Ontogenesis of female-to-male sex-reversal in XX polled goats

Authors


Abstract

The association of polledness and intersexuality in domestic goats (PIS mutation) made them a practical genetic model for studying mammalian female-to-male sex reversal. In this study, gonads from XX sex-reversed goats (PIS-/-) were thoroughly characterized at the molecular and histologic level from the first steps of gonadal differentiation (36 days post coitum [dpc]) to birth. The first histologic signs of gonadal sex reversal were detectable between 36 and 40 dpc (4–5 days later than the XY male) and were mainly characterized by the reduction of the ovarian cortex and the organization of seminiferous cords. As early as 36 dpc, aromatase (CYP19) gene expression was decreased in XX (PIS-/-) gonads, whereas genes normally up-regulated in males, such as SOX9 and AMH, showed an increased expression level from 40 dpc. Thereafter, steroidogenic cell precursors were affected, and at 56 dpc, WNT4 and 3β-HSD were expressed in a male-specific manner in sex-reversed gonads. Another noticeable feature was a progressive disappearance of germ cells, clearly visible in testicular cords around 70 dpc where 50–75% of germ cells were absent in XX (PIS-/-) gonads. These observations indicated that the causal mutation of PIS acts very early in the sex-determining cascade and affects primarily the supporting cells of the gonad. © 2002 Wiley-Liss, Inc.

INTRODUCTION

Testicular differentiation is governed by the Y-chromosome–located sex-determining gene SRY (Sinclair et al., 1990) even though its molecular targets and mechanism of action remain unknown since its discovery in 1990. In 1993, McElreavey and colleagues postulated that SRY could inhibit a Z gene acting as a repressor of the male differentiation pathway (McElreavey et al., 1993). This theory suggests that the critical function of Z is in the ovarian differentiation pathway; therefore, homozygous mutations in Z could be responsible for XX sex reversal in patients without SRY. As for SRY targets, no genes involved in such a pathology have yet been isolated. XX sex reversal has been observed in humans (McElreavey and Fellous, 1999) and in different animal species such as dogs, horses, pigs, and goats (Pailhoux et al., 1997; Meyers-Wallen et al., 1999; Buoen et al., 2000; Vaiman and Pailhoux, 2000). In humans, three types of phenotypes exist: true hermaphrodites, XX males with ambiguities of the external genitalia, and XX males without ambiguities (van Niekerk and Retief, 1981; Manieri et al., 1996). The majority of XX males without ambiguities presents a translocation of the SRY gene on their paternal X chromosome (Petit et al., 1987), whereas among true hermaphrodites and XX males with ambiguities, SRY is rarely present (McElreavey et al., 1992). Rare familial cases of SRY-negative XX sex reversal have been reported, demonstrating the genetic inheritance of this pathology (Skordis et al., 1987; McElreavey et al., 1993). Nevertheless, no linkage analysis studies have yet been published in humans. Consequently, one promising way to find genes involved in XX sex reversal is to investigate domestic species for which genomic tools are now available.

In goats, the dominant mutation P (for “Polled”) results in hornlessness of heterozygous (PIS+/-) and homozygous (PIS-/-) animals of both sexes (Asdell, 1944). On the other hand, in the homozygous condition (PIS-/-), all the genetic females (60,XX) present with sex reversal leading, in most cases, to a male phenotype with ambiguities of external genitalia (Basrur and Kanagawa, 1969; Soller et al., 1969). In a previous study, we have demonstrated that no XX male do not present any Y chromosome sequences, including SRY (Pailhoux et al., 1994). The locus responsible for the genetic disorder Polled/Intersex Syndrome (PIS) was localised on goat chromosome 1 (Chi1q42) (Vaiman et al., 1996). The localisation of the PIS locus has been refined to a 100-kb region homologous to human chromosome 3q23 (Schibler et al., 2000). This region was shown to be involved in the blepharophimosis ptosis epicanthus inversus syndrome (BPES). The forkhead transcription factor FOXL2, located in this region, is mutated in BPES-affected patients (Crisponi et al., 2001). In goats, the PIS mutation corresponds to a 11.7-kb deletion inducing a long-range transcriptional effect on FOXL2 and a noncoding RNA, PISRT1 (PIS-regulated transcript 1) (Pailhoux et al., 2001). To characterize the defects caused by this mutation at the gonadal level, XX sex-reversed fetuses were produced at different developmental stages, by crossing heterozygous (PIS+/-) animals. The molecular and histologic studies performed on these gonads revealed that masculinization of XX (PIS-/-) gonads was detectable at a very early stage of sexual differentiation (40 days post coitum [dpc]). Moreover, the study of expression patterns of certain key genes involved in this process has enabled us to define at which developmental stage the PIS mutation modifies their expression.

