SEARCH

SEARCH BY CITATION

Keywords:

  • muscarinic receptors;
  • oligodendrocytes;
  • proliferation;
  • survival;
  • myelin proteins

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Acetylcholine (ACh) is a major neurotransmitter but also an important signaling molecule in neuron-glia interactions. Expression of ACh receptors has been reported in several glial cell populations, including oligodendrocytes (OLs). Nonetheless, the characterization of muscarinic receptors in these cells, as well as the description of the cholinergic effects at different stages of OL development, is still incomplete. In this study, we characterized the pattern of expression of muscarinic receptor subtypes in primary cultures of rat oligodendrocyte progenitor cells (OPC) and mature OLs, at both mRNA and protein levels. We found that muscarinic receptor expression is developmentally regulated. M1, M3, and M4 receptors were the main subtypes expressed in OPC, whereas all receptor subtypes were expressed at low levels in mature OLs. Exposure of OPC to muscarine enhanced cell proliferation, an effect mainly due to M1, M3, and M4 receptor subtypes as demonstrated by pharmacological competition with selective antagonists. Conversely, M2 receptor activation impaired OPC survival. In line with the mitogenic activity, muscarinic receptor activation increased the expression of platelet derived growth factor receptor α. Muscarine stimulation increased CX32 and myelin basic protein expression, left unaffected that of myelin proteolipid protein (PLP), and decreased member of the family of epidermal growth factor receptor (EGFR) ErbB3/ErbB4 receptor expression indicating a predominant role of muscarinic receptors in OPC. These findings suggest that ACh may contribute to the maintenance of an immature proliferating progenitor pool and impair the progression toward mature stage. This hypothesis is further supported by increased expression of Notch-1 in OL on muscarinic activation. © 2011 Wiley Periodicals, Inc. Develop Neurobiol 72: 713–728, 2012


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

During nervous system development, neuron-glia interactions modulate several processes, including neural stem cell proliferation (Ma et al.,2004; Zhou et al.,2004) neurite extension and fiber myelination (Barres,1997), synapse formation (Pfrieger et al.,1997) and neuron migration (Anton et al.,1997), and differentiation (Garcia-Abreu et al.,1995). Several soluble factors secreted by glial and neuronal cells, among which neurotransmitters, have been described to mediate these interactions (Gomes et al.,2001; Simon and Trajkovic,2006; Verkhratsky,2010).

Emerging evidence indicates that glial cells express receptors for different neurotransmitters, which suggests that these molecules, most probably when released in extrasynaptic regions (Araque et al.,1999; Weiner et al.,2001; Ullian et al.,2004), may modulate glial cell survival, proliferation, and differentiation (Stevens and Fields,2000; Magnaghi et al.,2004, 2009; Verkhratsky and Toescu,2006; Loreti et al.,2007a).

Acetylcholine (ACh) was the first molecule identified as neurotransmitter, and it has been reported as one of oldest signaling molecules (Wessler et al.,2001). ACh acts in different tissues and cell types such as endothelium, lung bronchial epithelia, keratinocytes, and lymphocytes (Proskocil et al.,2004, Grando et al.,2006; Kawashima and Fuji,2008), and cholinergic modulation of basic cell functions including growth, survival, differentiation, and apoptosis has been reported (Eglen,2005).

In the nervous system, ACh and its receptors (both muscarinic and nicotinic types) are expressed by neurons and glial cells (Tata et al.,2000; Ragheb etal.,2001; Biagioni et al.,2002; Loreti et al.,2006). During neurogenesis, ACh modulates neuron survival and proliferation (Lauder,1993; Biagioni et al.,2000). Moreover, muscarinic receptor activation promotes neuronal differentiation (Salani et al.,2009; Tata et al.,2003), whereas nicotinic receptor activation plays a role in the modulation of inflammation in both peripheral organs and in the brain, by affecting the release of pro- and anti-inflammatory molecules from peripheral immune system cells (e.g., macrophages and lymphocytes) as well as microglial cells (Tracey,2002; Kawashima and Fuji,2008; De Simone et al.,2005).

Although the expression of ACh receptors reported in several glial cell populations suggests that these cells can be targets for ACh actions (Murphy et al.,1986; Bernardini et al.,1998; Van der Zee et al.,1993; Rogers et al.,2001; Loreti et al.,2006), glial cell responsiveness to ACh in relation to proliferation and differentiation has not been studied in details.

Oligodendrocytes (OLs) are the myelinating cells of the CNS, and their development is regulated by several growth factors including platelet derived growth factor (PDGF), insulin-like growth factor-1 (IGF-1), and basic fibroblast growth factor (bFGF) (Kettenmann and Ransom,2005). OLs express muscarinic receptors (Larocca and Almazan,1997; Kahn and Morell,1988; Ragheb et al.,2001; Molina-Holgado et al.,2003), whose activation triggers different signal transduction pathways involving mitogen-activated protein kinase (MAPK), inositolo triphosphate (IP3), and calcium mobilization (Larocca et al.,1987; Cohen and Almazan,1994; Larocca and Almazan,1997; Kastritsis and McCarthy,1993; Ritchie et al.,1987).

As for central myelin-forming cells, Schwann cells express different muscarinic receptor subtypes, whose activation negatively modulates Schwann cell proliferation while promoting their progression to myelinating phenotype (Loreti et al.,2006, 2007).

