SEARCH

SEARCH BY CITATION

Keywords:

  • Ly-6G;
  • Ly-6C;
  • cross-reactivity;
  • flow cytometry;
  • Ly-6G/C

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

Background

The Ly-6 family has many members, including Ly-6C and Ly-6G. A previous study suggested that the anti-Ly-6G antibody, RB6-8C5, may react with Ly-6Chi murine bone marrow (BM) cells. This finding has been interpreted as cross-reactivity of RB6-8C5 with the Ly-6C antigen, and has been generalized to many hematopoietic cell types, using the terminology Ly-6G/C. The present study was undertaken to determine whether anti-Ly-6G antibodies truly cross-react with the Ly-6C antigen on multiple hematopoietic cell types.

Methods

Splenocytes, thymocytes, and BM cells obtained from Ly-6.1 and Ly-6.2 strains of mice were stained with a variety of antibodies to Ly-6C and Ly-6G. Flow cytometric analysis was performed on these populations.

Results

Evaluation of anti-Ly-6C and anti-Ly-6G staining showed only Ly-6C expression and no Ly-6G expression on subsets of splenic T and B cells and thymocytes from Ly-6.1 and Ly-6.2 mice. Bone marrow cells were identified that express both Ly-6G and Ly-6C; no Ly-6G+Ly-6C populations were seen.

Conclusions

Multiple Ly-6C+ hematopoietic cell populations were identified that do not stain with anti-Ly-6G antibodies. This calls into question the use of the Ly-6G/C nomenclature and suggests that epitopes recognized by anti-Ly-6G antibodies should simply be designated Ly-6G. © 2004 Wiley-Liss, Inc.

The Ly-6 locus comprises a family of Ly-6 proteins in the mouse, including Ly-6C and Ly-6G. Ly-6C is a 131-amino acid phosphatidylinositol-linked murine cell surface protein that belongs to the Ly-6 gene family (1). Previous studies have shown that Ly-6C is expressed on subsets of T lymphocytes, thymocytes, activated B lymphocytes, and late myeloid/granulocytic precursors (2–6). The two alleles of Ly-6C, Ly-6C.1 and Ly-6C.2, result in differential expression of this protein on subpopulations of CD4+ T cells (4).

Ly-6G, another member of the Ly-6 family, is expressed on granulocytes, a subset of eosinophils, and transiently during developmental stages of monocytes (7–11). Its expression has been studied primarily using the monoclonal antibody (mAb) RB6-8C5 (anti Gr-1), but other monoclonal antibodies (mAbs) have also been developed against this antigen (Ag), including NIMPR-14 (9). Expression of Ly-6G has also recently been described on plasmacytoid dendritic cells (12, 13).

The RB6-8C5 mAb has previously been suggested to cross-react weakly with Ly-6Chi cells in murine bone marrow (BM) and with Ly-6C-transfected EL4J cells (8). This potential cross-reactivity of an anti-Ly-6G mAb with the Ly-6C Ag has been generalized to all hematopoietic cell types and now appears in the recent literature using the terminology Ly-6G/C (12, 14, 15).

Previous unpublished observations in our laboratory have failed to show evidence of anti-Ly-6G staining on Ly-6C+ T cells. To systematically examine the presence or absence of cross-reactivity of anti-Ly-6G mAbs with Ly-6C Ags, two-, three- and four-color flow cytometric analyses of Ly-6G and Ly-6C expression were performed on murine splenocytes, thymocytes, and BM cells using a variety of anti-Ly-6G and anti-Ly-6C mAbs.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

Mice

BALB/C, DBA/2, and C57Bl/6 (8–10-week-old) mice were obtained from Harlan Sprague-Dawley (Indianapolis, IN). All mice were maintained in the specific pathogen-free (SPF) facility at the University of Iowa.

