SEARCH

SEARCH BY CITATION

Keywords:

  • syntenin-2;
  • PDZ;
  • PIP2;
  • nucleus;
  • fluorescence correlation spectroscopy;
  • fluorescence cross-correlation spectroscopy;
  • fluorescence recovery after photobleaching

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information

Cellular signaling is largely dependent on the presence, that is, assembly/disassembly, of supramolecular complexes. Postsynaptic density protein, Discs-large, Zona occludens (PDZ) domains play important roles in the assembly of various signaling complexes. Syntenin-2 (S2) is a PDZ protein that interacts with nuclear phosphatidylinositol 4,5-bisphosphate (PIP2). Although nuclear lipids emerge as key players in nuclear processes, the global significance of nuclear phosphoinositide-protein interactions is still poorly understood. Those phosphoinositide-protein interactions that have been studied in detail appear to have profound physiological effects. To our knowledge none of these were investigated by dynamic studies such as Fluorescence Correlation Spectroscopy (FCS), Fluorescence Cross-Correlation Spectroscopy (FCCS), or Fluorescence Recovery After Photobleaching (FRAP). Although the exact function of S2 is unknown, siRNA experiments suggest that this PDZ protein plays a role in the organization of nuclear PIP2, cell division, and cell survival. As a consequence of its PIP2 interaction, its reported self-association in a yeast two-hybrid study and its speculated interaction with many, yet unidentified, proteins one can hypothesize that S2 plays an important role in cell signaling. Therefore, we studied the dynamics of S2 using FCS, FCCS, and FRAP, utilizing an active truncated form deleted for the first 94 amino acids (S2-ΔN). We showed that S2-ΔN self-associates and is distributed in three groups. One immobile group, one slow diffusing group, which interacts with the nuclear environment and one fast diffusing group, which is not incorporated in high molecular weight complexes. In addition, our FCS and FRAP measurements on S2-ΔN mutants affected in their PIP2 binding showed that PIP2 plays an important role in the distribution of S2-ΔN among these groups, and favors the enrichment of S2-ΔN in the slow diffusing and immobile group. This work indicates that S2 relies on nuclear PIP2 to interact with practically immobile structures, possibly chromatin. © 2013 International Society for Advancement of Cytometry

Cellular signaling is largely dependent on the presence, that is, assembly/disassembly, of supramolecular complexes. In the dynamic process of (re)arranging multimeric protein complexes, the actions of a broad variety of protein modules are crucial. PDZ domains are among the most common protein domains and are present in organisms as diverse as bacteria, yeast, plants, invertebrates, and vertebrates [1]. Their name refers to the first three proteins in which they were originally identified (PSD-95/SAP90, Discs-large and Zona occludens 1) [2].

In the canonical mode PDZ domains recognize motifs of 3–7 amino acids that are present at the C-terminal end of membrane proteins [3]. In 2005 it was shown that the PDZ domains of syntenin-2 (S2) bind phosphatidylinositol 4,5-bisphosphate (PIP2) in surface plasmon resonance experiments with reconstituted liposomes [4]. The PIP2 concentrates at the plasma membrane, in nuclear speckles and nucleoli [5]. Nuclear speckles are dynamic punctuate subnuclear structures localized in the interchromatin regions of the nucleoplasm and enriched in pre-messenger RNA splicing factors [6]. Endogenous S2 is present in the nucleoplasm, nucleoli, and at the plasma membrane of paraformaldehyde fixed MCF-7 cells. Surprisingly, when fused to eGFP or Myc, overexpressed full length S2 is only present in the cytoplasm and excluded from the nucleus, whereas nontagged overexpressed full length S2 was detected with anti-S2 antibodies in the nucleus of MCF-7 cells. This indicated that tagging full length S2 interferes with its nuclear localization and that this interference is independent on the type of the tag. Interestingly, it was shown that the tandem of PDZ domains is necessary and sufficient to target S2 to the plasma membrane and subnuclear structures. Consequently, S2 deleted for the first 94 amino acids (S2-ΔN) is present in the nucleoplasm, nucleoli, and at the plasma membrane of living MCF-7 cells similar to endogenous S2 [4]. Additionally, in paraformaldehyde fixed cells, overexpressed eGFP-S2-ΔN is clearly enriched in nuclear speckles but anti-S2 antibodies fail to detect overexpressed eGFP-S2-ΔN in these nuclear compartments [4].

Although the exact function of S2 is unknown, siRNA experiments suggest that this PDZ protein plays a role in the organization of nuclear PIP2, cell division, and cell survival [4]. As a consequence of its PIP2 interaction, its reported self-association in a yeast two-hybrid study and its speculated interaction with many, yet unidentified, proteins one can hypothesize that S2 plays an important role in cell signaling. Using Fluorescence Correlation Spectroscopy (FCS) and Fluorescence Recovery After Photobleaching (FRAP), we studied the diffusion of S2-ΔN and S2-ΔN mutants affected in their PIP2 binding to characterize the influence of PIP2 on the nuclear binding behavior of S2 in living cells, for example, its presence in high molecular weight complexes, its long term binding or free diffusion.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information

Plasmids

For the expression of eYFP in MCF-7 cells, we used a peYFP-C1 construct (Clontech, Laboratories, Mountain View, CA, VS). eGFP-S2-ΔN, eGFP-S2-ΔN-δ1,2, eYFP-S2-ΔN, eYFP-S2-ΔN-δ1, eYFP-S2-ΔN-δ2, and eYFP-S2-ΔN-δ1,2 were constructed as earlier described [4]. To construct mCherry-S2-ΔN, S2-ΔN was cut from eGFP-S2-ΔN and ligated in mCherry using BsrGI and BamHI as restriction enzymes. To construct mCherry-S2-ΔN-δ1,2, S2-ΔN-δ1,2 was cut from eYFP-S2-ΔN-δ1,2 and ligated in mCherry-S2-ΔN using BamHI and EcoRI as restriction enzymes and replacing S2-ΔN. SC35 was obtained from ImaGenes (Image ID 5296371; Source BioScience, Nottingham, UK) and PCR-amplified using primers: sense: GGAAGGCAACTGCCTGAATTCGAGAGG and antisense: GTCTCGGATCCTTCCCAGACATTACC (engineered EcoRI and BamHI sites underlined). SC35 was ligated downstream and in frame with mCherry in mCherry-S2-ΔN using EcoRI and BamHI as restriction sites replacing S2-ΔN. SF3b155 was a kind gift from Dr. M. S. Schmidt-Zachmann (German Cancer Research Center, Heidelberg, Germany) and PCR-amplified using primers: GGTAAGCCCGGGTCTAAA CGCAAACGTAGATGGGATC sense: and GAACGCTCTAGAACCTCCCTATGGTGTTGGAG TTGC antisense: (engineered SmaI and XbaI sites are underlined). Amino acids 194 to 440 of SF3b155 were ligated downstream of mCherry in mCherry-S2-ΔN replacing S2-ΔN. eGFP-mCherry and mCherry-ASF/SF2 were a kind gift from Dr. J. Hendrix (K.U. Leuven, Leuven, Belgium).