On this background, we sought to investigate whether, as for Schwann cells, ACh could also influence OL survival, proliferation, and differentiation. To this aim, in this study, we characterized, at both mRNA and protein levels, the muscarinic receptor subtypes expressed in primary cultures of rat oligodendrocyte precursor cells (OPC) and mature OLs. In addition, we evaluated the effects of muscarinic agonist and antagonists on OL proliferation and survival. Finally, the ability of muscarinic receptors to modulate the expression of myelin proteins (e.g., MBP, MAL, MAG, and myelin proteolipid protein (PLP)) and of receptors, such as platelet derived growth factor receptor alpha (PDGFRα), member of the family of epidermal growth factor receptor (EGFR) (ErbB), and Notch-1, involved in the regulation of OPC proliferation and differentiation was also investigated.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Cell Cultures

Primary cultures were prepared from brain dissected from 1-day postnatal Wistar rat pups. Animals were handled in accordance with the guidelines laid down by the European Communities Council Directive (86/609/EEC, 24 November 1986). Forebrains were dissected out and mixed glial primary cultures were obtained by mechanical dissociation and maintained in defined serum-free medium, to facilitate their differentiation into OLs as previously reported (Bernardo et al.,2009, 2003), through a procedure modified from McCarthy and de Vellis (1980). After 10 days, a cell population enriched in OPCs was mechanically detached from the mixed cultures and incubated for 1 h at 37°C in culture flasks to remove adhering cells and thus minimize contamination by microglial cells. Cells were then seeded at the density of 6 × 104 cells/cm2 into poly-L-lysine-coated culture dishes. At 2 h after plating, the culture medium was replaced with a chemically defined serum-free medium, consisting of Dulbecco's modified eagle medium (DMEM)/Ham F12 (4:1) supplemented with 5.6 mg/mL glucose, 5 μg/mL insulin, 100 μg/mL human transferrin, 100 μg/mL bovine serum albumin, 0.06 ng/mL progesterone, 40 ng/mL sodium selenite, 16 μg/mL putrescine, 50 U/mL penicillin, 50 μg/mL streptomycin, and 2 mM glutamine. The culture medium contained T3 and T4 hormones (10 ng/mL), but not growth factors.

The purity of OPC cultures was evaluated using antibodies that selectively bind to differentiation-regulated antigens such as LB1 (anti-ganglioside GD3), anti-O4 (see also Bernardo et al.,2003), and anti MBP (Stallcup,1981; Sommer and Schachner,1981; Levi et al.,1987).

Muscarinic Agonist and Antagonist Treatments

Cells were incubated for 18-24 h in presence of the nonselective muscarinic agonist muscarine (final concentration 10−4M) or the M2 selective agonist arecaidine (final concentration 10−4M) (see Loreti et al.,2007). To discriminate the action of individual receptor subtypes, pirenzepine (M1 antagonist), gallamine (M2 antagonist), 1,1-dimethyl-4-diphenylacetoxypiperidinium iodide (4-DAMP) (M3 antagonist), or tropicamide (M4 antagonist) were used at concentrations comparable to those of their inhibition costant (Ki) in OLs (Ragheb et al.,2001). To evaluate OL proliferation, cultures were maintained in absence of growth factors and then treated with muscarinic agonists with or without antagonists.

Cell Viability

Cell viability was evaluated by 3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazolium bromide (MTT) assay (Mossman,1983). The cells were incubated at the last 4 h in presence of MTT, then the medium was removed, and 100 μL of dimethyl sulphoxide (DMSO) added to each well to dissolve the dark blue crystals. The optic density (OD) was then measured by spectrometry, using a Gio' di vita (instrument's company) (GDV) microplate reader. To evaluate the presence of dead cells, cultures were exposed to 1 μg/mL of Hoechst 33258 for 60 min at 37°C or to propidium iodide (45 μg/mL) during the final 20 min of incubation. Cell cultures were then rinsed with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde. Nuclear morphology was evaluated using a Leica Axioplan 2 fluorescence microscope.

Tunel System Assay

We performed terminal deoxynucleodidyl transferase-mediated dUTP-fluorescein nick end-labeling (Tunel) staining to detect at single cell level, DNA strand breaks generated during apoptosis. In situ cell death detection kit (Roche Diagnostics Milan-I) was used, and Tunel reaction was analyzed with Leica Axioplan 2 fluorescence microscope.

Immunocytochemistry

The cells were fixed for 20 min in 4% paraformaldehyde in PBS pH 7.4 at room temperature and incubated for 1 h in PBS containing 10% normal goat serum, 1% albumine bovine serum (BSA). When requested 0.1% Triton X-100 was added to blocking solution. Cells were incubated overnight at 4°C in presence of the indicated primary antibodies: anti-MBP (purified monoclonal mouse IgG, 1:100, Chemicon) (Agresti et al., 1996; Levi et al.,1987), anti PDGFR-α, anti Erb3, (Rabbit IgG 1:100, and 1:50, respectively, Santa Cruz) and anti-M1, anti-M2, anti-M3, and anti-M4 receptors (Goat IgG, 1:50, Santa Cruz). Cells were washed twice (10 min each) in PBS containing 1% BSA and then incubated for 90 min at room temperature with the secondary antibodies (Goat anti Mouse IgG fluorescein isothiocyanate (FITC)-conjugated; Goat anti-Rabbit IgG-Cy3 conjugated, rabbit anti-goat rhodamine isothiocyanate (TRITC)-conjugated Jackson diluted 1:200 in the same buffer used for the primary antibody dilution). After washing in PBS, the nuclei were stained with 1 μg/mL Hoechst 33258. Negative controls were performed by omitting the primary antibodies. When possible, the immunolocalization for O4 was performed before cell fixation (see Bernardo et al.,2003). The immunopositive cells were analyzed by Axio Observer Z1 fluorescence microscope (Zeiss).

[3H]-Thymidine Incorporation

OL progenitors were incubated for 18 h with 10−4M muscarine, a nonselective agonist of muscarinic receptors, or arecaidine (M2 selective agonist) (Loreti et al.,2007) and 1 μCi/mL [3H]-methyl-thymidine (specific activity 82 Ci/mmol; Amersham Pharmacia Biotech). To characterize the muscarinic receptor subtype involved in OL proliferation, experiments were run in parallel in the presence of selective antagonists: 10−6M pirenzepine (for M1 subtype); 10−6M gallamine (for M2 subtype); 10−7M tropicamide (for M4 subtype); 10−8M 4-DAMP (for M3 subtype); and of the nonselective antagonist atropine (10−6M). The incorporation was terminated by medium aspiration, cells were then rinsed twice with PBS and solubilized in 1% Triton X-100, at 4°C for 10 min. Ten percent of trichloroacetic acid (TCA) was added to cell lysates, which were kept at 4°C for 15 min and filtered on GF/C Whatman filters. Filters were then washed with TCA and transferred into scintillation vials. Ten milliliter of scintillation mixture (Filter-Count; Packard) was added and radioactivity was measured by scintillation β-counter (TriCarb 4000; Packard) (see Loreti et al.,2007).