Flow Cytometry Reagents

The following mAbs were used for flow cytometric analyses: 15.1.4.1 (hereafter referred to as 15.1), a rat IgG2a anti-mouse Ly-6C (16–18); 143-4-2 (hereafter referred to as 143), a mouse IgG1 anti-mouse Ly-6C.2 (19); 6C3, a rat IgG anti-mouse Ly-6C (20); RB6-8C5, a rat IgG2b anti-mouse Ly-6G (21); NIMPR-14, a rat IgG2b anti-mouse Ly-6G (9); GK1.5, a rat IgG2b anti-mouse CD4 (22); 53-6.72, a rat IgG2a anti-mouse CD8 (23); and 6B2, a rat IgG2a anti-mouse CD45R (B220) (24). These mAbs were prepared by ammonium sulfate precipitation from serum-free (HB101) culture supernatants. Polyclonal purified rat IgG (Jackson ImmunoResearch, West Grove, PA) was used for controls. The Abs were conjugated with fluorescein isothiocyanate (FITC), biotin, phycoerythrin (PE) (Molecular Probes, Eugene, OR), or cyanine 5.18 (Cy5; Amersham Pharmacia Biotech, Piscataway, NJ) using standard protocols. Wheat germ agglutinin (WGA) was purchased from Vector Laboratories (Burlingame, CA) and conjugated with Texas red (TR) using standard protocols. Biotinylated AL-21, a rat IgM anti-mouse Ly-6C, was purchased from Pharmingen, (San Diego, CA). PE-avidin was purchased from Southern Biotechnology Associates (Birmingham, AL). Texas red-avidin was purchased from Leinco Technologies (Ballwin, MO).

CpG ODN Treatment

To induce Ly-6C expression on B cells, BALB/c mice were injected i.p. with 500 μg of CpG ODN 1826 consisting of twenty bases containing two (underlined) CpG motifs (TCCATGACGTTCCTGACGTT) to induce Ly-6C expression. Splenocytes were examined 48 h post-treatment for Ly-6C and Ly-6G expression.

Flow Cytometric Analysis

Single-cell suspensions of freshly isolated BM, spleen, or thymus from C57Bl/6, DBA/2, or BALB/c mice were washed with balanced salt solution (BSS) and centrifuged through Fico-Lite-LM. Viable mononuclear cells were collected from the interface, washed in BSS, and resuspended in staining buffer containing 5% newborn calf serum (Hyclone Laboratories, Logan, UT) and 0.1% NaN3, in BSS. Staining was performed with 0.6 × 106 cells by incubating these cells for 20 min at 4°C with fluoresceinated, biotinylated, Cy5 conjugated, PE-conjugated, or TR-conjugated antibodies, followed by washing and another 20-min incubation at 4°C with the appropriate avidin reagent; 10 μl of anti-CD16/32 (FcγRIII/II) mAb 2.4G2 (25) and 10 μl of rat serum was added in the first incubation to eliminate background staining caused by nonspecific FcγR binding. The cells were analyzed on the FACS Vantage SE flow cytometer (Becton Dickinson) equipped with a primary argon laser and a rhodamine 6G CR595 dye head laser (Coherent, Palo Alto, CA). Dead cells were excluded by low-angle and orthogonal light scatter. At least 30,000 cells/sample were collected. Spectral overlaps between FITC and PE, and Cy5 and TR were corrected by electronic compensation. FACS data was collected and analyzed with a VAX station equipped with FlowJo software (TreeStar, Stanford, CA). Graphic output was carried out with Macintosh Canvas software (Deneba, Software, Miami, FL). Two-color contours are represented by 5% probability plots.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

CD8+ Splenocytes From Ly-6.1 and Ly-6.2 Strains of Mice Express Ly-6C But Not Ly-6G

To confirm expression patterns of Ly-6C and Ly-6G on resting CD8+ splenocytes, two-color flow cytometric studies were performed with anti-CD8 and one of several anti-Ly-6C or anti-Ly-6G mAbs. The anti-Ly-6C mAbs each bind to different epitopes on Ly-6C, as the presence of one of these mAbs does not inhibit staining with a second mAb (e.g., AL-21 does not inhibit staining of Ly-6C molecules with 15.1). The same is true for NIMPR-14 and RB6-8C5 staining of Ly-6G (unpublished observations). As shown in Figure 1A, resting CD8+ splenocytes from BALB/c (Ly-6.1) mice strongly express epitopes of Ly-6C (15.1, AL-21, and 6C3). However, no expression of Ly-6G (RB6-8C5 and NIMPR-14) was identified within the CD8+ population. Since Ly-6C and Ly-6G Abs were placed in separate tubes in these experiments, there was no possibility of an anti-Ly-6C mAb blocking the binding of an anti-Ly-6G mAb or vice versa.