Cell Culture and Transient Transfection Assays

MCF-7 cells were cultured in Dulbecco's Modified Eagle medium high glucose (D-MEM) without phenol red (Gibco BRL, Belgium) and supplemented with 10% fetal bovine serum (Sigma-Aldrich gmbh, Taufkrichen, Germany) and GlutaMax-I (Gibco). Cells were transfected using Lipofectamine 2000 (Invitrogen™, Belgium) according to manufacturer's guidelines. To inhibit specifically RNA polymerase II MCF-7 cells were incubated for 6 hours with 5 μg/mL α-amanitin (Roche, Belgium) at 37°C. To stimulate PLC activity in MCF-7 cells 100 μM m-3M3 FBS (Sigma-Aldrich, Bornem, Belgium) was added. FCS measurements were started 1 hour after adding m-3M3 FBS and ended when the MCF-7 cells were incubated with m-3M3 FBS for 2 hours. Before confocal imaging, FRAP or FCS measurements, the medium was changed to DMEM without phenol red and supplemented with 25 mM Hepes buffer (Gibco). For in vivo measurements, MCF-7 cells were kept at 37°C using a home-made heating stage and an objective heater (Bioptechs, Butler, PA, VS).

Paraformaldehyde Fixation

MCF-7 cells were rinsed with PBS buffer (Gibco) and fixed with paraformaldehyde (Formalin Solution, neutral buffered 10%, Sigma-Aldrich) at room temperature for 20 min. After fixation the cells were washed three times using PBS. To avoid artifacts caused by different batches of MCF-7 cells, cells measured for in vivo fluorescence imaging were afterward used for paraformaldehyde fixation.

Fluorescence Microscopy and Fluorescence Recovery After Photobleaching Experiments

Fluorescence microscopy and FRAP measurements were performed on a LSM510 ConfoCor2 microscope system (Carl Zeiss, Jena, Germany) using the 488 nm line of the argon-ion laser to excite eGFP and eYFP and the 543 nm line of the HeNe laser to excite mCherry. The fluorescence was collected with a 40x/1,2 Plan-Apochromat water immersion objective. The fluorescence emission light passed through a 505–530 nm bandpass filter for eGFP and eYFP fluorescence and a 565–615 nm bandpass filter for mCherry fluorescence.

In each FRAP experiment the recovery of fluorescence was recorded in a region of interest in the nucleoplasm or nucleoli and background subtracted by the fluorescence recorded in a region outside the cell. The fluorescence from the reference spot positioned at a similar nuclear environment in the same cell, was used to account for acquisition bleaching. Each FRAP measurement was started by 10 images by 3% AOTF of 16.5 mW at 488 nm before bleaching. Afterward, a bleaching period of ∼66 ms on a circular spot with radius of 10 pixels (∼0.90 μm) was performed by 100% AOTF of 16.5 mW at 488 nm. The complete FRAP measurement was composed of 200 image frames with intervals of 100 ms for eYFP-S2-ΔN, eYFP-S2-ΔN-δ1, eYFP-S2-ΔN-δ2, and eYFP-S2-ΔN-δ1,2 in the nucleoplasm and with intervals of 200ms for eYFP-S2, eYFP-S2-ΔN-δ1, and eYFP-S2-ΔN-δ2 in nucleoli. The average fluorescence intensity in the bleaching spot was normalized before analyzing according to

  • display math

with inline image and inline image the background-subtracted intensities in respectively the bleach and reference spot and < inline image> and < inline image> the average of the background-subtracted intensities before bleaching in, respectively, the bleach and reference spots. Analysis of fluorescence recovery in the nucleus was done according to a diffusion model based on a circular bleaching profile [7].

Fluorescence Correlation Spectroscopy and Fluorescence Cross-Correlation Spectroscopy Experiments

FCS and FCCS measurements were performed essentially as described in [8] on a LSM510 ConfoCor2 microscope system (Carl Zeiss, Jena, Germany).

In brief, in FCS eYFP was excited using the 488 nm line of argon-ion laser and the emission light was filtered by a 505–550 bandpass filter. The fluctuation data were correlated over 15s and 15 data sets in one specific region of one MCF-7 cell. Only cells with low to medium expression level were chosen on average 20 cells were measured under one condition. The autocorrelation function (ACF) was imported into Igor Pro 5 (Wavemetrics, Lake Oswego, OR, VS) and analyzed by means of global analysis.

When the molecular detection function is approximated by a Gaussian in axial and lateral directions, and the medium is homogeneous, the ACF can be described by an analytical model. The overall autocorrelation curve contains two factors, a first factor describing fluctuations during the residence time of the molecule in the detected volume due to photophysical phenomena (GT), and a factor due to diffusion (GD):

  • display math

The fast fluctuation term is described as a sum of exponentials:

  • display math

With Fx and τx the fraction and time of the fast process and n the number of processes. These fast processes are not relevant for our analysis.

The different models used to fit the diffusion behavior have the following general forms:

  • display math
  • display math
  • display math

inline image describes the autocorrelation at slower timescale, representing diffusion; inline image the average number of particles in the confocal volume element, inline image the correlation time; inline image the diffusion time; S is the structure parameter, that is, inline image with inline image and inline image, respectively, the radial and axial radii of the confocal volume element, which are determined by a calibration with Rhodamine 6G [D = 635 μm2/s for diffusion at 37°C in water as recalculated from its diffusion coefficient of 426 μm2/s at room temperature [12]] and are fixed throughout the fitting routine; inline image and inline image the fractions of molecules diffusing with diffusion times inline image and inline image, respectively; inline image the anomaly factor, which is equal to 1 for free (Brownian) diffusion and smaller than 1 for restricted diffusion. Two-component diffusion describes the heterogeneity of the species, whereas anomalous diffusion is a general way to take into account the heterogeneity of the medium (see discussion) and is often used to describe diffusion in the living cell [13].

In FCCS eGFP was used as a fluorescent tag instead of eYFP to minimize bleeding through. eGFP was excited with the 488 nm line of argon-ion and mCherry with the 543 nm line of HeNe. The emission light was filtered by two filter sets (500–530 nm bandpass and 600–650 nm bandpass). Collection and analysis procedures are similar to the FCS measurements. The cross-correlation function was normalized to the green ACF.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information

S2-ΔN Subnuclear Localization in Living Cells

S2, by virtue of its PDZ domains, localizes at three PIP2 rich cellular locations in paraformaldehyde fixed MCF-7 cells, that is, the plasma membrane, nucleoli and nuclear speckles [4, 5]. Unfortunately, anti-S2 antibodies fail to detect overexpressed eGFP-S2-ΔN in nuclear speckles [4]. Here, we investigated the nuclear localization of S2-ΔN in living cells. Therefore, we fused S2-ΔN N-terminally with eGFP (eGFP-S2-ΔN). Nuclear speckles were identified in living cells using three different speckle markers fused with mCherry, that is, mCherry-SC35, mCherry-ASF/SF2, and mCherry-ΔSF3b155 [14] (Fig. 1A, Supporting Information Figs. S1A and S2A). First, the functionality of these nuclear speckle markers was tested using α-amanitin. This RNA polymerase II inhibitor causes the nuclear speckles to increase in size and change their shape after incubation with 5 μg/ml for 6 hours at 37°C [6, 15]. In agreement, all three nuclear speckle markers showed such behavior (Fig. 1D, Supporting Information Figs. S1D and S2D). When cotransfecting eGFP-S2-ΔN with mCherry-SC35, mCherry-ASF/SF2 or mCherry-ΔSF3b155, we found that eGFP-S2-ΔN concentration was lower in the nuclear speckles than in the nucleoplasm (Figs. 1A–1C, Supporting Information Figs. S1A–S1C and S2A–S2C). Moreover, after adding α-amanitin, the distribution pattern of eGFP-S2-ΔN did not change (Figs. 1D–1F, Supporting Information Figs. S1D–S1F, and S2D–S2F). Interestingly, when these cells were fixed using paraformaldehyde, eGFP-S2-ΔN was translocated to the nuclear speckles in both non-treated as α-amanitin treated cells (Figs. 1G–1L, Supporting Information Figs. S1G–S1L and S2G–S2L), indicating that this translocation is fixation dependent.