RNA Extraction and RT-PCR Analysis

Total RNA was extracted using Trizol Reagent (Invitrogen) and then digested with 2 U/μL DNAse I (Ambion). About 2 μg of each sample was reverse transcripted for 60 min at 37°C with 1 μg random hexamers (Promega) as primers and 200 U Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen). After reverse transcription, 100 ng of each cDNA were used as template in each reaction tubes and polimerase chain reaction (PCR) reagents (Taq DNA polymerase and corresponding buffer; Promega) were added to the tubes in presence of specific primers for PDGFRα and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (final concentration 0.4 μM). PCR conditions for PDGFRα receptor (for primers sequences see Table 1) were initial denaturation at 95°C for 2 min; 35 cycles with the following profile, 95°C for 30 s, 60°C for 30 s, 72°C for 30 s; final extension at 72°C for 5 min. For each PCR reaction, 12.5 μL was run on 1.5% agarose gel. GAPDH was used to normalize the intensity of the amplified fragment bands. Total RNA from mouse neural stem cells (NCs) was included as negative control (Jian-Guo et al.,2004). Densitometric analyses of the bands were performed using software Phoretix 3D Linear (Abel).

Table 1. Sequence of Primers and PCR Product Sizes Used in Semiquantitative RT-PCR
Primer NamesSequence (5′−3′)PCR Product Size (bp)
  • *

    Jian-Guo Hu et al.,2004.

PDGRFα sense*GCCAGGAGACGAGGTATCAA426
PDGRFα antisense*TGTTCCCAATGCCAAGGTC 
GAPDH senseTGGCATTGTGGAAGCGCTCATGAC188
GAPDH antisenseATGCCAGTGAGCTTCCCGTTCAGC 

Real-Time PCR

The expression of muscarinic receptor subtypes and ErbB receptors was evaluated by real-time PCR analysis using selective primers as indicated in Table 2 (see Brattelid et al.,2007).

Table 2. Sequence of Primers Used in Real-Time PCR
Primer NamesSequence (5′−3′)
  • *

    Brattelid et al.,2007.

GAPDH senseTGGCATTGTGGAAGGGCTCATGAC
GAPDH antisenseATGCCAGTGAGCTTCCCGTTCAGC
M1 sense*CCATGGAGTCCCTCACATCCT
M1 antisense*ATCTACCATGGGCATCTTGATCA
M2 sense*ATCTACCATGGGCATCTTGATCA
M2 antisense*CGAAGTGGAAACTGTGTTTTCAT
M3 sense*TCCATCCTCAACTCTACCAAGCT
M3 antisense*TTGTGAGCATTTCTCTCCACATC
M4 sense*CACTCTGCAATGCCACTTTCAA
M4 antisense*CTGTGCCGATGTTCCGATACT
M5 sense*ACCCGGACTGAAAACAGTGACT
M5 antisense*ATCGGAACTAGGCAACACACTT
ErbB3senseTGTTTAGGCCAAGCAGAGGT
ErbB3 antisenseACTTTGTTTGCCTTCTCGCTT
ErbB4 senseGCTTCTCAGTCAGTGTGCCGGAAC
ErbB4 antisenseGATCTCCAGGTTGCCCATGACTACC

For each RNA sample, 1–2 μg of total RNA was reverse transcribed for 60 min at 37°C, with random hexamers as primers and M-MLV Reverse Transcriptase. Ten nanograms of each cDNA were used as template in each tube for real time-PCR assay. SyBRGreen Jump Start Taq Ready Mix (Sigma, MA) and the selective primers (final concentration 300 nM) were also added at the respective reaction tubes and analyzed in I Cycler IQ™ Multicolor Real-Time Detection System (Biorad). All samples were run in duplicate. The real-time PCR conditions included a denaturing step at 95°C for 3 min followed by 40 cycles at 95°C at 30 s; 58°C at 30 s, and 75°C at 45 s. Two cycles were included as final steps: one at 95°C (1 min) and the other at the annealing temperature specific for each couple of primers used (1 min). Quantification was performed using a comparative CT method (CT = threshold cycle value). Briefly, CT value was calculated as the mean of the CT each sample performed in duplicate. The differences between the mean CT value of each sample and the CT value of the housekeeping gene (GAPDH) were calculated: ΔCTsample = CTsampleCTGAPDH. Final result was determined as 2−ΔΔCT where ΔΔCT = ΔCTsample − ΔCTcalibrator.

Western Blotting

Total proteins were extracted by radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP40, 1x protease inhibitor cocktail, Sigma), separated in 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to PVDF sheets (Millipore, Bedford, MA). Membranes were incubated with polyclonal anti-MBP antibody (SIGMA, St Louis, MO) (dilution 1:500), monoclonal anti-CX32 (SIGMA, St Louis, MO) (dilution 1:1000), monoclonal anti-PLP (Abcam, Cambridge, United Kingdom) (dilution 1:800), or anti-Notch-1 (Santa Cruz, dilution 1:500) overnight at 4°C. The anti-rabbit, anti-mouse, or anti-goat/secondary antibodies horseradish peroxidase (HRP)-conjugated (Promega, Madison, WI) (dilution 1:10000) was used for the detection and the enzymatic activity was revealed using enhanced chemioluminiscence (ECL)-detection kit (Pierce Biotechnology, Rockford, IL). Antibody anti-actin (Chemicon/Millipore, Temecula, CA) was used as reference.