thumbnail image

Figure 1. CD8+ splenocytes from BALB/c (Ly-6.1) and C57Bl/6 (Ly-6.2) mice express high levels of Ly-6C but do not express Ly-6G. A: BALB/c splenocytes were stained for expression of CD8, and either Ly-6C or Ly-6G (biotinylated monoclonal antibodies (mAbs) followed by phycoerythrin [PE]-avidin) using several different mAbs. CD8+ splenocytes were gated and analyzed for Ly-6C expression (15.1, AL-21, 6C3), or for Ly-6G expression (RB6-8C5, NIMPR-14). B: C57Bl/6 splenocytes were stained as described in A: An additional mAb (143), specific for the Ly-6C.2 allele, was included in the panel.

Download figure to PowerPoint

CD8+ splenocytes from C57Bl/6 (Ly-6.2) mice were stained similarly. In this case, a mAb specific for the Ly-6C.2 allele (143) was included. No similar mAb is available for the Ly-6C.1 allele. As shown in Figure 1B, CD8+ splenocytes from these mice also expressed epitopes of Ly-6C, and no expression of Ly-6G was noted. Similar results were seen using DBA/2 mice, another Ly-6.2 strain (data not shown).

It is possible that the presence of mAbs specific for Ly-6C might result in alteration of the three-dimensional structure of the Ly-6C molecule, exposing cryptic epitopes that are recognized by anti-Ly-6G mAbs. The anti-Ly-6G mAbs would then appear to be cross-reactive with the Ly-6C Ag. To determine whether this was the case, mAbs specific for Ly-6C and Ly-6G were used to stain splenocytes simultaneously with anti-CD8 in three-color flow cytometric assays. Figure 2 demonstrates that under these conditions, a fraction of CD8+ splenocytes from BALB/c (Ly-6.1) and C57Bl/6 (Ly-6.2) mice express Ly-6C, but none show any evidence of a shift towards positivity with anti-Ly-6G mAbs. These results were confirmed in another Ly-6.2 strain of mice, DBA/2 (data not shown).

thumbnail image

Figure 2. CD8+ splenocytes from BALB/c (Ly6.1) and C57Bl/6 (Ly6.2) mice express moderate to high levels of Ly-6C, but not Ly-6G. A: Splenocytes from BALB/c mice were stained for expression of CD8, Ly-6C, and Ly-6G in a three-color protocol using various combinations of mAbs specific for Ly-6C and Ly-6G. CD8+ splenocytes were gated and analyzed for Ly-6C (15.1, AL-21, 6C3) and Ly-6G (RB6-8C5, NIMPR-14) expression. The fluorochrome-Ab conjugates used are indicated on the plot axes. Bio/TR = biotinylated Ab followed by TR avidin; Bio/phycoerythrin (PE) = biotinylated Ab followed by PE avidin. B: C57Bl/6 splenocytes were stained as described in A: An additional monoclonal antibody (mAb) (143), specific for the Ly-6C.2 allele, was included in the panel.

Download figure to PowerPoint

Ly-6C.2 CD4+ Splenocytes Express Ly-6C But Do Not Express Ly-6G

CD4+ splenocytes from Ly-6C.2 mice express low levels of Ly-6C (4). This population was also studied by two- and three-color flow cytometric analysis in two Ly-6.2 strains (C57Bl/6 and DBA/2) for evidence of staining with anti-Ly-6G mAbs. As in the CD8+ splenocyte populations, no Ly-6G staining was identified on Ly-6C+CD4+ cells from C57Bl/6 mice in three-color analyses (Fig. 3) or when anti-Ly-6G and anti-Ly-6C mAbs were used to stain CD4+ splenocytes independently in two-color analyses (data not shown). The Ly-6C.2 allele-specific mAb (143) was not used in these studies, as it has previously been shown not to bind to CD4+ Ly-6C+ splenocytes (4). Studies in DBA/2 mice confirmed the findings in C57Bl/6 mice (data not shown). CD4+ splenocytes from Ly-6C.1 mice fail to stain with anti-Ly-6C or anti-Ly-6G (4) (data not shown).

