whole cell extracts were prepared in radio immunoprecipitation assay (RIPA) buffer and centrifuged at 12,000g for 15 minutes. Protein concentrations were measured using the bicinchoninic acid assay. Immunoblot analysis was performed using specific primary antibodies, and immune complexes were incubated with the fluorescein-conjugated secondary antibody and then detected using an Odyssey fluorescence scanner (Li-Cor, Lincoln, Neb).

RNA Collection, cDNA Synthesis, and Real-Time PCR Analysis

Total RNA was extracted from fresh-frozen primary HCC tissues in Trizol (Invitrogen, Carlsbad, Calif). Reverse transcription of total RNA was performed using random hexamers (Roche Diagnostics, Berlin, Germany) and SuperScriptII reverse transcriptase (Invitrogen). All quantitative real-time PCR reactions were performed in 1× Universal Master Mix (4367659; Applied Biosystems, Sparta, NJ) with gene-specific primers and probes on the ABI Prism 7300 Sequence Detection System, according to the manufacturer's instructions. The 18S ribosomal RNA levels were quantified as an internal control to normalize the expression of each gene. Each reaction was repeated independently at least 3 times. The primers for ckap4 were as follows: forward: CCGTGGAATCACTCCAGAAGG; reverse: AGTCCTGAGCATTTTCAAGTCC.

Statistical Analysis

The Pearson chi-square test or Fisher exact test was used to analyze the relationship between CKAP4 or DHHC2 expression and the clinicopathologic features. Survival curves were calculated using the Kaplan-Meier method and compared with the log-rank test. The Cox proportional hazards regression model was used for analyses to explore the effect of the clinicopathological variables and CKAP4 and DHHC2 expression on survival. SPSS statistical software (version 15.0; SPSS Inc, Chicago, Ill) was used for all statistical analyses and a P value < .05 was considered to be statistically significant.

RESULTS

Expression of CKAP4 in HCC Specimens is Associated With Clinicopathological Features

Using real-time PCR and Western blot analysis (Figs. 1A and 1B), we confirmed the high expression of CKAP4 in HCC specimens. To further investigate the correlation between CKAP4 expression and clinical characteristics, 2 sets of TMAs were constructed for training and validation tests. The patients and clinicopathologic data are summarized in Table 1 and Table 2. Of the patients in the training cohort, 63.6% of cases were classified as having high expression of CKAP4 in tumor tissues; the normal adjacent tissues demonstrated that only 39.2% of the samples had high CKAP4 expression (Fig. 1C). With regard to the validation set, there were 61% of patients found to have high CKAP4 expression. Further analysis demonstrated that the expression of CKAP4 was significantly correlated with tumor size (P = .020), intrahepatic metastases (P = .048), portal venous invasion (P = .040), histological grading (P = .041), and TNM (P = .049) and Barcelona Clinic Liver Cancer (BCLC) (P = .041) stage of disease in the training set and similar results were observed in the validation cohort (Table 1) (Table 2).

Table 1. Relationship Between CKAP4 Protein Expression and Clinicopathologic Characteristics In the Training Set (N = 139)
CharacteristicsNo. of PatientsCKAP4 Immunore activityPa
LowHigh
  1. Abbreviations: AFP, α-fetoprotein; BCLC, Barcelona Clinic Liver Cancer; CKAP4, cytoskeleton-associated membrane protein 4; HBsAg, hepatitis B surface antigen.

  2. a

    Bold type indicates statistical significance.

Sex   .317
Female1798 
Male1224973 
Age, y   .784
≤50823547 
>50572334 
HBsAg   .435
Absent1037 
Present1295574 
AFP, ng/mL   .299
≤20301515 
>201094366 
Tumor size, cm   .020
≤533825 
>51065056 
No. of tumors   .435
Single1295574 
Multiple1037 
Intrahepatic metastases   .048
Negative762650 
Positive633231 
Portal venous invasion   .040
Negative672245 
Positive723636 
Distant metastasis   .444
Negative963858 
Positive432023 
Encapsulation   .655
Negative753045 
Positive642836 
Cirrhosis   1.000
Negative622636 
Positive773245 
Histological grading   .041
Well/moderate13313 
Poor1345667 
TNM stage   .049
I and II642143 
III and IV753738 
BCLC stage   .041
A33825 
B391623 
C673433 
Table 2. Relationship Between CKAP4 Protein Expression and Clinicopathologic Characteristics in the Validation Set (n = 277)
CharacteristicsNo. of PatientsCKAP4 Immunore activityPa
LowHigh
  1. Abbreviations: AFP, α-fetoprotein; BCLC, Barcelona Clinic Liver Cancer; CKAP4, cytoskeleton-associated membrane protein 4; HBsAg, hepatitis B surface antigen.