RNAse Protection Assay (RPA)

Samples of total RNA (10 μg) extracted using Trizol reagent (Invitrogen) were utilized in the RNase protection assay, as previously described (Magnaghi et al.,2004). Briefly, after ethanol precipitation samples were dissolved in 20 μL of hybridization solution (80% formamide, 40 mM PIPES pH 6.4, 400 mM sodium acetate pH 6.4 and 1 mM ethylenediaminetetraacetic acid (EDTA)) containing 250,000 cpm of [32P]-labeled cRNA probe for MBP, and 50,000 cpm of [32P]-labeled cRNA 18s probe. The cRNA antisense probes were generated by in vitro transcription of a pCR®II-TOP0® specific plasmid containing the following inserts: 380 bp for MBP; 689 bp for connexin 32 (CX32), 601 bp for myelin-associated glycoprotein (MAG), 554 bp for myelin and lymphocyte protein (MAL). Indeed, the cRNA antisense probe for 18s was generated by in vitro transcription of the pTRI-rRNA 18s plasmid (Ambion, Austin). The probes specific activities were >108 cpm/μg. The samples were heated at 85°C for 10 min then incubated overnight at 45°C. The samples were diluted with 200 μL of RNase digestion buffer (300 mM NaCl, 10 mM Tris-HCl pH 7.4, 5 mM EDTA pH 7.4) containing a 1:400 dilution of RNase cocktail (1 μg/μL RNase A and 20 U/μL RNase T1) and incubated for 30 min at 30°C. Then 10 μg of proteinase K and 20% SDS were added to the samples, and the mixture incubated at 37°C for 15 min. The samples were then phenol–chloroform extracted and precipitated. The pellets were dried, dissolved in loading buffer, boiled at 95°C for 5 min, and separated on a 5% polyacrylamide gel, under denaturing conditions (7 M urea). The protected fragments were visualized by autoradiography and their sizes were determined by the use of math imageP-end labeled (T4 polynucleotide kinase) MspI-digested pBR322 fragments. The mRNA levels for MBP isoforms and 18s rRNA were calculated by measuring the peak densitometric area of the autoradiography analyzed with Epson Scanner. To ensure that the autoradiographic bands were in the linear range of intensity, different exposure times were performed. The mean value of the controls within a single experiment was set to 100, and all the other values were expressed as percent versus the levels detected in controls.

Statistical Analysis

Data were analyzed using unpaired Student's t test when comparing two groups or one-way analysis of variance followed by Bonferroni's posthoc tests for multiple comparison. Data are expressed as mean ± SEM from at least three independent experiments. Numbers of independent experiments are indicated in figure legends. p < 0.05 was accepted as statistical significance.

For the quantification of PDGFRα and ErbB3 staining, positive cells were counted and the percentage respect to O4+ cells calculated. Ten photographic fields/dish for each experimental condition were counted from two different experiments performed in triplicate.

Densitometric analysis of the bands obtained in western blot analysis was performed using software Phoretix 3D Linear (Abel).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Characterization of OL Cell Cultures

OL differentiation occurs through a series of stages that can be defined by morphological and antigenic changes occurring in vivo as well as in culture systems (Stallcup,1981; Sommer and Schachner,1981; Dubois-Dalcq et al.,1986; Levi et al.,1987). Progenitor cells are small cells with few processes; they express the surface gangliosides recognized by the monoclonal antibodies A2B5 and LB1 [anti-ganglioside GD3; Fig. 1(A)]. As differentiation proceeds, cells acquire a number of processes that become highly branched in mature OLs. Immature OLs express the O4 antigen and galactocerebroside (O1) on their surface whereas mature OLs express myelin basic protein [MBP, Fig. 1(B)] and other myelin proteins. As previously demonstrated at 2 days in vitro, about 80% of the cells were LB1+/O4 (OPC), 20% were O4+/O1 (pre-OLs) and only 5% were O4+/O1+ (immature OLs). Contamination of astrocytes, microglia, and fibroblasts accounted for less than 2% of total cells, as assessed by cell-type specific markers. Neurons were absent. At 8 days in vitro, all cells are O4+/O1+ and 85–95% of them were also MBP+ (see Bernardo et al.,1997, 2003, 2009).

thumbnail image

Figure 1. Analysis of OL markers in OPC cultures and mature OLs. Immunocytochemistry analysis showing the expression of LB1 in OL progenitors (A) and MBP in mature OLs (B) corresponding to 2 and 8 DIV, respectively (bar = 50 μm). The levels of MBP transcripts were evaluated by RNase protection assay in OPC cultures (2 DIV) and mature OLs (8 DIV). Quantification of mRNA bands corresponding to two MBP isoforms of 18.5 (C) and 21.5 kDa (D) was calculated by measuring the peak densitometric area of the autoradiography gels normalized with 18s rRNA bands. Data represent means ± SEM obtained from three independent experiments (***p < 0.001; **p < 0.01). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

To further confirm the characterization of our cultures, we have evaluated the levels of expression of the transcripts for the 18.5 [Fig. 1(C)] and 21.5 kDa [Fig. 1(D)] MBP isoforms. As expected and in line with the immunocytochemistry analysis, MBP transcript levels, analyzed by RNAse protection assay, were low at 2 DIV but significantly increased at 8 DIV (***p < 0.001; **p < 0.01) respectively.

Expression of Different Muscarinic Receptor Subtypes

Pharmacological characterization of muscarinic ACh receptor subtypes and their expression at mRNA levels by RT-PCR were previously reported (Ragheb et al.,2001). Using real-time PCR, we first confirm the expression of the different receptor subtypes evaluating your levels of expression. As reported in Figure 2(A), OPC express all muscarinic receptor subtypes, being M3 the most abundantly expressed. The levels of transcripts encoding for M2 and M5 were significantly lower then those for the other receptor subtypes. Mature OLs, express all muscarinic receptor subtypes, being M4 the one expressed at the lowest level [Fig. 2(B)].

thumbnail image

Figure 2. Expression of muscarinic receptor subtype in OPC cultures and in mature OLs. (A and B) Relative levels of muscarinic receptor mRNAs determined by real time-PCR analysis in OPC (A) and OL (B) cultures. The CT value of each sample was first normalized respect to CT value of the housekeeping gene (GAPDH). The data obtained were then compared to the value of the sample selected as reference (M1 receptor). The data are means ± SEM obtained from three independent experiments performed in duplicate. *p < 0.05 M4 versus M1, M3, and M5 subtypes. ***p < 0.001 M2 versus M1, M3, and M4 subtypes; M3 versus all subtypes; M5 versus M1, M3, and M4. (C) Expression of M1, M2, M3, and M4 muscarinic receptor subtypes by immunocytochemistry analysis in OPC cultures (2 DIV). The antibodies against muscarinic receptors were revealed using a secondary antibody -Cy3 conjugated. The nuclei were stained with Hoechst 33258 (bar = 50 μm). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

The expression of muscarinic receptor subtypes was then investigated by immunocytochemistry analysis. Although this technique does not allow a quantitative analysis, in OPC M3, M1, and M4 immunoreactivities were stronger than M2 immunoreactivity [Fig. 2(C)]. M1 and M3 subtypes appeared localized in both cell body and processes, whereas the M4 subtype was found only in the cell body [Fig. 2(C)]. All cells present in our cultures; which as mentioned before contain >98% cells of oligodendroglial cell line (about 80% OPC and 20% pre-OLS) resulted positive for muscarinic receptor subtypes.