thumbnail image

Figure 3. CD4+ splenocytes from C57Bl/6 (Ly6.2) mice express Ly-6C, but not Ly-6G. Splenocytes were stained for expression of CD4, Ly-6C, and Ly-6G in a three-color protocol using various combinations of monoclonal antibodies (mAbs) specific for Ly-6C and Ly-6G. CD4+ splenocytes were gated and analyzed for Ly-6C (15.1, AL-21, 6C3) and Ly-6G (RB6-8C5, NIMPR-14) expression. Fluorochrome/mAb conjugates used were RB6-8C5 phycoerythrin (PE) and NIMPR-14 FITC. All Ly-6C mAbs were Cy5 conjugates.

Download figure to PowerPoint

CD8+CD4 (CD8 SP) and CD4CD8 (DN) Thymocytes Express Ly-6C But Do Not Express Ly-6G

Several thymocyte populations have previously been demonstrated to express Ly-6C in both Ly-6.1 and Ly-6.2 strains of mice (3, 4). To determine whether these populations also stained with anti-Ly-6G antibodies, four-color flow cytometric analyses were performed on thymocytes from BALB/c (Ly-6.1) mice. Each tube contained anti-CD4 and anti-CD8 to identify the four major subsets of thymocytes, as well as anti-Ly-6C and anti-Ly-6G mAbs or the relevant isotype controls. The CD8 SP and DN thymocyte subsets contain the highest frequencies of cells expressing Ly-6C, therefore these populations were gated and studied for the ability to simultaneously stain with anti-Ly-6C and anti-Ly-6G mAbs. As shown in Figure 4, the Ly-6C+ populations showed no staining with anti-Ly-6G mAbs, consistent with the findings on splenic Ly-6C+ populations. Similar results were seen with CD4+CD8 (CD4 SP), CD8 SP, and DN thymocyte populations from Ly-6C.2 strains of mice (data not shown).

thumbnail image

Figure 4. CD4 SP and DN thymocytes from BALB/c (Ly6.1) mice express Ly-6C, but not Ly-6G. Thymocytes were stained for expression of CD4, CD8, Ly-6G and Ly-6C in a four-color protocol using various combinations of monoclonal antibodies (mAbs) specific for Ly-6C and Ly-6G. CD4 SP and DN thymocytes were gated and analyzed for Ly-6C (15.1, AL-21, 6C3) and Ly-6G (RB6-8C5, NIMPR-14) expression. The fluorochrome-Ab conjugates used are indicated on the plot axes. Bio/TR = biotinylated Ab followed by TR avidin.

Download figure to PowerPoint

Activated B Cells Express Ly-6C But Do Not Express Ly-6G

Resting B cells do not express Ly-6C but, when activated with CpG ODN, they are capable of expressing this molecule (5). To determine whether activated B lymphocytes also stain with anti-Ly6G mAbs, two-color flow cytometric studies were conducted on CpG ODN-activated BALB/c (Ly-6.1) B cells. As shown in Figure 5, activated B220+ splenocytes showed expression of Ly-6C but, again, no Ly-6G positivity was noted on these cells. Similar findings were observed on activated B cells from Ly-6.2 strains of mice (data not shown).

thumbnail image

Figure 5. CpG ODN activated B220+ splenocytes from BALB/c (Ly6.1) mice express Ly-6C, but not Ly-6G. Splenocytes from mice treated 48 h previously with CpG ODN 1826 were stained for expression of B220 and either Ly-6C or Ly-6G using several different monoclonal antibodies (mAbs). All Ly-6C and Ly-6G mAbs used in this experiment were biotinylated, followed by TR-avidin. B220+ splenocytes were gated and analyzed for Ly-6C expression (15.1, AL-21, 6C3) and Ly-6G expression (RB6-8C5, NIMPR-14).