  2. a

    Bold type indicates statistical significance.

Sex   .106
Female351817 
Male24290152 
Age, y   .514
≤501606595 
>501174374 
HBsAg   .842
Absent19712 
Present258101157 
AFP, ng/mL   .582
≤20472027 
>2023088142 
Tumor size, cm   .016
≤5561442 
>522194127 
No. of tumors   .380
Single254101153 
Multiple23716 
Intrahepatic metastases   .005
Negative15047103 
Positive1276166 
Portal venous invasion   .006
Negative1103278 
Positive1677691 
Distant metastasis   .551
Negative19172119 
Positive863650 
Encapsulation   .606
Negative17767110 
Positive1004159 
Cirrhosis   .862
Negative762947 
Positive20179122 
Histological grading   .013
Well/moderate32626 
Poor245102143 
TNM stage   .033
I and II792369 
III and IV19885100 
BCLC stage   .037
A441034 
B692643 
C1647292 
Figure 1.

Expression of cytoskeleton-associated membrane protein 4 (CKAP4) is shown in hepatocellular carcinoma (HCC) specimens. (A) CKAP4 mRNA expression is shown in HCC (T) and normal (N) liver tissues. (B) Western blot analysis expression of CKAP4 is shown in HCC (T) and normal adjacent tissues (N). The tissues were lysed and protein extracts were subjected to protein gel blot analysis using CKAP4 antibody and the relative protein levels were evaluated. (C) Tissue microarray analysis detection of CKAP4 expression in the training cohort is shown. The training set tissue microarray analysis was stained by CKAP4 antibody and the samples were grouped into high expression and low expression groups according to the CKAP4 intensity. GAPDH indicates glyceraldehyde 3-phosphate dehydrogenase; Para-T, para-tumor .

Prognostic Values of CKAP4 Expression Among Patients With HCC

Kaplan-Meier analysis revealed that the patients with low CKAP4 expression had significantly shorter OS and higher disease recurrence rates compared with patients with high CKAP4 expression. The 1-year, 3-year, 5-year, and 7-year OS rates were 30.6%, 15.7%, 7.4%, and 0%, respectively, for patients with low CKAP4 expression in the training cohort (Fig. 2A-D), whereas the patients with high CKAP4 expression had 1-year, 3-year, 5-year, and 7-year OS rates of 50.9%, 26%, 12.4%, and 3.6%, respectively. Examining the rates of disease recurrence, the 1-year, 3-year, 5-year, and 7-year recurrence rates were 81.5%, 91.7%, 96.3%, and 100%, respectively, for patients with low CKAP4 expression in the training set (Figs. 2 A-D) and among the patients with high CKAP4 expression, the 1-year, 3-year, 5-year, and 7-year recurrence rates were 72.2%, 81.7%, 91.7%, and 97.7%, respectively. Similar results were observed in the validation set (Fig. 2 E-H).

Figure 2.

Kaplan-Meier curves are shown for time to disease recurrence and overall survival among patients with high or low intratumoral cytoskeleton-associated membrane protein 4 (CKAP4) expression. The 7-year, 5-year, 3-year, and 1-year overall survival and recurrence rates were analyzed in groups of patients with high and low CKAP4 expression in (A-D) the training cohort and (E-H) the validation set.

Univariate analyses of clinical variables considered to be potential predictors of survival are shown in Table 3 and Table 4. Univariate analysis revealed that CKAP4, sex, hepatitis B virus, serum CA 19-9, tumor size, intrahepatic metastases, hepatic venous invasion, portal venous invasion, encapsulation, histological grading, and BCLC and TNM stage of disease were predictors of OS and DFS in the training set. Distant metastasis was associated with DFS. Further analysis in a multivariate Cox proportional hazards model demonstrated that CKAP4, together with tumor size, hepatitis B virus, and BCLC stage, were strongly associated with OS. CKAP4 was also found to be correlated with DFS in our validation cohort. CKAP4 was an independent prognostic indicator for OS (P = .026 in the training set and P = .001 in the validation cohort) (Table 3) (Table 4).