RESULTS

Normal Sexual Differentiation in Goats

To define the key steps of sexual differentiation in goats (Fig. 1), we produced normal goat fetuses from horned animals, at 11 developmental stages (from 25 dpc to adulthood). Briefly, in this species, the genital ridges were visible as early as 25 dpc. Morphologic differentiation of the testis was first visible at 36 dpc by the edification of seminiferous cords and tunica albuginea. Moreover, as early as 34 dpc, Sertoli cell differentiation was attested by the presence of anti-Müllerian hormone (AMH), responsible for Müllerian duct regression, which started at 46 dpc. Between seminiferous cords, testosterone-producing Leydig cells were first observed at 40 dpc. The masculinization of external genitalia started 2 days later, whereas the differentiation of internal androgeno-dependent structures (seminal vesicles and prostatic buds) occurred at 56 dpc. The epididymis and vas deferens stimulation took place at 70 dpc. In the female, the beginning of ovarian cortex development was observed at 36 dpc, concomitant with germ cell multiplication below the coelomic epithelium and P450 aromatase (CYP19) gene expression, which is responsible for estrogen production. The meiosis prophase of germ cells and folliculogenesis, considered as key features of ovarian development, started around 55 and 90 dpc, respectively.

Figure 1.

Sexual differentiation in goats. The central arrow represents the developmental axis with critical stages given in days post coitum (dpc). The upper part depicts male differentiation with its main events and the expression profiles of SRY and AMH genes. The lower part concerns the female pathway with the expression profiles of AMH and Aromatase (CYP19) genes.

First Gonadal Defects of XX PIS-/- Mutants Are Visible Between 36 and 40 dpc

To investigate the time course of pathologic features of intersex gonads, we produced XX PIS-/- fetuses and born animals (IS) at nine developmental stages between 36 dpc and 60 days postpartum (Table 1). The sex-reversal condition was deduced from (1) the phenotypic sex observed at the time of dissection, (2) the chromosomal sex, (3) the gonadal histology and immunohistochemistry with AMH antibodies, (4) the genotype of the genetic markers adjacent to the PIS mutation. At 36 dpc, no histologic differences were observed between the XX (PIS-/-) gonads and the controls (not shown). But by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, CYP19 expression was decreased in these XX (PIS-/-) gonads when compared with normal XX (PIS+/+ or PIS+/-) gonads (Fig. 6A). By contrast, the five 40-day-old XX (PIS-/-) fetuses showed significant modifications of the presumptive ovaries characterised mainly by the reduction of the ovarian cortex and the formation of seminiferous cords and tunica albuginea (no differences in germ cell number or aspect can be noticed). These gonads, resembling those of 36-day-old normal XY male testes (Fig. 2A,B), contained Sertoli-like cells producing AMH detectable both by immunohistochemistry (Fig. 2C), and RT-PCR analysis (Fig. 6B). With this last approach, it appeared that XX sex-reversed gonads of 40 dpc presented a high level of SOX9 mRNA compared with normal XX females (Fig. 6B). In contrast with this early masculinization of supporting cells, WNT4, normally more expressed in female than in male interstitial cells, remained strongly expressed in intersex at 40 dpc (Fig. 6B) and also at 44 dpc (data not shown). At all observed stages, no differences were noted between males whatever their genotypes (PIS+/+, PIS+/-, or PIS-/-).

Table 1. Summary of Animals Studieda
Stage (dpc)No. of fetusesNo. of femalesNo. of intersexesNo. of intersexes
  • a

    dpc, days post coitum; dpp, days post partum.

3626161343
4024135250, 252, 258, 304, 237
4417112178, 182
501461230
5616113100, 103, 107
70632311, 313
5, 25, 60 dpp853127, 308, 306
Figure 2.