In mature OLs, M1, M3, and M4 immunoreactivities were barely detectable, suggesting that the expression of these receptor subtypes is strongly decreased during OL differentiation (data not shown; see Supporting Information Fig. 1); however, the expression of M2 receptor in OPC was not substantially modified in mature OLs appearing comparable to the other muscarinic receptor subtypes.

As specific antibodies for M5 subtype were not available, we could not analyze the expression of this muscarinic subtype.

Muscarinic Receptor Agonists Stimulate OPC Proliferation

Previous data indicated that cholinergic agonist carbachol induces OPC proliferation via muscarinic receptor activation (Cohen et al.,1996; Ragheb et al.,2001). As carbachol shows different binding affinity for muscarinic receptor subtypes, and it also binds nicotinic receptors (Peralta et al.,1987), to better characterize the subtypes involved in the control of OPC proliferation, we used the muscarinic receptor agonist muscarine, alone or in combination with selective muscarinic subtype antagonists. First, we observed that 18–24 h of treatment with 10−4M muscarine induced an increase of 3[H]-thymidine incorporation levels [Fig. 3(A)], which was counteracted by the muscarinic antagonist atropine [1 μM; Fig. 3(B)]. Similarly, the M1 antagonist pirenzepine, M3 antagonist 4-DAMP, and M4 antagonist tropicamide significantly reduced muscarine-induced 3[H]-thymidine incorporation, suggesting that these three receptor subtypes mediate cholinergic effects on OPC proliferation. The M2 antagonist gallamine did not significantly influence the muscarine-induced 3[H]-thymidine incorporation, indicating that this receptor is not involved in the control of OPC proliferation [Fig. 3(B)].

thumbnail image

Figure 3. Levels of 3[H]thymidine incorporation in OPC treated for 18 h with 10−4M muscarine alone (A) or in presence of muscarinic antagonists used at concentration close to their Ki inhibition (B). Pirenzepine (10−6M) has been used as antagonist of M1, Gallamine (10−6M) for M2 receptor, 4-DAMP (10−8M) for M3, tropicamide (10−7M) for M4 and atropine (10−6M) was used as muscarinic antagonist. Data represent means ± SEM of three independent experiments, performed in triplicate. (***p < 0.001, muscarine vs. control: atropine vs. muscarine; pirenzepine, 4-DAMP, and tropicamide vs. muscarine).

Download figure to PowerPoint

Cholinergic Modulation of PDGFR-α and ErbB Receptor Expression

Several transcription factors as well as growth factors have been identified in the regulation of OL development. As OPC proliferation is enhanced by platelet derived growth factor type AA (PDGF-AA), to establish whether the muscarinic receptor stimulation may affect the signaling of this growth factor, we evaluated the ability of muscarinic receptors to modulate the expression of PDGFR-α in OPC cultures. Analysis by semiquantitative RT-PCR indicated that muscarine-treatment induces a significant increase of PDGFR-α transcript compared to untreated cells [p < 0.01; Fig. 4(A,B)]. Similar results were obtained by immunocytochemistry analysis [Fig. 4(C)], showing an increased in the receptor protein expression because the percentage of PDGFR-α+ (calculated over the O4 + cells) was significantly higher in muscarine-treated cells (38 ± 2.0) than untreated cells (8.2 ± 0.25) [Fig. 4(D)]. Moreover the staining for PDGFR-α did not always colocalized with O4 [Fig. 4(C), arrow head], confirming that its expression is prevalent in immature cells of the OL lineage.

thumbnail image

Figure 4. Expression of PDGF-α receptor in OPC cultures. A, B. Semiquantitative RT-PCR analysis of PDGF-α receptor transcript in OPC cultures. Panel A shows transcripts corresponding to PDGFR-α and housekeeping GAPDH in mouse neural stem cells as negative control, (lane 1), in untreated OPC (lane 2) and in 10−4M muscarine treated OPC (lane 3). In panel B densitometric analysis of the bands normalized respect to housekeeping gene is reported. **p < 0.01 as compared to control (n = 3). C. Immunocytochemistry analysis of PDGFR-α in OPC maintained in absence (CTR) or in presence of 10−4M muscarine. The PDGFR-α was revealed using a secondary antibody Cy3-conjugated (red). O4 staining was revealed using a secondary antibody FITC-conjugated (green). Nuclear staining was performed using Hoechst 33258 (blue) (Scale bar = 50 μm). D. Quantitative analysis of PDGFR-α +/O4+ cells in OPC cultures maintained in presence or absence of muscarine (musc vs. ctr ***p < 0.001). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Neuregulin 1 (NRG-1) and its receptors ErbB3 and ErbB4 are other important mediators of OL survival and differentiation (Park et al.,2001; Schmucker etal.,2003; Roy et al.,2007; Taveggia et al.,2008). As muscarinic receptor activation modulates the expression and distribution of ErbB receptors in Schwann cells (Loreti et al.,2007), we analyzed, by real time PCR, the expression of the transcripts for ErbB3 and ErbB4 receptors after 24 h of 10−4M muscarine treatment in OPC cultures. As reported in Figure 5(A), the muscarinic receptor activation caused a significant decrease of ErbB3 and ErbB4 transcripts suggesting that ACh, through the muscarinic receptors, may negatively modulate OPC responsiveness to NRG-1. The immunocytochemistry analysis confirmed that ErbB3 expression was decreased in muscarine-treated cells because the percentage of ErbB3+ cells significantly decrease in the muscarine-treated cells (12.7 ± 0.8) as compared to untreated cells (27.4 ± 0.7) [Fig. 5(C)]. Moreover, in treated cells ErbB3 immunoreactivity appeared mainly associated to O4 negative cells, suggesting that ErbB3 receptor was peculiarly expressed in immature cells [Fig. 5(B)].