Table 3. Univariate and Multivariate Cox Regression Analyses: CKAP4 for DFS or OS of Patients in the Training Cohort (n = 139)
VariablesDFSOS
HR (95% CI)aPbHR (95% CI)bPb
  1. Abbreviations: 95% CI, 95% confidence interval; AFP, α-fetoprotein; ALT, alanine aminotransferase; BCLC, Barcelona Clinic Liver Cancer; CEA, carcinoembryonic antigen; CKAP4, cytoskeleton-associated membrane protein 4; DB, direct bilirubin; DFS, disease-free survival; HBV, hepatitis B virus; HR, hazards ratio; NA, not applicable; OS, overall survival; TB, total bilirubin.

  2. a

    For CKAP4, the median values were used as the cutoff point for the definition of subgroups (low expression and high expression groups). Univariate analysis, Cox proportional hazards regression; multivariate analysis, Cox proportional hazards regression. Variables were adopted in multivariate analysis for their prognostic significance by univariate analysis.

  3. b

    Bold type indicates statistical significance.

Univariate analysis    
CKAP4 (high vs low)0.669 (0.450-0.993).0460.653 (0.437-0.975).037
Age (>50 y vs ≤50 y)0.981 (0.963-1.000).0570.789 (0.526-1.185).253
Sex (male vs female)0.554 (0.279-1.104).0930.414 (0.191-0.894).025
HBV (negative vs positive)2.705 (0.991-7.381).0522.763 (1.013-7.541).047
Serum AFP (>20 ng/mL vs ≤20 ng/mL)1.660 (0.993-2.775).0531.884 (1.083-3.278).025
Serum CEA (>10 ng/ml vs ≤10 ng/ml)1.481 (0.886-2.475).1341.362 (0.796-2.331).259
Serum TB (>18.8 umol/L vs ≤18.8umol/L)0.516 (0.300-0.889).1700.629 (0.369-1.072).088
Serum DB (>6 umol/L vs ≤6 umol/L)0.790 (0.489-1.253).3161.032 (0.659-1.616).890
Serum ALT (>41 U/L vs ≤41 U/L)0.921 (0.602-1.410).7051.114 (0.711-1.744).638
Ascites (negative vs positive)1.150 (0.725-1.825).5521.441 (0.927-2.240).105
Largest tumor size (>5 cm vs ≤5 cm)2.937 (1.683-5.125).0002.496 (1.454-4.285).001
Intrahepatic metastasis (negative vs positive)1.737 (1.163-2.596).0072.431 (1.611-3.668).000
Hepatic venous invasion (negative vs positive)2.006 (1.167-3.447).0121.882 (1.087-3.257).024
Portal venous invasion (negative vs positive)2.128 (1.409-3.215).0003.302 (2.153-5.064).000
Distant metastasis (well vs moderate/poorly)2.100 (1.400-3.150).0001.562 (1.022-2.387).040
Encapsulation (negative vs positive)0.576 (0.383-0.868).0080.438 (0.287-0.668).000
Cirrhosis (negative vs positive)1.096 (0.720-1.668).6681.552 (0.983-2.452).059
Histologic grading (well/moderate vs poor)2.349 (1.084-5.089).0302.473 (1.080-5.667).032
TNM stage (I/II vs III/IV)2.923 (1.838-4.647).0004.691 (2.810-7.831).000
BCLC stage (A vs B vs C)1.681 (1.291-2.189).0002.589 (1.918-3.494).000
Multivariate analysis    
CKAP4 (high vs low)NA 0.601 (0.383-0.943).027
Sex (male vs female)NA NA 
HBV (negative vs positive)NA 5.263 (1.805-15.344).002
Serum AFP (>20 ng/ml vs≤20 ng/ml)NA NA 
Largest tumor size (>5 cm vs ≤5 cm)1.996 (1.047-3.803).0360.426 (0.191-0.942).035
Intrahepatic metastasis (negative vs positive)NA 1.672 (1.032-2.711).037
Hepatic venous invasion (negative vs positive)NA NA 
Portal venous invasion (negative vs positive)NA NA 
Distant metastasis (well vs moderate/poorly)1.807 (1.189-2.745).006NA 
Envelop (negative vs positive)NA NA 
Histologic grading (well/moderate vs poor)NA NA 
TNM stage (I/II vs III/IV)1.937 (1.128-3.326).017NA 
BCLC stage (A vs B vs C)NA 3.527 (1.692-7.352).001
Table 4. Univariate and Multivariate Cox Regression Analyses: CKAP4 for DFS or OS of Patients in the Validation Cohort (n = 277)
VariablesDFSOS
HR (95% CI)aPbHR (95% CI)aPb
  1. Abbreviations: 95% CI, 95% confidence interval; AFP, α-fetoprotein; ALT, alanine aminotransferase; BCLC, Barcelona Clinic Liver Cancer; CEA, carcinoembryonic antigen; CKAP4, cytoskeleton-associated membrane protein 4; DB, direct bilirubin; DFS, disease-free survival; HBV, hepatitis B virus; HR, hazards ratio; NA, not applicable; OS, overall survival; TB, total bilirubin.