image

Figure 1. S2-ΔN is not enriched in nuclear speckles in living cells. (AC) Confocal fluorescence micrographs of living MCF-7 cells overexpressing mCherry-SC35 (A) with eGFP-S2-ΔN (syntenin-2 deleted for the first 94 amino acids) (B). In the merge (C) SC35 is in red and S2-ΔN is in green. Note that eGFP-S2-ΔN is not enriched in nuclear speckles in living cells. (D-F) Confocal fluorescence micrographs of living MCF-7 cells as described in (A-C) but after incubation for 6 hours with 5 μg/ml of α-amanitin. Note that the inhibition of transcription by α-amanitin affects the shape of nuclear speckles (compare A to D) and that eGFP-S2-ΔN is not recruited to nuclear speckles after α-amanitin treatment. (G-I) Confocal fluorescence micrographs of MCF-7 cells as described in (A-C) after paraformaldehyde fixation. Note the clear enrichment of eGFP-S2-ΔN in nuclear speckles after fixation. (J-L) Confocal fluorescence micrographs of MCF-7 cells as described in (D-F) after paraformaldehyde fixation. Note again the change in shape of nuclear speckles after α-amanitin treatment (compare J with G). Note eGFP-S2-ΔN enrichment in nuclear speckles. Scale bars 10 μm.

Download figure to PowerPoint

Dynamics of eYFP-S2-ΔN in the Nucleoplasm

Knowing the exact nuclear localization of S2-ΔN in living cells, we studied the mobility of eYFP-S2-ΔN in the nucleoplasm of MCF-7 cells. FCS is particularly suited to measure diffusion of proteins in living cells as it is a noninvasive technique, which can be used to measure the mobility and interactions of proteins inside a living functional cell at spatial and temporal scales [16, 17]. However, FCS in a living cell is subject to many sources of potential artefacts, as extensively described by Enderlein et al. [18]. By controlling as many optical parameters as possible and by measuring at a low penetration depth their impact on the diffusion coefficients from the ACF can be minimized [18, 19].

We compared the FCS measurements of eYFP-S2-ΔN with those of eYFP in different spots in the nucleoplasm (Fig. 2). The ACFs of eYFP-S2-ΔN and eYFP could best be fitted with the two-component diffusion model (Supporting Information Figs. S3A–S3B), which defines the existence of one component with a high and one with a low diffusion coefficient. From the fit, the diffusion coefficients together with the percentage of each component were calculated (Table 1). For eYFP, the slow component contributed only 3 ± 3 %.

image

Figure 2. S2-ΔN fusion slows down the diffusion of eYFP in the nucleoplasm and in nucleoli. Normalized autocorrelation curves obtained from FCS measurements in the nucleoplasm and nucleoli of MCF-7 cells overexpressing different constructs as indicated. Note the important shift to longer timescale of eYFP-S2-ΔN compared with eYFP in the nucleoplasm. Additionally, note that eYFP-S2-ΔN is even more slowed down in nucleoli compared with the nucleoplasm.

Download figure to PowerPoint

Table 1. FCS experiments performed on MCF-7 cells transiently transfected with different constructs and treated with α-amanitin or m-3M3 FBS as indicated
 Dfast, 37°C ± s.d. (μm2/s)Dslow, 37°C ± s.d. (μm2/s)Ffast, 37°C ± s.d.χ2 ( inline image)n
  1. FCS experiments were performed on MCF-7 cells transiently transfected with the different constructs as indicated. Additionally, eYFP-S2-ΔN transfected MCF-7 cells were incubated with 5 μg/ml α-amanitin for 6 hours or with 100 μM m-3M3 FBS for minimum 1 and maximum 2 hours as indicated. All autocorrelation curves obtained were fit with the two-component diffusion model to calculate the diffusion coefficients (Dfast, 37°C and Dslow, 37°C, μm2/s), the fraction of the fast component (Ffast, 37°C) and the goodness of fit (χ2). n = number of independent cellular measurements, s.d. = standard deviation.

Nucleoplasm     
eYFP36.4 ± 3.80.6 ± 0.80.97 ± 0.031.3719
eYFP-S2-ΔN22.0 ± 6.51.8 ± 0.60.48 ± 0.084.4127
eYFP-S2-ΔN + α-amanitin17.7 ± 6.81.6 ± 0.60.53 ± 0.118.4332
eYFP-S2-ΔN-δ118.5 ± 6.51.7 ± 0.90.63 ± 0.113.7923
eYFP-S2-ΔN-δ217.5 ± 6.81.4 ± 0.70.59 ± 0.115.1045
eYFP-S2-ΔN-δ1,216.3 ± 5.50.7 ± 0.30.70 ± 0.103.2920
eYFP-S2-ΔN + m-3M3 FBS16.4 ± 8.61.0 ± 0.30.55 ± 0.094.8134
Nucleoli     
eYFP-S2-ΔN14.1 ± 6.71.0 ± 0.20.20 ± 0.092.0512
eYFP-S2-ΔN-δ117.3 ± 9.91.4 ± 0.50.52 ± 0.204.3020
eYFP-S2-ΔN-δ214.0 ± 4.60.8 ± 0.20.29 ± 0.054.6724

As shown in Figure 2, the ACF of eYFP-S2-ΔN strongly shifted to the longer time scale compared with eYFP. A diffusion coefficient of the fast component of eYFP-S2-ΔN (D = 22.0 ± 6.5 μm2/s) is obtained which is only ∼1.6 times smaller than that of eYFP (D = 36.4 ± 3.8 μm2/s). This factor is only slightly higher than the factor inline image= 1.26 which is expected for a spherical molecule with double molecular mass (Mw eYFP = 29.42 kDa; Mw eYFP-S2-ΔN = 51.06 kDa). This suggests that eYFP-S2-ΔN diffuses as a monomer or maximally as a dimer, in view of the limited accuracy of FCS. The slow component however, has to be attributed to a species interacting with elements from the nucleoplasm.

The abundance of nuclear speckles in the nucleoplasm (∼20–50 per cell) together with their small size [0.8–1.8 μm diameter [20]] made it impossible to exclude these nuclear compartments from our nucleoplasmic FCS measurements, even with the coexpression of a nuclear speckle marker. When eYFP-S2-ΔN was measured in the nucleoplasm of α-amanitin treated MCF-7 cells the ACFs could again best be fitted with the two-component diffusion model (Supporting Information Fig. S3C). Only a limited but significant decrease was observed for the fast diffusion coefficient of α-amanitin treated compared with untreated MCF-7 cells. This decrease could be explained by additional nucleoplasmic interactions of eYFP-S2-ΔN caused by the inhibition of transcription. In addition, we cannot conclude from our confocal microscopy studies that eYFP-S2-ΔN is completely excluded from nuclear speckles. However, the slow diffusion coefficient and the amplitude fraction (Ffast 37°C) of α-amanitin treated and untreated MCF-7 cells were not significantly different (Table 1 and Supporting Information Table S1).

Dynamics of eYFP-S2-ΔN in Nucleoli

Comparable to the nucleoplasm, in nucleoli, the two-component diffusion model also gives the best description of the ACF of eYFP-S2-ΔN (Supporting Information Fig. S4A). A pronounced decrease in the fraction of the fast component was noted in nucleoli compared with the nucleoplasm. In addition, both diffusion coefficients were somewhat decreased, most likely due to an increased “viscosity” of the nucleolus (Table 1 and Fig. 2).