thumbnail image

Figure 5. Expression of ErbB3 and ErbB4 receptor transcripts by real time-PCR analysis in control and 10−4M muscarine treated OPC cultures. The CT value of each sample was first normalized respect to CT value of the housekeeping gene (GAPDH). The data obtained were then compared to the value of the sample selected as reference (ctr = untreated cells). The data were the means ± SEM (n = 3 independent experiments performed in duplicate). ***p < 0.001 and **p < 0.01 as compared to control (CTR). (B) Immunocytochemistry analysis of ErbB3 in OPC maintained in absence (CTR) or in presence of 10−4M muscarine. The ErbB3 was revealed using a secondary antibody Cy3-conjugated (red). O4 staining was revealed using a secondary antibody FITC-conjugated (green). Nuclear staining was performed using Hoechst 33258 (blue) (Scale bar = 50 μm). (C) Quantitative analysis of ErbB3+/O4+ cells in OPC cultures maintained in presence or absence of muscarine (musc vs. ctr ***p < 0.001). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

M2 Receptor Activation Affects OPC Viability

Although M2 antagonist gallamine did not modify the muscarine induced-proliferation in OPC cells (Fig. 3), the treatment with M2 agonist arecaidine (10−4M) showed a significant decrease of 3[H]-thymidine incorporation (data not shown). To understand this apparent discrepancy, we evaluated OPC survival after 24 h treatment with arecaidine (10−4 − 10−7M). Cell viability was evaluated by assessing the reduction of MTT as general index of the metabolic state of the cells. As reported in Figure 6(A), the M2 agonist arecaidine significantly affected OPC survival, in a dose dependent manner. The toxic effect of arecaidine was counteracted by M2 antagonist gallamine (10−6M), suggesting that M2 receptor is specifically involved in the modulation of OPC survival [Fig. 6(B)]. Finally 3[H]-thymidine incorporation levels was measured after cell incubation with lower doses, of arecaidine [10−5 − 10−7M; Fig 6(C)] and according to the data reported in Figure 3, arecaidine did not significantly modify 3[H]-thymidine incorporation levels.

thumbnail image

Figure 6. Cell viability and proliferation in OPC cultures exposed to M2 agonist and antagonist. Cell viability was evaluated by MTT assay on OPC cultures treated for 18 h with different concentrations of the M2 agonist arecaidine (arec),alone (A) and in the presence of the M2 antagonist gallamine (B). Data are presented as percentages of MTT reduction in control cultures (CRT) and are values ± SEM from n = 3 independent experiments. *p < 0.05 versus control (Ctr); **p < 0.01 versus arecaidine (arec). Levels of 3[H]thymidine incorporation measured in presence of increasing concentrations of arecaidine (C). Data are mean values ± SEM of four independent experiments runs in triplicate.

Download figure to PowerPoint

The toxic effect of arecaidine on OPC was confirmed by evaluating total and dead cell number after 10−4M arecaidine treatment (Fig. 7). Hoechst nuclear staining revealed a higher cell number in control cultures than in arecaidine-treated cultures [Fig. 7(A,D,I)]. In addition, the propidium iodide staining and tunnel assay demonstrated an increase in necrotic [Fig. 7(B,D,L)] and apoptotic [Fig. 7(E–H,L) cell number in arecaidine-treated cultures.

thumbnail image

Figure 7. Cytotoxic effect of arecaidine in OPC cultures. OPC were treated for 24 h with 10−4 M arecaidine (arec). Total cell number was evaluated by Hoechst 33258 nuclear staining (blue); necrotic cells were evaluated by Propidium Iodide staining (red, B,D). Apoptotic cell numbers were evaluated by morphology (nuclear fragmentation) after staining by Hoechst 33258 and by Tunel assay (green, G,H). A, B, E, G, untreated cells (CTR); C, D, F, H: arecaidine treated cells (bar = 50 μm). Data are given as percentage of cells in untreated cultures (Ctr) and are mean values ± SEM of cells counted in 10 fields/coverslip, prepared in duplicate for each condition, in four independent experiments. *p < 0.05 arecaidine (arec) as compared to control (Ctr). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Muscarinic Receptors Modulate the Expression of Myelin Proteins

To evaluate the effects of muscarinic receptor activation on OL differentiation, we analyzed the expression of MBP and of other important myelin proteins, using RNAse protection assay, in OPC and OL exposed for 24 h to 10−4M muscarine. In Figure 8(A), the bands obtained for the transcripts encoding for the 18.5 kDa and 21.5 kDa MBP forms in OPC and mature OLs are reported. The densitometric analysis of the bands, after normalization with RNA 18s, revealed that muscarine treatment induced a decrease of the both MBP transcripts in OPC as well as in mature OLs [Fig. 8(B–E)].

thumbnail image

Figure 8. Expression of MBP transcripts in OPC and mature OLs after 24 h of treatment with 10−4M muscarine treatments. (A) Expression of the 18.5 and 21.5 kDa isoform transcripts of MBP in OPC and mature OLs by RPA. Lane 1, untreated OPC; lane 2, OPC treated with 10−4M muscarine for 24 h; lane 3, untreated mature OLs; lane 4, mature OLs treated with 10−4M muscarine. RNA 18s was used as housekeeping gene. (B) Densitometric analysis of the bands obtained in RPA analysis for 18.5 and 21.5 kDa isoform transcripts of MBP, normalized respect housekeeping 18s. *p < 0.05 and ***p < 0.001 as compared to control (CTR).