  2. a

    For CKAP4, the median values were used as the cutoff point for the definition of subgroups (low expression and high expression groups). Univariate analysis, Cox proportional hazards regression; multivariate analysis, Cox proportional hazards regression. Variables were adopted in multivariate analysis for their prognostic significance by univariate analysis.

  3. b

    Bold type indicates statistical significance.

Univariate analysis    
CKAP4 (high vs low)0.676 (0.509-0.897).0070.621 (0.474-0.815).001
Age (>50 y vs ≤50 y)0.990 (0.977-1.003).1290.989 (0.977-1.000).104
Sex (male vs female)0.632 (0.404-0.988).0440.569 (0.362-0.893).014
HBV (negative vs positive)2.029 (1.070-3.847).0301.812 (0.011-3.249).046
Serum AFP (>20 ng/mL vs ≤20 ng/mL)1.798 (1.202-1.691).0041.933 (1.288-2.901).001
Serum CEA (>10 ng/mL vs ≤10 ng/mL)1.987 (0.844-1.670).3251.166 (0.837-1.623).363
Serum TB (>18.8 umol/L vs ≤18.8 umol/L)0.788 (0.560-1.109).1710.889 (0.634-1.229).475
Serum DB (>6 umol/L vs ≤6 umol/L)0.963 (0.710-1.304).8051.126 (0.846-1.500).415
Serum ALT (>41 U/L vs ≤41 U/L)0.976 (0.721-1.322).8751.168 (0.865-1.577).311
Ascites (negative vs positive)1.221 (0.870-1.714).2471.197 (0.868-1.652).273
Largest tumor size (>5 cm vs ≤5 cm)2.370 (1.593-3.524).0002.302 (1.560-3.390).000
Intrahepatic metastasis (negative vs positive)1.392 (1.051-1.843).0211.901 (1.453-2.488).000
Hepatic venous invasion (negative vs positive)2.201 (1.375-2.970).0001.737 (1.196-2.523).004
Portal venous invasion (negative vs positive)1.809 (1.347-2.429).0002.730 (2.029-3.674).000
Distant metastasis (well vs moderate/poorly)1.546 (1.162-2.057).0031.225 (0.923-1.626).161
Encapsulation (negative vs positive)0.617 (0.456-0.835).0020.497 (0.368-0.671).000
Cirrhosis (negative vs positive)1.165 (0.853-1.590).3371.313 (0.965-1.787).084
Histologic grading(well/moderate vs poor)1.725 (1.071-2.777).0252.429 (1.459-4.049).014
TNM stage (I/II vs III/IV)2.213 (1.587-3.086).0002.349 (1.736-3.179).000
BCLC stage (A vs B vs C)1.532 (1.262-1.858).0032.157 (1.745-2.666).002
Multivariate analysis    
CKAP4 (high vs low)0.733 (0.547-0.981).0370.631 (0.476-0.836).001
Sex (male vs female)NA 0.578 (0.348-0.956).034
HBV (negative vs positive)2.103 (1.102-4.013).0241.994 (1.081-3.681).027
Serum AFP (>20 ng/mL vs≤20 ng/mL)NA NA 
Largest tumor size (>5 cm vs ≤5 cm)2.098 (1.370-3.213).001NA 
Intrahepatic metastasis (negative vs positive)NA 1.419 (1.067-1.887).016
Hepatic venous invasion (negative vs positive)1.952 (1.321-2.884).001NA 
Portal venous invasion (negative vs positive)NA NA 
Distant metastasis (well vs moderate/poorly)NA NA 
Envelop (negative vs positive)NA NA 
Histologic grading (well/moderate vs poor)NA NA 
TNM stage (I/II vs III/IV)1.468 (1.019-2.114).039NA 
BCLC stage (A vs B vs C)NA 1.960 (1.567-2.452).000