We also used FRAP to detect potentially slow or immobile groups of eYFP-S2-ΔN in cells, which could be missed by FCS. As the diffusion of eYFP-S2-ΔN was relatively fast, live cells were imaged at room temperature (∼21°C) to slow down these processes. Additionally, at this lower temperature displacements of the cells during the measurements were reduced as well. The recovery curves obtained in minimum nine independent measurements were normalized and fitted using the diffusion model proposed by Soumpasis [7]. A small immobile fraction of 8% (Fimm = 0.08 ± 0.05) was obtained in the nucleoli in a 18s measurement. Bleaching could deplete the nucleolar fluorescent S2 pool, and therefore, its immobile fraction would be overestimated. However, in fluorescent loss of photobleaching experiments we observed a fast exchange of S2 between the nucleoplasm and nucleoli (results not shown). Therefore, the depletion of the fluorescent S2 pool in nucleoli can be neglected. In the nucleoplasm, already after 10s, an almost 100% recovery was noted (Fimm = 0.05 ± 0.03) (Table 2).

Table 2. FRAP experiments performed on MCF-7 cells transiently transfected with the different constructs as indicated
 Fimm±s.dn
  1. All FRAP curves were normalized and fitted as described in materials and methods. s.d. is the standard deviation and n the number of independent cellular measurements.

Nucleoplasm  
eYFP-S2-ΔN0.05 ± 0.039
eYFP-S2-ΔN-δ10.04 ± 0.046
eYFP-S2-ΔN-δ20.04 ± 0.039
eYFP-S2-ΔN-δ1,20.02 ± 0.0410
Nucleoli  
eYFP-S2-ΔN0.08 ± 0.0511
eYFP-S2-ΔN-δ10.03 ± 0.057
eYFP-S2-ΔN-δ20.03 ± 0.0420

In the Nucleus, PIP2 Favors the Enrichment of S2-ΔN in the Slow Diffusing Components

Nucleoplasm

Using previously described S2-ΔN mutants [4] that are defective in their PIP2 binding in the first (S2-ΔN-δ1), the second (S2-ΔN-δ2), or both (S2-ΔN-δ1,2) PDZ domains, we aimed to explore the effects of PIP2 interactions in living cells. Similar to eYFP-S2-ΔN, the best fit of the ACFs of these mutants was obtained with the two-component diffusion model for all constructs in the nucleoplasm and nucleoli (Supporting Information Figs. S3D–S3F and S4B–S4C). When S2-ΔN was unable to bind PIP2 (eYFP-S2-ΔN-δ1,2) a strong increase of the fraction of the fast component was noted compared with eYFP-S2-ΔN (full-PIP2 binding). The average diffusion coefficients of eYFP-S2-ΔN-δ1,2 were surprisingly somewhat lower than those of eYFP-S2-ΔN, although a broad distribution of diffusion coefficients is observed (see standard deviations Table 1). Second, a significant enrichment in the fast fraction was observed when only one PDZ domain was mutated for its PIP2 binding compared with eYFP-S2-ΔN in the nucleoplasm. However, this enrichment was less than with the double mutant. In addition, both the fast and slow diffusion coefficient of the single mutants was again slightly decreased. However, only eYFP-S2-ΔN-δ2 was significantly different from eYFP-S2-ΔN (Table 1 and Supporting Information Table S1).

Nucleoli

To define if nuclear PIP2 also influences the diffusion of nucleolar S2-ΔN, we measured eYFP-S2-ΔN-δ1 and eYFP-S2-ΔN-δ2 using FCS in the nucleoli. Again, a significant increase in the percentage of the fast component because of the loss of PIP2 binding was noted compared with eYFP-S2-ΔN (Table 1 and Supporting Information Table S1).

Colocalization experiments and treatments known to affect cellular PIP2 levels have shown that the subnuclear localization of S2-ΔN is PIP2 dependent. In paraformaldehyde fixed MCF-7 cells [4] and in living cells (Fig. 3C), eYFP-S2-ΔN-δ1,2 is excluded from the nucleoli. We used FRAP to determine if the interaction with nuclear PIP2 leads to long-term binding of S2-ΔN in nucleoli. When the immobile fraction of eYFP-S2-ΔN (0.08 ± 0.05) was compared with those of eYFP-S2-ΔN-δ1 and eYFP-S2-ΔN-δ2 (Fimm, eYFP-S2-ΔN-δ1 = 0.03 ± 0.05 and Fimm, eYFP-S2-ΔN-δ2 = 0.03 ± 0.04) only a significant difference was measured for eYFP-S2-ΔN-δ2 (P = 0.0106) (Table 2 and Supporting Information Table S2). However, for both eYFP-S2-ΔN-δ1 and eYFP-S2-ΔN-δ2 a clear trend to a decreased long-term binding of S2-ΔN in nucleoli is observed when PIP2 binding is lost in the first or second PDZ domain (Fig. 3D and Table 2). Although in the nucleoplasm the immobile fraction of eYFP-S2-ΔN was very low (Fimm = 0.05 ± 0.03), the same trend to decrease the immobile fraction when one or both PDZ domains were mutated for their PIP2 binding is observed (Fimm, eYFP-S2-ΔN-δ1 = 0.04 ± 0.04; Fimm, eYFP-S2-ΔN-δ2 = 0.04 ± 0.03; Fimm, eYFP-S2-ΔN-δ1,2 = 0.02 ± 0.04) (Table 2).

image

Figure 3. The recruitment of S2-ΔN towards the nucleoli is PIP2 dependent. (A-C) Confocal fluorescence micrographs of MCF-7 cells overexpressing eYFP-S2-ΔN mutated to abolish PIP2 binding in the first (eYFP-S2-ΔN-δ1) (A), the second (S2-ΔN-δ2) (B) or both (S2-ΔN-δ1,2) PDZ domains (C). Note that eYFP-S2-ΔN-δ1,2 is excluded from nucleoli. Scale bars denote 10 μm. (D) The averaged normalized fluorescence recovery from minimum 7 independent FRAP experiments in nucleoli of MCF-7 cells expressing different constructs as indicated are plotted in function of time. Error bars correspond to standard deviations from the mean. Note the decrease of the immobile fraction when eYFP-S2-ΔN-δ1 and S2-ΔN-δ2 are measured and compared to the fluorescence recovery of eYFP-S2-ΔN.

Download figure to PowerPoint

Because mutations were introduced in the carboxylate binding loop and the N-terminus of the αB-helix, which are both known to be important for the peptide binding of PDZ domains, an additional approach was attempted to confirm our measurements. As shown previously, nuclear PIP2 is required for subnuclear enrichment of eGFP-S2-ΔN [4]. PLC-mediated hydrolysis of PIP2 is the major catabolic pathway for PIP2 [21]. Activating PLC by incubating eYFP-S2-ΔN transfected MCF-7 cells with 100 μM m-3M3 FBS, that is, a general PLC activator, should decrease cellular PIP2 levels [22]. As previously reported, already after 25 minutes eGFP-S2-ΔN translocates from the nucleus toward the cytoplasm and the plasma membrane [4]. In agreement, in our confocal microscopy measurements, eYFP-S2-ΔN translocates from the nucleus toward the cytoplasm and the plasma membrane after incubation with 100 μM m-3M3 FBS (data not shown). This suggests that nuclear PIP2 levels are effectively decreased. Therefore, after incubation with 100 μM m-3M3 FBS for minimum 1 and maximum 2 hours, the diffusion of the remaining eYFP-S2-ΔN was measured in the nucleoplasm of MCF-7 cells using FCS. Taking the standard deviations into account a limited decrease in the diffusion coefficients and a limited increase in the percentage of the fast component was observed when eYFP-S2-ΔN measured in m-3M3 FBS incubated cells was compared with eYFP-S2-ΔN wild type. The trend in the parameters is the same as the one observed for eYFP-S2-ΔN-δ1,2 (Table 1) and are thus consistent with our mutant studies.