Normal and XX (PIS-/-) mutant gonads at 40 days post coitum (dpc). A,B: Histologic aspect (Tuchmann du Plessis staining). The male and the sex-reversed gonads display the first signs of seminiferous cord (s) and tunica albuginea (a) differentiation. The normal XX gonad is characterized by the beginning of ovarian cortex (c) formation, surrounding a central unorganized blastema. C: Immunoperoxidase detection of anti-Müllerian hormone (AMH). A signal is detected in the Sertoli cells of developing seminiferous cords in male and XX sex-reversed animals. Scale bars = 20 μm in A, 10 μm in B, 25 μm in C.

Variable Phenotypes Are Observed as Early as 56 dpc

At this stage, the gonads of two XX (PIS-/-) sex-reversed fetuses (IS103, IS107, Table 1) were histologically similar to XY gonads with a tunica albuginea, seminiferous cords, and interstitial cells (see IS 103 of Fig. 3A,B). Moreover, a basal lamina surrounding the cords was clearly visible after Tuchmann du Plessis coloration, attesting the presence of peritubular cells.

Figure 3.

Gonads and external genitalia of 56-day-old normal and XX (PIS-/-) sex-reversed fetuses. A,B: Sections of normal and sex-reversed gonads (Tuchmann du Plessis staining, except the female lane B stained with hematoxylin-erythrosin and observed with the Nomarski procedure). The XY male gonad is characterized by well-differentiated seminiferous cords (s) surrounded by a wide tunica albuginea (a). These cords are mainly composed of Sertoli cells encompassing some germ cells in mitotic arrest (arrowheads). The control XX female shows an ovarian cortex (c) full of meiotic (leptoten and zygoten) germ cells (arrows). The XX mutant gonad (IS 100) displays ovotestis with both a reduced ovarian cortex (c) and some underdifferentiated seminiferous cords (s). The second XX sex-reversed gonad (IS 103) is indistinguishable from the XY male control. C: Immunoperoxidase detection of anti-Müllerian hormone (AMH) protein. The presence of AMH is clearly detected in IS 103 and the control male but significantly lower in IS 100. D: External genitalia fixed in Bouin's fluid. The control male and IS 103 have a well-developed scrotum (sc) and a penis (p) in its terminal location under the umbilicus. The control XX female has a clitoris (cl) and a urogenital orifice near the anus. The IS 100 has an ambiguous external genitalia with a penis-like structure (p) and an increase of the anogenital distance. Scale bars = 50 μm in A and C, 10 μm in B, 2 mm in D.

One of the most important genes involved in steroidogenesis, the 3-beta-hydroxysteroid dehydrogenase gene (3β-HSD), which is normally more expressed in male than in female gonads, displayed a male-type expression level in XX (PIS-/-) sex-reversed gonads attesting Leydig cell differentiation, and production of testosterone from androstenedione (Fig. 6B).

The other fetus analyzed (IS100) showed a hermaphrodite-type fetal gonad with underdeveloped seminiferous cords in the central blastema, containing germ cells in mitotic arrest (Fig. 3B). This testicular-like part, resembling that of a 36-dpc XY male, was separated from a cortical ovarian-like area, by a thin layer that looked like a tunica albuginea (Fig. 3A). The reduced ovarian cortex contained germ cells either in meiotic prophase or showing a degenerating nuclear appearance. Expression analysis of investigated genes showed a pattern of testicular type in the three XX sex-reversed gonads. SOX9, AMH, and 3β-HSD genes were significantly overexpressed but with variable levels, whereas WNT4 and CYP19 gene expression was suppressed (Figs. 3C, 6B). In the three XX (PIS-/-) fetuses, internal and external genitalia masculinization was related to the degree of gonadal masculinization. The Müllerian duct regression started in IS 103 and 107, but not in IS 100, correlating perfectly with the level of AMH production (Fig. 3C). The lowest masculinization of external genitalia was observed for IS 100, which had the lowest transcription level of 3β-HSD and maintained a slight expression of WNT4 (Figs. 3D, 6B).