Expression of DHHC2 in HCC Tissues

Previous studies revealed that CKAP4 was a major substrate of the palmitoyl acyltransferase DHHC2, which is a tumor suppressor. We then examined the expression of DHHC2 in patients with HCC. Real-time PCR and Western blot analysis both demonstrated that DHHC2 expression was low or absent in tumor tissues (Figs. 3A and 3B). DHHC2 expression was also examined in TMA by immunohistochemistry (Fig. 3C). According to the expression of DHHC2, the HCC tissues were divided into 3 groups: those with high tumor and low para-tumor expression (group 1), those with low tumor and high para-tumor expression (group 2), and those with low tumor and low para-tumor expression (group 3). As shown in Figure 3C, 17.5% of the cases presented with high DHHC2 expression in the tumor and low expression in the para-tumor, 60.1% of the cases fell in group 2, and 17.5% of samples demonstrated low expression in both the tumor and para-tumor.

Figure 3.

Expression of DHHC2 is shown in hepatocellular carcinoma (HCC) specimens. (A) DHHC2 expression in 68 pairs of HCC (T) and normal (N) adjacent liver tissues were detected by real-time polymerase chain reaction (PCR). The value represented Log2 of the quantitative reverse transcriptase-PCR value of the mRNA of the HCC tumor to the paired normal adjacent tissue. (B) Western blot analysis of DHHC2 protein levels was performed in 20 pairs of HCC tumor tissues. (C) DHHC2 expression was examined in tissue microarray analysis by immunohistochemistry. According to the staining of DHHC2, the HCC samples were divided into 3 groups: those with high tumor and low para-tumor (Para-T) expression (group 1), those with low tumor and high para-tumor expression (group 2), and those with low tumor and low para-tumor expression (group 3). GAPDH indicates glyceraldehyde 3-phosphate dehydrogenase.

Combination of CKAP4 and DHHC2 Exhibits Improved Prognostic Accuracy for HCC

Kaplan-Meier analysis indicated that a high level of DHHC2 expression predicted a favorable OS rate and DFS rate in both the training cohort and validation set (Fig. 4). Accumulating evidence also indicated that a combination of multiple markers might be more informative than any single marker for the prediction of clinical outcome among patients with HCC. Elevation of either CKAP4 or DHHC2 in patients with HCC appears to be predictive of a good prognosis. We then observed the combination of CKAP4 and DHHC2 expression as a predictor of clinical outcome. As shown in Figure 5 (the training cohort and validation cohort), those patients with elevated CKAP4 expression and enhanced DHHC2 expression demonstrated even better OS and DFS rates, indicating that the combination of the 2 parameters has a better prognostic value compared with either one alone. We further analyzed the prognosis of patients with different levels of expression of CKAP4 or DHHC2 in the same BCLC or TNM disease stage. As shown in Table 5, patients with TNM stage III to IV and BCLC stage C disease with weak CKAP4 expression have much worse prognosis whereas DHHC2 expression only appears to have prognostic value with regard to DFS in patients with early-stage disease according to both the TNM and BCLC staging systems (Table 6). For analysis of the prognostic significance of the combination of CKAP4 and DHHC2 expression in patients with the same TNM or BCLC stage of disease, we separated the cases into 4 groups: group 1 had both weak CKAP4 and DHHC2 expression, group 2 had weak CKAP4 and strong DHHC2 expression, group 3 had strong CKAP4 and weak DHHC2 expression, and group 4 had strong CKAP4 and strong DHHC2 expression. As shown in Table 7, patients in group 1 were found to have much shorter OS and DFS than the other groups at an advanced TNM or BCLC stage of disease.

Table 5. OS Rates and DFS Rates in CKAP4 Groups Within Different Variables (n = 277)
Stratification VariableClassificationCKAP4 StainingNo.3-Year OS Rate, %3-Year OS Pa5-Year OS Rate, %5-Year OS Pa3-Year DFS Rate, %3-Year DFSPa5-Year DFS Rate, %5-Year DFS Pa
  1. Abbreviations: BCLC, Barcelona Clinic Liver Cancer; CKAP4, cytoskeleton-associated membrane protein 4; DFS, disease-free survival; OS, overall survival.

  2. a

    Bold type indicates statistical significance.