S2-ΔN Self-Associates in a PIP2 Independent Manner

Some PDZ proteins are reported to homodimerize and heterodimerize [23-28] and S2 was reported to self-associate in yeast two-hybrid experiments [29]. This obliged us to find out if S2-ΔN forms dimers (or oligomers) in living cells. Therefore, we used FCCS to check the codiffusion of eGFP-S2-ΔN and mCherry-S2-ΔN in the nucleoplasm of MCF-7 cells [30-32]. Control experiments were designed to calculate the false signal because of cross-talk between the green and red channel. Therefore, MCF-7 cells transfected with eGFP-S2-ΔN were measured. The counting rate ratio of red to green was around 10% on 488 nm excitation. This 10% signal in the red channel is due to bleeding through from green to red. No significantly detectable bleeding through from red to green was observed. As a negative control of codiffusion, FCCS was measured in the nucleoplasm of MCF-7 cells cotransfected with eGFP-S2-ΔN and mCherry. The transfection procedure was optimized to obtain equal to almost equal number particles for eGFP-S2-ΔN and mCherry in the green and red channel, respectively. A normalized cross-correlation amplitude of 0.17 ± 0.05 was obtained (Supporting Information Fig. S5A). Second, the fusion protein eGFP-mCherry was used as a positive control and gave a normalized cross-correlation amplitude of 0.38 ± 0.03 (Supporting Information Fig. S5B). After optimization of the transfection procedure similar to the negative control, FCCS measurements in the nucleoplasm of MCF-7 cells cotransfected with eGFP-S2-ΔN and mCherry-S2-ΔN showed a normalized cross-correlation amplitude of 0.35 ± 0.13 (Fig. 4A and Supporting Information Fig. S5C). This indicates that S2-ΔN self-associates in the nucleoplasm. Interestingly, when eGFP-S2-ΔN-δ1,2 and mCherry-S2-ΔN-δ1,2 were measured, a normalized cross-correlation value not significantly different from S2-ΔN (P = 0.1012) was calculated (S2-ΔN inline image; S2-ΔN-δ1,2 inline image) (Supporting Information Figs. 4A and S5D). This indicates that the self-association of S2-ΔN in the nucleoplasm is largely independent of nuclear PIP2 binding.

image

Figure 4. S2-ΔN forms homo-dimers in the nucleoplasm. (A) Histograms of the mean amplitudes of cross-correlation curves obtained from Fluorescence Cross-Correlation Spectroscopy (FCCS) experiments measured in the nucleoplasm of MCF-7 cells transiently expressing different constructs as indicated. Error bars correspond to standard deviations from the mean of minimum 12 independent measurements. Fusion of eGFP and mCherry was used as a positive control. Cross-correlation between mCherry and eGFP-S2-ΔN was used as a negative control. Note the codiffusion of eGFP-S2-ΔN and mCherry-S2-ΔN. Note also that eGFP-S2-ΔN-δ1,2 and mCherry-S2-ΔN-δ1,2 still co-diffuse. * denotes a significant difference (P < 0.05).

(B) Brightness-values or counts per molecules (cpm in kHz per molecule) are measured for eYFP and eYFP-S2-ΔN in the nucleoplasm of transfected MCF-7 cells and divided into different brightness-intervals. The histogram shows the percentage of events that a given brightness-value belongs to the indicated brightness-interval.

Download figure to PowerPoint

To estimate the degree of homoassociation, we compared the molecular brightness of eYFP-S2-ΔN with eYFP [33]. Therefore, the averaged fluorescent intensities of eYFP and eYFP-S2−ΔN were divided by their respective average number particles to obtain the apparent brightness or counts per molecules (cpm) of eYFP and eYFP-S2-ΔN. Afterward, these brightness values were normalized to the averaged cpm of eYFP in the nucleoplasm and plotted into histograms (Fig. 4B). The distribution of the brightness values of eYFP-S2-ΔN was increased compared with eYFP and a second peak with an increased observed brightness of 1.5 ± 0.2 kHz is visible. The presence of two peaks indicates that in part of the nucleoplasmic measurements only monomeric eYFP-S2-ΔN is observed, whereas in others a mixture of monomeric and probably dimeric eYFP-S2-ΔN is detected. However, in the ideal case of no quenching, bleaching, or binding to endogenous S2 the homodimerization of eYFP-S2-ΔN should lead to a brightness value of 2.0 kHz. In the two-components diffusion model the total apparent brightness is dependent on the number particles and brightness of each component in a nonlinear Equation [34]. Using this dependence and assuming a brightness value of 2.0 kHz for the dimer, we calculate that our observed brightness of 1.5 ± 0.2 kHz corresponds to a fraction of protein in dimers of 50%. It should be realized that this equilibrium position is valid at the micromolar concentrations of fluorescent S2 observed in our selected cells. It is possible that the endogenous concentration is much lower, and therefore, the degree of association of the endogenous S2 might be lower.

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information

S2-ΔN is Not Enriched in Nuclear Speckles in Living Cells

As a PDZ protein, S2 most likely interacts with many partners but only a few are identified today. Interestingly, in 2005, it was shown that nuclear PIP2 binds to the PDZ domains of S2 [4]. Unfortunately, for S2 only limited information is available and although much is known about the phosphoinositide signaling at the cytoplasm, only in the last decades evidence accumulated suggesting its presence in the nucleus. However, the PDZ-PIP2 interaction of S2 together with its reported self-association in yeast two-hybrid experiments suggest that S2 plays an important role in cell signaling. Therefore, we studied the influence of PIP2 on the binding behavior of S2 in the nucleus of living cells. To study this, FCS, FCCS, and FRAP are excellent tools as they are noninvasive techniques, which can be used to measure the mobility and interactions of proteins inside a living functional cell at spatial and temporal scales [16, 17].

According to the major view in the field at present, nuclear speckles function as storage/assembly/modification compartments that can supply splicing factors to active transcription sites [35]. Depletion of S2 by siRNA disrupts the nuclear speckles-PIP2 pattern in fixed MCF-7 and U-2 OS cells, which suggests a role for S2 in the nuclear speckles formation [4]. In paraformaldehyde fixed cells, eYFP-S2-ΔN is present at the plasma membrane, in the nucleoplasm and highly enriched in nucleoli and nuclear speckles [4]. Interestingly, however, in our colocalization studies with different nuclear speckle markers we showed that the enrichment of S2-ΔN in nuclear speckles is fixation dependent. Redistribution toward nuclear speckles after fixation is also described in the literature for RNA polymerase II [36]. Although we could not conclude that S2 is excluded from nuclear speckles, this finding was rather surprising and stresses the risk of biological misinterpretations after fixation. However, S2 diffusion is influenced when α-amanitin, known to inhibit RNA polymerase II and enlarge nuclear speckles, is added to the cell. Therefore, we speculate that a low percentage of S2 is still present in these nuclear compartments, although its function remains unknown.

S2 is Distributed in Three Diffusing Groups in the Nucleus

Studying the diffusion of S2-ΔN in the nucleus, we could gain insight in its binding behavior in living cells since, for example, high molecular weight complexes, long term binding or free diffusion can be determined. In the nucleoplasm and nucleoli the ACFs of eYFP-S2-ΔN had to be fitted by a two-component diffusion model indicating two pools of the protein that are not in fast exchange. In the nucleoplasm, we noticed a ∼1.5 decrease in the fast diffusion coefficient of eYFP-S2-ΔN compared with eYFP. This factor is only slightly higher than what can be expected from its molecular weight relative to eYFP and suggests the presence of a monomeric protein. However, using FCCS, we could show that S2-ΔN does (in) directly self-associate in the nucleoplasm. Interestingly, when the slow component of eYFP-S2-ΔN is compared with its fast component, the decrease in the diffusion coefficient is remarkable (about 10-fold). This factor is much too high to represent an increased molecular mass. The slow diffusion of eYFP-S2-ΔN is therefore likely due to interactions with immobile nuclear structures, possibly chromatin.