Download figure to PowerPoint

BM Subsets Expressing Ly-6C and Ly-6G

To determine whether Ly-6C+ cells in BM express Ly-6G, and to establish that the anti-Ly-6G mAbs used to stain splenocytes and thymocytes were functional, two-color flow cytometric analyses were conducted on BM from C57Bl/6 (Ly-6.2) mice using various combinations of anti-Ly-6C and anti-Ly-6G mAbs. As shown in Figure 6, two major BM populations exist that express Ly-6C and/or Ly-6G. One population expresses moderate levels of Ly-6C and is also positive for Ly-6G, while the other subset expresses high levels of Ly-6C. The Ly-6Chi population shows no increased staining with anti-Ly-6G mAbs over the isotype control (shown in the first column of plots in Fig. 6) with most of the anti-Ly-6G/anti-Ly-6C mAb combinations utilized. In a few cases (e.g., AL-21 vs. NIMPR-14 plot) a slight shift towards Ly-6G positivity is seen in the Ly-6Chi population. No Ly-6GLy-6Cpopulation is identified in murine BM. Similar findings were observed in BM from Ly-6.1 (BALB/c) mice (data not shown).

thumbnail image

Figure 6. Bone marrow subsets from C57Bl/6 (Ly6.2) mice express Ly-6C and Ly-6G. Bone marrow cells were stained for expression of Ly-6C and Ly-6G in a two-color protocol using various combinations of monoclonal antibodies (mAbs) specific for Ly-6C (15.1, AL-21, 6C3, 143) and Ly-6G (RB6-8C5, NIMPR-14). The fluorochrome-Ab conjugates used are indicated on the plot axes. Bio/phycoerythrin (PE) = biotinylated Ab followed by PE. Each row of contour plots was obtained from staining on the same BM preparation. The numbers in the upper right corner of the contour plots indicate the fraction of Ly-6C+ cells that are negative or positive for staining with the Ly-6G mAb, respectively.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED

Ly-6 molecules comprise a family of low-molecular-weight phosphatidylinositol anchored cell surface glycoproteins (26, 27). Genes for the Ly-6 proteins in mice are found on chromosome 15 (28). Many Ly-6 molecules, including Ly-6C and Ly-6G, possess conserved domains containing cysteine residues. However, heterogeneity between Ly-6C and Ly-6G is observed in the cysteine spacing within these domains, imparting structural differences between these molecules (26). Amino acid sequencing shows Ly-6G and Ly-6C differ by at least 27 amino acids (29). The extent of homology between Ly-6 molecules has been quantitated using optical alignment techniques. Ly-6G and Ly-6C amino acid sequences have optical alignment standard deviations of 27.1, much greater than the three standard deviations necessary to regard a statistical difference in structure (26). Therefore, it is likely that Ly-6G and Ly-6C exhibit enough structural differences to possess unique epitopes.

A previous study suggested that the mAb RB6-8C5, specific for the Ly-6G Ag, weakly stains Ly-6Chi cells in BM (8). This has been interpreted as cross-reactivity of the RB6-8C5 mAb with the Ly-6C Ag. Perhaps because of this report, the molecule to which RB6-8C5 binds has been called Ly-6G/C, and this terminology has been perpetuated in the recent literature (12, 14, 15).

The two-, three-, and four-color flow cytometric experiments reported herein indicate that mAbs specific for Ly-6G, including RB6-8C5, do not show any binding to many cell populations that express moderate to high levels of Ly-6C. These Ly-6C+ cell populations, which are Ly-6G, include CD8+ splenocytes, CD8 SP and DN thymocytes, and CpG ODN-activated B cells in both Ly-6.1 and Ly-6.2 strains, as well as CD4+ splenocytes and CD4 SP thymocytes in Ly-6.2 strains. The lack of cross-reactivity was demonstrated using a variety of anti-Ly-6C and anti-Ly-6G mAbs, including an Ly-6C.2 allele-specific mAb (143).