Download figure to PowerPoint

Western immunoblotting confirmed the decreased expression of MBP in muscarine-treated cultures [Fig. 9(A)]. Immunocytochemistry analysis also confirmed the reduction in MBP expression on muscarine treatment [Fig. 9(B)]. Given that at 8 DIV all the cells are O4+ while the 85-95% of cells are also MBP+ (see first paragraph), we suggested that following muscarine treatment, the MBP negative cells were likely 04+ cells. The inhibition of MBP expression occurred in the absence of any cytotoxic effect, as indicated by the comparable morphology as assessed by O4 staining, MTT, lactate dehydrogenase (LDH), and crystal violet analyses (data not shown; see Supporting Information Fig. 2).

thumbnail image

Figure 9. MBP espression in mature OL (8 DIV) after 24 h of treatment with 10−4M muscarine. (A) Western immunoblotting for MBP protein. The actin was used to normalize the intensity of the bands; the values of optical density obtained from three independent experiments were also reported; (B) Immunocytochemistry for MBP in mature OLs, maintained in absence or in presence of 10−4M muscarine. The MBP was revealed using a secondary antibody Cy3-conjugated (red); nuclear staining was performed using Hoechst 33258 (blue), O4 staining was revealed using a secondary antibody FITC-conjugated (green). The arrows indicate cells negative for MBP expression in muscarine-treated cultures. (Scale bar = 50 μm). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Finally, we observed that the expression of the myelin proteins MAG, CX32, and MAL, at transcript level, in mature OL, was not significantly affected by muscarine treatment although was observable a trend to increased expression (Fig. 10). The western blot analysis for CX32 has confirmed an increased expression in muscarine-treated OLs [Fig. 10(B,C)]. We have also evaluated the expression of PLP, an other myelin protein expressed in OLs. In this case, the immunoblotting has revealed a faint expression of this protein in mature OLs, which was not modified by muscarine treatment [Fig. 10(B,C)].

thumbnail image

Figure 10. (A) Densitometric analysis of the bands obtained in RPA analysis for MAG, MAL and CX32 in OL cultures maintained in absence or presence of 10−4M muscarine (24 h). The optical density was normalized with 18s bands used as housekeeping gene. The values are the mean ± SEM from three independent experiments. (B) Western immunoblotting for CX32 and PLP. The actin was used to normalize the intensity of the bands; the values of optical density obtained from three independent experiments were also reported in (C) (for CX32 musc vs. ctr ***p < 0.001).

Download figure to PowerPoint

Finally we have observed the expression of Notch-1, an important negative regulator of OL differentiation (Stidworthy et al.,2004; Taveggia et al.,2010). As reported in Figure 11, the analysis of Notch-1 expression by Western blot analysis revealed a band at 120 kDa, indicating the presence of intracellular domain of Notch-1 (NICD). Its expression increased in muscarine-treated cells, confirming that cholinergic stimulation may contribute to inhibit the terminal differentiation of OLs.

thumbnail image

Figure 11. Western immunoblotting for Notch-1 protein. The band at 120 kDa correspond to intracellular domain of Notch (NICD). The actin was used to normalize the intensity of the bands; the values of optical density obtained from three independent experiments were also reported (musc vs. ctr **p < 0.01).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Neurotrophins and growth factors have been known for long time for their crucial functions in nervous system development. However, neurotransmitters can also act as modulators of neuron and glial cell proliferation or differentiation (Stevens and Fields,2000; Ma et al.,2004; Magnaghi et al.,2004; Loreti et al.,2007).

ACh is the first and best-characterized neurotransmitter in both central and peripheral nervous system. Cholinergic receptors are expressed at early stages of nervous system development, in neural stem and progenitor cells as well as in central and peripheral myelinating glial cells (Cohen and Almazan,1994; Rogers et al.,2001; Ragheb et al.,2001; Ma et al.,2004; Loreti et al.,2006).

OLs are known to respond to ACh through nicotinic and muscarinic receptors (Larocca et al.,1987, 1997; Cohen and Almazan,1994; Cohen et al.,1996; Ragheb et al.,2001). In this study, we demonstrate the expression and distribution of muscarinic receptor subtype proteins overall in OPC, demonstrating that their expression was very faint in mature OLs. Moreover, we sought to deepen the knowledge on muscarinic ACh receptors in the biology of the OL lineage, focusing on the effects elicited by selective activation of muscarinic receptor subtypes on OPC proliferation, survival, and OL differentiation. Therefore, we focused the attention on which muscarinic subtypes appear mainly involved in OL physiology.

Besides confirming the expression of all muscarinic receptor subtypes in OPC, we observed that M3, M1, and M4 are the most abundantly expressed. Moreover, for the first time, we report that they are differently distributed at cellular levels, being the M3 and M1 in progenitor cell bodies and processes while the M4 are mainly localized in cell bodies. This different distribution may suggest specific roles of muscarinic subtypes in OL physiology. In addition, the immunocytochemistry analysis showed a reduced expression of M3, M1, and M4 receptors in mature OLs as compared to OPC, suggesting that the activity of these receptors may be mainly required in early stages of OL development. At variance, M2 receptors were expressed at comparable levels in OPC and OL cultures.

Based on these observations, we evaluated the ability of muscarinic receptor to modulate OPC proliferation and survival. Previous studies have shown that muscarinic receptors trigger several transduction pathways in OL cell lineage (MAPK, ERK, PI3K) (Larocca et al.,1987, 1997; Cui et al.,2006). These studies, employed the cholinergic agonist carbachol (Cohen et al.,1996), which has different binding affinities for muscarinic receptors (M2 ≈ M1 > M3 > M4) and binds nicotinic receptors (Peralta et al.,1987). To characterize the muscarinic receptor subtypes involved in OPC proliferation, we took advantage of selective subtype antagonists and evaluated their abilities to counteract the effects induced by muscarine. Our findings confirmed the previous observations and extended them by showing that, in addition to M3 subtype (Cohen et al.,1996), M1 and M4 subtypes significantly contribute to OPC proliferation. The activity of these receptors appears in agreement with the signal transduction pathways activated downstream muscarinic receptor in OPC, as previously reported by other authors (Larocca et al.,1987, 1997; Cui et al.,2006) demonstrating the activation of second messangers (e.g., MAPK/ERK) usually activated by βγ subunits of Gi and Gq proteins associated to M4 and M1/M3 receptor subtypes, respectively.