In nucleoli a further decrease in the high diffusion coefficients was noted compared with the nucleoplasm. This decrease is most likely caused by an increased “viscosity” [37]. Additionally, an enrichment in the slow component is observed. Therefore, also in nucleoli two fractions of eYFP-S2-ΔN are detected by FCS: a minor fraction which is (almost) freely diffusing and a major fraction that is interacting with practically immobile structures, possibly nucleolar chromatin. Identification of partners of eGFP-S2-ΔN in the nucleolus will clarify the nature of its slow diffusing components.

Measuring FRAP we observed a 5% and 8% immobile fraction in, respectively, the nucleoplasm and nucleoli. This immobile fraction indicates long term binding and is, in addition to the two components measured by FCS, the third group of S2-ΔN present in the nucleus.

The PDZ-PIP2 Interaction Plays an Important Role in the Nucleoplasm and in Nucleoli

Although nuclear PIP2 is implicated in a diverse set of nuclear activities such as gene transcription, chromatin remodeling, cell proliferation, cell cycle regulation, and mRNA metabolism [5, 38-43], the global significance of nuclear phosphoinositide-protein interactions is still poorly understood. This is largely due to the fact that only few nuclear effector proteins are known. Interestingly, those phosphoinositide-protein interactions that have been studied in detail appear to have profound physiological effects [43-45]. To our knowledge none of these were investigated by dynamic studies such as FCS, FCCS, or FRAP. Nevertheless, efforts are taken in the literature to explore phosphoinositide-protein interactions and recently a proteomic screen identified 28 nuclear PIP2 interacting proteins that could provide an important resource on which to base further investigations [46].

To get insight into the influence of nuclear PIP2 on the binding behavior of S2, we studied the diffusion of S2-ΔN PIP2 mutants in the nucleus of living MCF-7 cells. In both the nucleoplasm and nucleoli, an increased percentage of the fast component was measured by FCS and a decreased immobile fraction by FRAP when these S2-ΔN PIP2 mutants were compared to eYFP-S2-ΔN. This indicates that nuclear PIP2 plays an important role in the distribution among the three pools of eYFP-S2-ΔN and favors the enrichment of this PDZ protein in the slower diffusing pool. Therefore, this suggests that when eYFP-S2-ΔN looses the ability to bind nuclear PIP2, the expected scaffolding properties of this PDZ protein decrease. However, even without any PIP2 binding, as in the case of eYFP-S2-ΔN-δ1,2, a slow diffusing group is still noted that indicates that also PIP2-independent interactions contribute. Interestingly, when eGFP-S2-ΔN-δ1,2 and mCherry-S2-ΔN-δ1,2 were measured in the nucleoplasm using FCCS, no significant decrease or increase in the cross-correlation value was noted compared to intact S2-ΔN. Therefore, the self-association of S2-ΔN seemed to be independent of PIP2. In addition, limited decreased diffusion coefficients measured for both the slow and fast component of eYFP-S2-ΔN PIP2 mutants compared with eYFP-S2-ΔN make the story even more complex. This decrease suggests that the loss of PIP2 binding enables S2-ΔN to associate with additional interactors, not yet identified for S2-ΔN. All together, the different combinations of S2 binding with nuclear structures, PIP2 and not yet identified interactors fit well with the expected function of S2 in cell signaling. Moreover, cellular differences in PIP2 concentration can regulate S2 interactions with nuclear structures and other binding partners not identified yet.

When measuring mutant forms of eYFP-S2-ΔN defective for PIP2 binding, results must be interpreted with caution, as these mutations were made in structural features known to be important for the peptide binding of PDZ domains (i.e., the carboxylate binding loop and the N-terminus of the αB-helix). Interestingly, mutating the PIP2 binding in one or both PDZ domains of S2 does not destroy the peptide binding of tetraspanin L6A, that is, the only known peptide ligand of S2 until now [4, 47]. A possible way to confirm that the effects were related to PIP2, was to decrease nuclear PIP2 levels by adding drugs. Therefore, we incubated MCF-7 cells with a general PLC activator, that is, m-3M3 FBS, which decreases cellular PIP2 as reported previously [22]. As a result, the percentage of the fast component of eYFP-S2-ΔN increased, although not to the same extent as of eYFP-S2-ΔN PIP2 mutants. However, it is to be expected that the diffusion of eYFP-S2-ΔN PIP2 mutants, which are unable to bind PIP2 in one or both PDZ domains, will be more affected than the diffusion of eYFP-S2-ΔN in an environment with decreased but not fully depleted PIP2 levels.

The interactions we have identified were all based on the diffusion or absence of diffusion of the fluorescent proteins under study. In this way, it was possible to identify interactions with unknown nonfluorescent partners. Also, FCCS measurements of homo-oligomerization are based on codiffusion. This is in contrast with other techniques, for example, based on FRET signals, where specific interactions are measured independent on diffusion and more dependent on a specific short distance interaction. For these type of studies the partners have to be known, and the degree of association and the complex stoichiometry can in this case be calculated provided the intrinsic FRET efficiency of the complex can be determined [48, 49].