TNMI-IIWeak2343.2.67526.1.85721.7.42913.0.778
Strong5642.923.232.112.5
III-IVWeak858.2.0092.4.0084.7.0081.2.005
Strong11317.77.111.56.2
BCLCAWeak1080.0.11040.30740.0.74920.0.625
Strong3450.029.438.217.6
BWeak2623.1.46711.5.4737.7.4433.8.520
Strong4323.311.618.67.0
CWeak724.2.0001.4.0004.2.0021.4.002
Strong9218.56.510.95.4
Table 6. OS Rates and DFS Rates in DHHC2 Groups Within Different Variables (n = 277)
Stratification VariableClassificationDHHC2 StainingNo.3-Year OS Rate, %3-Years OS Pa5-Year OS Rate, %5-Year OS Pa3-Year DFS Rate, %3-Year DFSPa5-Year DFS Rate, %5-Year DFSPa
  1. Abbreviations: BCLC, Barcelona Clinic Liver Cancer; DFS, disease-free survival; OS, overall survival.

  2. a

    Bold type indicates statistical significance.

TNMI-IIWeak4035.0.09515.0.03317.5.0085.0.005
Strong3951.333.341.020.5
III-IVWeak11410.5.3502.6.2426.1.2311.8.149
Strong8417.98.311.97.1
BCLCAWeak1850.35922.2.23322.2.0155.6.016
Strong2661.538.550.026.9
BWeak3917.9.3037.7.24210.3.3132.6.205
Strong3030.016.720.010.0
CWeak9710.3.6472.1.4266.2.5852.1.459
Strong6714.97.510.46.0
Table 7. OS Rates and DFS Rates in DHHC2 and CKAP4 Groups Within Different Variables (n = 277)
Stratification VariableClassificationStainingaNo.3-Year OS Rate, %3-Year OS Pb5-Year OS Rate, %5-Year OS Pb3-Year DFS Rate, %3-Year DFSPb5-Year DFS Rate, %5-Year DFSPb
  1. Abbreviations: BCLC, Barcelona Clinic Liver Cancer; CKAP4, cytoskeleton-associated membrane protein 4; DFS, disease-free survival; OS, overall survival.

  2. a

    CKAP4 and DHHC2 staining: 1 indicates CKAP4 weak and DHHC2 weak; 2, CKAP4 weak and DHHC2 strong; 3, CKAP4 strong and DHHC2 weak; 4, CKAP4 strong and DHHC2 strong.

  3. b

    Bold type indicates statistical significance.

TNMI-II11540.0.49520.0.27713.3.1110.0.075
2944.433.333.333.3
32433.312.520.88.3
43151.632.241.916.1
III-IV1586.9.0211.7.0205.2.0210.0.018
2267.13.83.83.8
35715.83.57.03.5
45721.110.515.88.8
BCLCA1683.3.29833.3.44633.3.1890.0.206
2460.040.040.040.0
31136.418.218.29.1
42259.136.450.022.7
B12015.0.59910.0.7055.0.7470.0.621
2540.020.020.020.0
32025.05.015.05.0
42425.016.720.88.3
C1474.3.0040.0.0064.3.0220.0.022
2254.04.04.04.0
35016.04.08.04.0
44221.49.514.37.1
Figure 4.

Kaplan-Meier curves are shown for time to disease recurrence and overall survival among patients with high or low intratumoral DHHC2 expression. The 7-year, 5-year, and 3-year overall survival and disease recurrence rates were analyzed in groups with high and low DHHC2 expression in (A-C) the training set and (D-E) the validation cohort. The different subgroups were plotted according to the DHHC2 levels.

Figure 5.

The combination of cytoskeleton-associated membrane protein 4 (CKAP4) and DHHC2 was found to demonstrate improved prognostic accuracy among patients with hepatocellular carcinoma. The 7-year, 5-year, and 3-year overall survival and disease-free survival rates of patients with hepatocellular carcinoma with high or low CKAP4 and DHHC2 expression were compared using Kaplan-Meier analysis in (A-C) the training set and (D-F) the validation cohort.

DISCUSSION

Over the past several decades, great efforts have been made to explore the molecular mechanism underlying tumorigenicity, invasion, and metastasis of HCC to identify biomarkers for prediction and to develop effective treatments. To our knowledge to date, there is evidence linking the CKAP4 gene to tumor growth in patients with bladder cancer and cervical carcinoma.[8, 9] Our recent work indicates that CKAP4 is a prognostic marker in patients with intrahepatic cholangiocellular carcinoma and is clinicopathologically associated with tumor progression and metastasis.[14] To our knowledge, systematic investigation of the prognostic significance of CKAP4 in HCC has not been reported to date, especially with long-term follow-up and a large number of patients.