M2 receptors did not appear involved in OPC proliferation, as indicated by the inability of antagonist gallamine to counteract the muscarine-induced 3[H]-thymidine incorporation. However, in spite of the low expression, activation of M2 receptor by the selective agonist arecaidine reduced OPC survival. The ability of gallamine to prevent the arecaidine-dependent cell impairment and death, suggests a specific involvement of M2 receptors rather than an unspecific toxic effect of arecaidine.

As OPC proliferation is generally dependent on growth factors, among which PDGF-AA, we evaluated the effects of muscarine on PDGFR-α expression. The exposure of OPC to muscarine significantly increased the PDGFR-α expression, suggesting that muscarinic activation may contribute to OPC proliferation also with indirect mechanisms, by increasing the OPC responsiveness to PDGF-AA.

Another important factor regulating OL development is NRG-1 (Canoll et al.,1996; Taveggia et al.,2008, 2010), which through ErbB receptors modulates OL survival, differentiation and myelin protein expression (Park et al.,2001; Schmuchker et al.,2003; Roy et al.,2007). Muscarinic activation negatively modulates the expression of ErbB receptors in OPC cultures, in particular ErbB3, in line with what previously described in Schwann cells (Loreti et al.,2007a). As ErbB receptors usually act as heterodimers, the decreased expression of ErbB3 is likely to result in a general hypo-responsiveness of OPC to NRG-1. PDGFR-α and ErbB3 immunocytochemistry confirmed the trend observed at transcript level as indicated by quantification of immunopositive cell in muscarine treated and untreated cells. In addition, PDGFR-α and ErbB3 immunopositive cultures showed a morphology typically associated to immature forms of OL lineage cells, also indicated by the absence of O4 immunopositivity in these cells. Altogether, these observations suggest that muscarinic receptor activation might favor the maintenance of proliferating OPC. These data are also in agreement with the demonstration that the loss of ErbB signaling contribute to alter OL differentiation and the myelin formation (Roy et al.,2007; Taveggia et al.,2008).

This interpretation is further supported by the inhibition of MBP expression by muscarine, at both transcript and protein levels. Myelin basic protein is one of the most abundant proteins in the CNS (Campagnoni and Campagnoni,2004); its gene gives rise to alternative spliced mRNAs that encode several MBP isoforms, ranging in molecular mass from 14 to 21.5 kDa. Among these, the 18.5 and 21.5 kDa isoforms are the major ones and are described as developmentally regulated. The 21.5 kDa isoform is expressed early during OL development, and downregulated at later stages, whereas the 18.5 kDa isoform appears late during myelination (Campagnoni and Campagnoni,2004). MBP expression appears under the specific control of muscarinic activation, because the reduced expression of 18.5 and 21.5 kDa MBP isoforms occurred in the absence of evident changes in morphology and cell viability (not shown), or in the presence of other myelin protein expression. Indeed, the transcripts encoding for MAG, MAL, and CX32, after muscarine treatment, showed a trend towards an increase, although the effect did not reach statistical significance. The western blot analysis confirmed an increased expression of CX32 in muscarine-treated OLs while the faint expression of PLP was not significantly modified by cholinergic stimulation. CX32 and MAG are the protein components expressed in the Schmidt-Laterman incisure while MBP has an essential adhesive role in the formation of compact myelin; for this reason their expression is often inversely proportional (Smith-Slatas and Barbarese,2000), as observed in our experiments. PLP have a similar function to MBP. The absence of an increased expression of this protein by muscarine may contribute to impair terminal differentiation of OLs. This hypothesis is confirmed by the increased expression of Notch-1 on muscarinic activation. This receptor plays a relevant role in spatial and temporal differentiation of OPCs; in fact, the interaction of Notch-1 with its ligand Jagged-1 inhibits OPC differentiation and myelination (Stidworthy et al.,2004; Zhang et al.,2009; Taveggia et al.,2010).

In conclusion, our results confirm that OLs are cholinoceptive and that ACh, via muscarinic receptor activation, control OL development. In particular, given the dynamic regulation of muscarinic receptor expression during OL maturation, we demonstrate for the first time that OPC are more responsive than OLs to ACh action, and that ACh may promote OPC proliferation through the prevailing activities of M1, M3 and M4 subtypes. Moreover, we also demonstrate new roles for muscarinic receptors in OL development. We found that the M2 receptors could mediate OL lineage cell impairment and damage decreasing OPC survival and demonstrated that the muscarinic receptors expressed in immature OLs may impair their terminal differentiation and myelination.

As previously reported, ACh is produced and released during early neurogenesis in extra-synaptic regions acting as intercellular signal for neurons as well as glial cells (Zhou et al.,2004; Augusti-Tocco et al.,2006; Ma et al., 2006; Simons and Trajkovic,2006), further supporting the possible role of ACh in controlling OPC proliferation slowing their differentiation to OLs.

ACh effects on OLs may be not limited to nervous system development. In the adult CNS, maturation of new OLs is required in neuropathologies where the OL population is impaired and the recruitment of proliferating OPC to the site of lesion has a strategic relevance for remyelination. Noteworthy, muscarinic agonists and antagonists are currently considered for the treatment of neurological and neuropsychiatry disorders where the muscarinic receptor expression and/or OL functionality appear altered (e.g., Alzheimer's disease and schizophrenia) (Felder et al.,2000; Corfas et al.,2004; Wess,2004; Langmead et al.,2008; Tata,2008; Mc Arthur et al.,2010). Given their ability to control glial cell proliferations (Guizzetti etal.,1996; Ragheb et al.,2001; Loreti et al.,2007), their potential therapeutic application in brain tumors (e.g., gliomas and oligodendrogliomas) is recently emerging (Tata et al.,2008, 2010).

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The authors are grateful to Gabriella Augusti-Tocco for her comments and suggestions. Special thanks to Di Bari and Uggenti for technical assistance.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
DNEU_20976_sm_SuppFig1.tif13239KSupporting Information Figure 1
DNEU_20976_sm_SuppFig2.tif6392KSupporting Information Figure 2

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.