Literature Cited

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information
  • 1
    Ponting CP, Phillips C, Davies KE, Blake DJ. PDZ domains: Targeting signaling molecules to sub-membranous sites. Bioessays 1997;19:469479.
  • 2
    Cho KO, Hunt CA, Kennedy MB. The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein. Neuron 1992;9:929942.
  • 3
    Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, Crompton A, Chan AC, Anderson JM, Cantley LC. Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 1997;275:7377.
  • 4
    Mortier E, Wuytens G, Leenaerts I, Hannes F, Heung MY, Degeest G, David G, Zimmermann P. Nuclear speckles and nucleoli targeting by PIP2-PDZ domain interactions. EMBO J 2005;24:25562565.
  • 5
    Osborne SL, Thomas CL, Gschmeissner S, Schiavo G. Nuclear PtdIns (4,5)P2 assembles in a mitotically regulated particle involved in pre-mRNA splicing. J Cell Sci 2001;114:25012511.
  • 6
    Spector DL. Macromolecular domains within the cell nucleus. Annu Rev Cell Biol 1993;9:265315.
  • 7
    Soumpasis DM. Theoretical analysis of fluorescence photobleaching recovery experiments. Biophys J 1983;41:9597.
  • 8
    Hendrix J, Gijsbers R, De RJ, Voet A, Hotta J, McNeely M, Hofkens J, Debyser Z, Engelborghs Y. The transcriptional co-activator LEDGF/p75 displays a dynamic scan-and-lock mechanism for chromatin tethering. Nucleic Acids Res 2011;39:13101325.
  • 9
    Aragon SR andPecora R. Fluorescence correlation spectroscopy as a probe of molecular dynamics. J Chem Phys 1976;64:17911804.
  • 10
    Schwille P, Bieschke J, Oehlenschlager F. Kinetic investigations by fluorescence correlation spectroscopy: The analytical and diagnostic potential of diffusion studies. Biophys Chem 1997;66:211228.
  • 11
    Schwille P, Korlach J, Webb WW. Fluorescence correlation spectroscopy with single-molecule sensitivity on cell and model membranes. Cytometry 1999;36:176182.
  • 12
    Petrasek Z andSchwille P. Precise measurement of diffusion coefficients using scanning fluorescence correlation spectroscopy. Biophys J 2008;94:14371448.
  • 13
    Wachsmuth M, Waldeck W, Langowski J. Anomalous diffusion of fluorescent probes inside living cell nuclei investigated by spatially-resolved fluorescence correlation spectroscopy. J Mol Biol 2000;298:677689.
  • 14
    Eilbracht J andSchmidt-Zachmann MS. Identification of a sequence element directing a protein to nuclear speckles. Proc Natl Acad Sci USA 2001;98:38493854.
  • 15
    Carmo-Fonseca M, Pepperkok R, Carvalho MT, Lamond AI. Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies. J Cell Biol 1992;117:114.
  • 16
    Bacia K andSchwille P. A dynamic view of cellular processes by in vivo fluorescence auto- and cross-correlation spectroscopy. Methods 2003;29:7485.
  • 17
    Rigler R, E. Elson.Fluorescence Correlation Spectroscopy: Theory and Applications.New York:Springer;2001.
  • 18
    Enderlein J, Gregor I, Patra D, Fitter J. Art and artefacts of fluorescence correlation spectroscopy. Curr Pharm Biotechnol 2004;5:155161.
  • 19
    Enderlein J, Gregor I, Patra D, Dertinger T, Kaupp UB. Performance of fluorescence correlation spectroscopy for measuring diffusion and concentration. ChemPhysChem 2005;6:23242336.
  • 20
    Spector DL. Nuclear domains. J Cell Sci 2001;114:28912893.
  • 21
    Horowitz LF, Hirdes W, Suh BC, Hilgemann DW, Mackie K, Hille B. Phospholipase C in living cells: Activation, inhibition, Ca2+ requirement, and regulation of M current. J Gen Physiol 2005;126:243262.
  • 22
    Bae YS, Lee TG, Park JC, Hur JH, Kim Y, Heo K, Kwak JY, Suh PG, Ryu SH. Identification of a compound that directly stimulates phospholipase C activity. Mol Pharmacol 2003;63:10431050.
  • 23
    Brenman JE, Chao DS, Gee SH, McGee AW, Craven SE, Santillano DR, Wu Z, Huang F, Xia H, Peters MF, Froehner SC, Bredt DS. Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alpha1-syntrophin mediated by PDZ domains. Cell 1996;84:757767.
  • 24
    Gee SH, Sekely SA, Lombardo C, Kurakin A, Froehner SC, Kay BK. Cyclic peptides as non-carboxyl-terminal ligands of syntrophin PDZ domains. J Biol Chem 1998;273:2198021987.
  • 25
    Hillier BJ, Christopherson KS, Prehoda KE, Bredt DS, Lim WA. Unexpected modes of PDZ domain scaffolding revealed by structure of nNOS-syntrophin complex. Science 1999;284:812815.
  • 26
    Xu XZ, Choudhury A, Li X, Montell C. Coordination of an array of signaling proteins through homo- and heteromeric interactions between PDZ domains and target proteins. J Cell Biol 1998;142:545555.
  • 27
    Srivastava S, Osten P, Vilim FS, Khatri L, Inman G, States B, Daly C, DeSouza S, Abagyan R, Valtschanoff JG, Weinberg RJ, Ziff EB. Novel anchorage of GluR2/3 to the postsynaptic density by the AMPA receptor-binding protein ABP. Neuron 1998;21:581591.
  • 28
    Fouassier L, Yun CC, Fitz JG, Doctor RB. Evidence for ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions. J Biol Chem 2000;275:2503925045.
  • 29
    Koroll M, Rathjen FG, Volkmer H. The neural cell recognition molecule neurofascin interacts with syntenin-1 but not with syntenin-2, both of which reveal self-associating activity. J Biol Chem 2001;276:1064610654.
  • 30
    Bacia K, Kim SA, Schwille P. Fluorescence cross-correlation spectroscopy in living cells. Nat Meth 2006;3:8389.
  • 31
    Bacia K, Schwille P. Fluorescence correlation spectroscopy. Meth Mol Biol 2007;398:7384.
  • 32
    Slaughter BD, Schwartz JW, Li R. Mapping dynamic protein interactions in MAP kinase signaling using live-cell fluorescence fluctuation spectroscopy and imaging. Proc Natl Acad Sci USA 2007;104:2032020325.
  • 33
    Renz M andLangowski J. Dynamics of the CapG actin-binding protein in the cell nucleus studied by FRAP and FCS. Chromosome Res 2008;16:427437.
  • 34
    Thompson NL. Fluorescence correlation spectroscopy. In: Lakowicz JR, editor.Topics in Fluorescence Spectroscopy,1st ed.New York:Plenum Press;1991. pp337378.
  • 35
    Lamond AI, Spector DL. Nuclear speckles: A model for nuclear organelles. Nat Rev Mol Cell Biol 2003;4:605612.
  • 36
    Guillot PV, Xie SQ, Hollinshead M, Pombo A. Fixation-induced redistribution of hyperphosphorylated RNA polymerase II in the nucleus of human cells. Exp Cell Res 2004;295:460468.
  • 37
    Dross N, Spriet C, Zwerger M, Muller G, Waldeck W, Langowski J. Mapping eGFP oligomer mobility in living cell nuclei. PLoS ONE 2009;4:e5041.
  • 38
    Anderson RA, Boronenkov IV, Doughman SD, Kunz J, Loijens JC. Phosphatidylinositol phosphate kinases, a multifaceted family of signaling enzymes. J Biol Chem 1999;274:99079910.
  • 39
    Cocco L, Martelli AM, Gilmour RS, Ognibene A, Manzoli FA, Irvine RF. Changes in nuclear inositol phospholipids induced in intact cells by insulin-like growth factor I. Biochem Biophys Res Commun 1989;159:720725.
  • 40
    Divecha N, Banfic H, Irvine RF. The polyphosphoinositide cycle exists in the nuclei of Swiss 3T3 cells under the control of a receptor (for IGF-I) in the plasma membrane, and stimulation of the cycle increases nuclear diacylglycerol and apparently induces translocation of protein kinase C to the nucleus. EMBO J 1991;10:32073214.
  • 41
    Jones DR, Divecha N. Linking lipids to chromatin. Curr Opin Genet Dev 2004;14:196202.
  • 42
    Yu H, Fukami K, Watanabe Y, Ozaki C, Takenawa T. Phosphatidylinositol 4,5-bisphosphate reverses the inhibition of RNA transcription caused by histone H1. Eur J Biochem 1998;251:281287.
  • 43
    Zhao K, Wang W, Rando OJ, Xue Y, Swiderek K, Kuo A, Crabtree GR. Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF complex to chromatin after T lymphocyte receptor signaling. Cell 1998;95:625636.
  • 44
    Jones DR, Bultsma Y, Keune WJ, Halstead JR, Elouarrat D, Mohammed S, Heck AJ, D'Santos CS, Divecha N. Nuclear PtdIns5P as a transducer of stress signaling: an in vivo role for PIP4Kbeta. Mol Cell 2006;23:685695.
  • 45
    Mellman DL, Gonzales ML, Song C, Barlow CA, Wang P, Kendziorski C, Anderson RA. A PtdIns4,5P2-regulated nuclear poly(A) polymerase controls expression of select mRNAs. Nature 2008;451:10131017.
  • 46
    Lewis AE, Sommer L, Arntzen MO, Strahm Y, Morrice NA, Divecha N, D'Santos CS. Identification of nuclear phosphatidylinositol 4,5-bisphosphate-interacting proteins by neomycin extraction. Mol Cell Proteomics 2011;10:M110.
  • 47
    Borrell-Pages M, Fernandez-Larrea J, Borroto A, Rojo F, Baselga J, Arribas J. The carboxy-terminal cysteine of the tetraspanin L6 antigen is required for its interaction with SITAC, a novel PDZ protein. Mol Biol Cell 2000;11:42174225.
  • 48
    Hoppe A, Christensen K, Swanson JA. Fluorescence resonance energy transfer-based stoichiometry in living cells. Biophys J 2002;83:36523664.
  • 49
    Gell DA, Grant RP, Mackay JP. The detection and quantitation of protein oligomerization. Adv Exp Med Biol 2012;747:1941.