Two BM populations were identified that stain with Ly-6C (Fig. 6). One of these is clearly also positive for Ly-6G. The other population (Ly-6Chi) shows slight positivity with anti-Ly-6G mAbs with certain anti-Ly-6C and anti-Ly-6G fluorochrome combinations. This population is comprised of macrophage and dendritic cell precursors (unpublished observations), and cells of the monocytic lineage have previously been reported to express low levels of Ly-6G (10, 11). Thus, this slight shift could represent detection of true, low-level Ly-6G expression on this population that is apparent with certain fluorochrome-mAb conjugates. It is also formally possible that the observed shift could be the result of anti-Ly-6G cross-reactivity with Ly-6C epitopes expressed on this cell population; however, this explanation is unlikely based on the complete lack of anti-Ly-6G/C cross-reactivity observed in other Ly-6C+ hematopoietic cell types. Alternatively, it is possible that an isoform of Ly-6C is expressed on these cells that is not found on T or B cells, and this particular isoform allows cross-reactivity with the anti-Ly-6G mAbs. To date, there is no published information indicating the presence of more than one Ly-6C gene, or evidence for multiple pathways of post-transcriptional or post-translational modification of the Ly-6C gene product. Therefore, in light of the lack of staining of many other Ly-6C+ populations with anti-Ly-6G, it is likely that the BM cells which stain with anti-Ly-6G mAbs actually express Ly-6G and Ly-6C as independent molecules.

An additional cell population has recently been identified that stains with both Ly-6C and Ly-6G mAbs (12, 13). These cells, termed plasmacytoid dendritic cells, comprise a rare population found in many hematopoietic tissues, including spleen and lymph node. The experiments in this study do not address Ly-6C and Ly-6G expression on this population; however, the same arguments hold for these dual staining populations as for the BM populations that stain with both anti-Ly-6C and anti-Ly-6G mAbs.

In conclusion, no evidence for cross-reactivity between Ly-6C and Ly-6G is identified on B or T cells from Ly-6C.1 and Ly-6C.2 strains of mice. Previously published molecular data also indicate that two separate genes with quite different amino acid sequences exist for these molecules, supporting the existence of unique epitopes on the two molecules. Taken together, these results question the use of the Ly-6G/C nomenclature, and suggest that epitopes recognized by anti-Ly-6G Abs should simply be designated as Ly-6G.