In the current study, we observed that CKAP4 expression was upregulated in patients with HCC and the high level of CKAP4 correlated with a favorable prognosis. Analyzing the association between CKAP4 expression and pathological characteristics in several cohorts of patients with HCC using TMA revealed a significant correlation between CKAP4 expression and several clinical features, all of which were hallmarks for prognosis in patients with HCC. Furthermore, the Kaplan-Meier analysis indicated that patients with HCC who had high CKAP4 expression in general had a better prognosis compared with those with low CKAP4 expression. To the best of our knowledge, this is the first study to determine that CKAP4 is a prognostic marker in patients with HCC. Metastasis is an important feature of HCC progression. Clinical results have suggested that CKAP4 inhibits tumor intrahepatic metastases and venous invasion, and therefore the effect of CKAP4 on tumor invasion and metastasis requires further detailed investigations. The clinical data presented in the current study indicate that CKAP4 was a tumor suppressor in patients with HCC, which raised the question of why a tumor suppressor is highly expressed in HCC.

Palmitoylation plays an important role in regulating the subcellular distribution and function of many proteins, with key roles in diverse signaling networks.[15-17] Palmitoylation is mediated by a family of at least 23 palmitoyl acyltransferases characterized by an Asp-His-His-Cys (DHHC) motif.[18] CKAP4 was identified as a substrate of DHHC2, a putative tumor suppressor.[10] Previous reports suggested that CKAP4 palmitoylation by DHHC2 is required for its trafficking from the endoplasmic reticulum to the plasma membrane and for its nuclear localization, which is critical to the antiproliferation effect of CKAP4.[19] It is therefore of interest to investigate the expression and clinical significance of DHHC2 in patients with HCC. We found that DHHC2 was lost or had only low expression in the majority of HCC samples and a high level of DHHC2 expression predicted a favorable outcome in both the training cohort and validation set. Human DHHC2 is frequently deleted in many types of cancer, including colorectal cancer,[20-22] hepatocellular carcinoma,[21, 23] non-small cell lung cancer,[20, 24] and cancers of the breast.[25, 26] The loss of DHHC2 expression in HCC and other highly metastatic cancers suggested to us that the hypo/depalmitoylated substrate of DHHC2 (eg, CKAP4) would provide important insight into the molecular mechanisms underlying tumorigenesis and disease progression. The data from the current study cannot fully explain why a tumor suppressor, CKAP4, is highly expressed in HCC, but they indicate that the function of CKAP4 is impaired because DHHC2 is absent in the majority of cases of HCC. However, the exact mechanisms of CKAP4 expression regulation and function in HCC remain to be investigated further.

We believe the most interesting finding of the current study is that the predictive range of CKAP4 levels combined with DHHC2 expression was more sensitive than that of either CKAP4 or DHHC2 alone with regard to OS and cumulative disease recurrence, strongly suggesting the concerted correlation of CKAP4 and DHHC2 when examined in patients with HCC in the current study. The detection of tumor CKAP4 alone or the combined evaluation of CKAP4/DHHC2 levels as a new prognostic marker in patients with HCC is important because they provide not only a new criterion for prognosis but also a potential therapeutic target. The heightened sensitivity of cells attempting to restore DHHC2/CKAP4 function could be exploited in the development of therapeutic regimens that may potentiate the antineoplastic effect of conventional therapeutic agents.

In conclusion, the results of the current study demonstrated that the expression of CKAP4 and its palmitoyl acyltransferase DHHC2 was correlated with disease progression and metastasis in patients with HCC. Elucidating CKAP4/DHHC2 expression in tumor cells and the careful classification of patients may prove to be important in the development of targeted therapeutic strategies for HCC.

FUNDING SUPPORT

Supported by grants from the National Natural Science Foundation of China (81000971, 81172305, 81370066, and 81372355), the Funds for Creative Research Groups of China (81221061), the State Key Project for Liver Cancer (2012ZX10002-009 and 2013ZX10002-010), and the Wujieping Medical Foundation for Laboratory Diagnosis of Liver Disease (SY-2011A003).

CONFLICT OF INTEREST DISCLOSURES

The authors made no disclosures.

Ancillary