Supporting Information

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Literature Cited
  7. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
cytoa22246-sup-0001-SuppFig1.tif13266KSupporting Information Figure 1. eGFP-S2-ΔN is not enriched in nuclear speckles in living cells. ASF/SF-2 colocalization studies. (A-C) Confocal fluorescence micrographs of living MCF-7 cells overexpressing mCherry-ASF/SF-2 (A) with eGFP-S2-ΔN (B). In the merge (C) ASF/SF-2 is in red and S2-ΔN is in green. Note that eGFP-S2-ΔN is not enriched in nuclear speckles in living cells. (D-F) Confocal fluorescence micrographs of living MCF-7 cells as described in (A-C) but after incubation for 6 hours with 5μg/ml of a-amanitin. Note that the inhibition of transcription by a-amanitin affects the shape of nuclear speckles (compare A to D) and that eGFP-S2-ΔN is not recruited to nuclear speckles after a-amanitin treatment. (G-I) Confocal fluorescence micrographs of MCF-7 cells as described in (A-C) after paraformaldehyde fixation. Note the clear enrichment of eGFP-S2-ΔN in nuclear speckles. (J-L) Confocal fluorescence micrographs of MCF-7 cells as described in (D-F) after paraformaldehyde fixation. Note again the change in shape of nuclear speckles after a-amanitin treatment (compare J with G). Note eGFP-S2-ΔN enrichment in nuclear speckles. Scale bars 10μm.
cytoa22246-sup-0002-SuppFig2.tif13359KSupporting Information Figure 2. eGFP-S2-ΔN is not enriched in nuclear speckles in living cells. ΔSF3b155 colocalization studies. (A-C) Confocal fluorescence micrographs of living MCF-7 cells overexpressing mCherry-ΔSF3b155 (A) with eGFP-S2-ΔN (B). In the merge (C) ΔSF3b155 is in red and S2-ΔN is in green. Note that eGFP-S2-ΔN is not enriched in nuclear speckles in living cells. (D-F) Confocal fluorescence micrographs of living MCF-7 cells as described in (A-C) but after incubation for 6 hours with 5μg/ml of a-amanitin. Note that the inhibition of transcription by a-amanitin affects the shape of nuclear speckles (compare A to D) and that eGFP-S2-ΔN is not recruited to nuclear speckles after a-amanitin treatment. (G-I) Confocal fluorescence micrographs of MCF-7 cells as described in (A-C) after paraformaldehyde fixation. Note the clear enrichment of eGFP-S2-ΔN in nuclear speckles. (J-L) Confocal fluorescence micrographs of MCF-7 cells as described in (D-F) after paraformaldehyde fixation. Note again the change in shape of nuclear speckles after a-amanitin treatment (compare J with G). Note eGFP-S2-ΔN enrichment in nuclear speckles. Scale bars 10μm.
cytoa22246-sup-0003-SuppFig3.tif1837KSupporting Information Figure 3. All ACFs measured in the nucleoplasm of MCF-7 cells transiently transfected with different constructs as indicated are best described by the two-component diffusion model. (A) Averaged residual plots obtained after fitting the ACFs obtained from 19 independent FCS measurements in the nucleoplasm of MCF-7 cells transiently transfected with eYFP. The one-component diffusion, the two-component diffusion and the anomalous diffusion model were used to fit as indicated. Note that the two-component diffusion model described the ACF of eYFP the best. (B) Averaged residual plots, obtained from 27 independent FCS measurements in the nucleoplasm of transiently transfected MCF-7 cells, showing the fit of the measured ACFs of eYFP-S2-ΔN with the anomalous, the two-component and the one-component diffusion model as indicated. Note that the two-component diffusion model described the ACF of eYFP the best. (C) Averaged residual plots showing the fit of the ACFs obtained from 32 independent FCS measurements in the nucleoplasm of MCF-7 cells transiently with eYFP-S2-ΔN and after incubation for 6 hours with 5μg/ml of ?-amanitin. Both the anomalous and the two-component diffusion model were used to fit the obtained ACFs, but the two-component diffusion model describes the data the best. (D-F) Averaged residual plots obtained after fitting the measured ACFs of eYFP-S2-ΔN-δ1,2 (D), eYFP-S2-ΔN-δ1 (E) or eYFP-S2-ΔN-δ2 (F) using the two-component diffusion and the anomalous diffusion model. The averaged residuals were calculated from fitting minimum 20 ACFs obtained in independent FCS measurements in the nucleoplasm of MCF-7 cells. Note that the ACFs of all the eYFP-S2-ΔN?PIP2 mutants are best described by the two-component diffusion model. The deviation from the fits [δG(τ)] is given in function of autocorrelation time (τ in μs).
cytoa22246-sup-0004-SuppFig4.tif964KSupporting Information Figure 4. All ACFs measured in nucleoli of MCF-7 cells transiently transfected with different constructs as indicated are best described by the two-component diffusion model. (A-C) Averaged residual plots obtained after fitting the ACFs of minimum 13 independent nucleolar FCS measurements in MCF-7 cells transiently expressing eYFP-S2-ΔN (A), eYFP-S2-ΔN-δ1 (B) or eYFP-S2-ΔN-δ2 (C). The two-component diffusion and the anomalous diffusion model were used. Note again that the two-component diffusion model describes the ACFs the best. The fit of eYFP-S2-ΔN-δ1,2 is not shown since this mutant is excluded from nucleoli. The deviation from the fits [δG(τ)] is given in function of autocorrelation time (τ in μs).
cytoa22246-sup-0005-SuppFig5.tif22218KSupporting Information Figure 5. S2-ΔN and S2-ΔN-δ1,2 form homo-dimers in the nucleoplasm (A-D) Mean normalized autocorrelation functions (ACF) and cross-correlation functions obtained from minimum 12 independent FCCS experiments measured in the nucleoplasm of MCF-7 cells transiently co-expressing eGFP-S2-ΔN and mCherry (A), eGFP-mCherry (B), eGFP-S2-ΔN and mCherry-S2-ΔN (C) or eGFP-S2-ΔN-δ1,2 and mCherry-S2-ΔN-δ1,2 (D). Cross-correlation between mCherry and eGFP-S2-ΔN was used as a negative control. Fusion of eGFP and mCherry was used as a positive control. Note the co-diffusion of eGFP-S2-ΔN and mCherry-S2-ΔN. Note also that eGFP-S2-ΔN-δ1,2 and mCherry-S2-ΔN-δ1,2 still co-diffuse.
cytoa22246-sup-0006-SuppTab1.doc34KSupporting Information Table 1. P-values as obtained by unpaired two-tailed t-tests listed to identify significant differences between the diffusion coefficients (Dfast, 37°C and Dslow, 37°C) or the percentage of the fast component (Ffast, 37°C) of the different constructs as indicated and measured by FCS. A P-value lower than lower than 0.05 denotes a significant difference, n = degrees of freedom.
cytoa22246-sup-0007-SuppTab2.doc29KSupporting Information Table 2. P-values as obtained by unpaired two-tailed t-tests listed to identify significant differences between the immobile fractions (Fimm) of the different constructs as indicated and measured by FRAP. A P-value lower than lower than 0.05 denotes a significant difference, n = degrees of freedom.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.