LITERATURE CITED

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. LITERATURE CITED
  • 1
    Rock KL, Reiser H, Bamezai A, McGrew J, Benacerraf B. The LY-6 locus: a multigene family encoding phosphatidylinositol-anchored membrane proteins concerned with T-cell activation. Immunol Rev 1989; 111: 195224.
  • 2
    Fichtner AT, Anderson S, Mage MG, Sharrow S, Thomas IIICA, Kung JT. Subpopulations of mouse Lyt-2+ T cells defined by the expression of an Ly-6-linked antigen, B4B2. J Immunol 1987; 138: 20242033.
  • 3
    Takahama Y, Sharrow SO, Singer A. Expression of an unusual T cell receptor (TCR)-Vβ repertoire by Ly-6C+ subpopulations of CD4+ and/or CD8+ thymocytes. Evidence for a developmental relationship between Ly-6C+ thymocytes and CD4-CD8-TCR-αβ + thymocytes. J Immunol 1991; 147: 28832891.
  • 4
    Schlueter AJ, Malek TR, Hostetler CN, Smith PA, de Vries P, Waldschmidt TJ. The distribution of Ly6C on lymphocyte subsets. I. Influence of allotype on T lymphocyte expression. J Immunol 1997; 158: 42114222.
  • 5
    Schlueter AJ. B cells express Ly-6C in a Th1 but not Th2 cytokine environment. J Interferon Cytokine Res 2002; 22: 799806.
  • 6
    Jutila MA, Kroese FGM, Jutila KL, Stall AM, Fiering S, Herzenberg LA, Berg EL, Butcher EC. Ly-6C is a monocyte/macrophage and endothelial cell differentiation antigen regulated by interferon-gamma. Eur J Immunol 1988; 18: 18191826.
  • 7
    Hestdal K, Ruscetti FW, Ihle JN, Jacobsen SEW, Dubois CM, Kopp WC, Longo DL, Keller JR. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol 1991; 147: 2228.
  • 8
    Fleming TJ, Fleming ML, Malek TR. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to granulocyte-differentiation antigen (GR-1) detects members of the Ly-6 family. J Immunol 1993; 151: 23992408.
  • 9
    Lopez A. Differentiation antigens on mouse eosinophils and neutrophils identified by monoclonal antibodies. Br J Haematol 1984; 57: 489494.
  • 10
    Lagasse E, Weissman IL. Flow cytometric identification of murine neutrophils and monocytes. J Immunol Methods 1996; 197: 139150.
  • 11
    Biermann H, Pietz B, Dreier R, Schmid KW, Sorg C, Sunderkotter C. Murine leukocytes with ring-shaped nuclei include granulocytes, monocytes, and their precursors. J Leukoc Biol 1999; 65: 217231.
  • 12
    Paturel C. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immun 2001; 2: 11441150.
  • 13
    Martin P, Martinez del Hoyo G, Anjuere F, Arias CF, Vargas HH, Fernandez LA, Parrillas V, Ardavin C. Characterization of a new subpopulation of mouse CD8α+B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential. Blood 2002; 100: 383390.
  • 14
    Shortman K. Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002; 2: 151161.
  • 15
    Ferrero I. Mouse CD11c+ B220+ Gr1+ plasmacytoid dendritic cells develop independently of the T-cell lineage. Blood 2002; 100: 28522857.
  • 16
    de Vries P, Brasel KA, Eisenman JR, Alpert AR, Williams DE. The effect of recombinant mast cell growth factor on purified murine hematopoietic stem cells. J Exp Med 1991; 173: 12051211.
  • 17
    Visser JWM, de Vries P. Identification and purification of murine hematopoietic stem cells by flow cytometry. Methods Cell Biol 1990; 33: 451468.
  • 18
    Visser JWM, de Vries P. Analysis and sorting of hematopoietic stem cells from mouse bone marrow. Methods Cell Biol 1994; 42: 243261.
  • 19
    Leo O, Foo M, Segal DM, Shevach E, Bluestone JA. Activation of murine T lymphocytes with monoclonal antibodies: detection on Lyt-2+ cells of an antigen not associated with the T cell receptor complex but involved in T cell activation. J Immunol 1987; 139: 12141222.
  • 20
    Dumont FJ, Coker LZ, Habbersett RC, Treffinger JA. Xenogeneic monoclonal antibody to an Ly-6-linked murine cell surface antigen: differential reactivity with T cell subpopulations and bone marrow cells. J Immunol 1985; 134: 23572365.
  • 21
    Davidson WF, Fredrickson TN, Rudikoff EK, Coffman RL, Hartley JW, Morse HC III. A unique series of lymphomas related to the Ly-1+ lineage of B lymphocyte differentiation. J Immunol 1984; 133: 744753.
  • 22
    Dialynas DP, Quan ZS, Wall KA, Pierres A, Quintans J, Loken MR, Pierres M, Fitch FW. Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: similarity of L3T4 to the human Leu-3/T4 molecule. J Immunol 1983; 131: 24452451.
  • 23
    Ledbetter JA, Herzenberg LA. Xenogeneic monoclonal antibodies to mouse differentiation antigens. Immunol Rev 1979; 47: 6390.
  • 24
    Morse HC, Davidson WF, Yetter RA, Coffman RL. A cell-surface antigen shared by B cells and Ly2+ peripheral T cells. Cell Immunol 1982; 70: 311320.
  • 25
    Unkeless JC. Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J Exp Med 1979; 150: 580596.
  • 26
    Gumley TP. Tissue expression, structure and function of the murine Ly-6 family of molecules. Immunol Cell Biol 1995; 73: 277296.
  • 27
    Shevach EM, Korty PE. Ly-6: a multigene family in search of a function. Immunol Today 1989; 10: 195200.
  • 28
    LeClair KP, Rabin M, Nesbitt MN, Pravtcheva D, Ruddle FH, Palfree RGE, Bothwell A. Murine Ly-6 multigene family is located on chromosome 15. Proc Natl Acad Sci USA 1987; 84: 16381643.
  • 29
    Palfree RGE. Ly-6-domain proteins—new insights and new members: a C-terminal Ly-6 domain in sperm acrosomal protein SP10. Tissue Antigens 1996; 48: 7179.