Germ Cells Disappear Between 56 and 70 dpc

Similarly to the situation at 56 dpc, the degree of masculinization of gonads and genital tracts was different in the two 70 dpc XX sex-reversed fetuses. Both presented a well-developed testicular tissue in the central part of the gonad, but in one case (IS 311), a reduced ovarian cortex was retained (Fig. 4A,B). The most important feature observed at this stage was a dramatic decrease (50 to 75%) in the germ cell number in seminiferous cords, clearly visible after AMH detection (see negative spot in Fig. 4C). The remaining germ cells entered meiosis when located either in the ovarian cortex (IS 311) or in the albuginea-like structure (IS 313). Those located in the seminiferous cords were in mitotic arrest (Fig. 4B). The number of germ cells continued to decrease until birth, and very few could be seen at 25 days post partum (dpp) (Fig. 5A,B). Among the two XX sex-reversed animals studied after birth, all gonads were composed of testicular tissue without any ovarian tissue (Fig. 5A,B). Another important feature of the PIS sex reversal was the presence of internal androgeno-dependent structures illustrated by the development of epididymis and prostate in XX sex-reversed fetuses at 70 dpc. As for the external tract, this process appears related to the degree of gonad virilization (Fig. 4D,E). The last characteristic observed at 70 dpc was the high expression level of the claudin 11 gene found in XY and XX sex-reversed gonads (Fig. 6B). The expression profiles of the other studied genes remained male specific in XX (PIS-/-) sex-reversed gonads at this stage and also after birth (Fig. 6B).

Figure 4.

Gonads and internal genital organs of 70 days post coitum (dpc) XX (PIS-/-) mutants. A,B: Histology of the gonads (Tuchmann du Plessis staining). In the XY male, organogenesis of seminiferous cords (s) is now achieved. They contain numerous spermatogonia (arrowheads) in mitotic arrest. The cords are isolated from the interstitial tissue by the layer of interconnected Sertoli cells polarized against the basal lamina. The XX female gonad shows a voluminous ovarian cortex (c) with numerous meiotic (zygoten and pachytene) germ cell nests (arrows). The IS 311 is a hermaphrodite with well-developed seminiferous cords (s) in the central part, separated by an albuginea (a) from an external reduced ovarian cortex (c). The IS 313 presents a similar structure to the XY testis except for the presence of meiotic germ cells in the albuginea (arrow). For both sex-reversed gonads, germ cells included in seminiferous cords are in mitotic arrest (arrowheads). C: Immunofluorescent detection of anti-Müllerian hormone (AMH). Similar signals are observed in both XX sex-reversed and XY male gonads. Note the reduced number of germ cells (large AMH negative spots) in the seminiferous cords of sex-reversed gonads compared with control XY. D,E: Development of androgeno-dependent structures of the internal genital tract (Tuchmann du Plessis staining). A well-developed Wolffian duct (W) and epididymis (e) are observed in normal XY and in both XX sex-reversed fetuses. Mullerian duct (M) is maintained only in XX female and XX IS 311 fetus. The number and development of prostatic buds (Pb) are identical in the normal XY and the XX IS 313 but less developed in the XX IS 311. Scale bars = 50 μm in A, 10 μm in B, 25 μm in C, 100 μm in D,E.

Figure 5.

Histology of normal and XX (PIS-/-) mutant gonads after birth. A: Histology of control and intersex gonads (5 and 25 days post partum [dpp], respectively, Tuchmann du Plessis staining). During the perinatal period, the number of spermatogonia (arrowheads) is reduced in XY control (compared with 70 days post coitum [dpc], see Fig. 4) and almost completely absent in IS 127 testis. The XX control ovary is composed of an ovarian cortex (c) containing follicles at different stages including antral follicles (af). B: Immunofluorescent detection of anti-Müllerian hormone (AMH). After birth, the granulosa cells of ovarian follicles produce AMH as the Sertoli cells in the seminiferous cords (S) of XY and IS 127 testes. Scale bars = 50 μm in A,B.

Figure 6.

Reverse transcriptase-polymerase chain reaction analysis of genes involved in testis- or ovary-determining pathways. Expression patterns from gonads of males, females, and XX sex-reversed animals at different stages. A: Gonads at 36 days post coitum (dpc), ethidium bromide staining. B: From 40 dpc to 60 days post partum gonads. PCR products have been Southern blotted, hybridised, then autoradiographed. ND, not determined.

DISCUSSION

Sex-Reversal in XX (PIS-/-) Goats Occurs Early in Gonad Development and Affects Supporting Cell Lineage

Detailed knowledge about the genetics of the polled mutation in goats was used to produce intersex fetuses at crucial steps of sexual differentiation (36 dpc, 40 dpc, 56 dpc, 70 dpc). Reports in the scientific literature previously have stressed the extremely masculinized phenotype of adult XX sex-reversed polled goats compared with XX sex reversal in other mammalian species such as dogs and pigs (Soller et al., 1969; Meyers-Wallen and Patterson, 1988; Pailhoux et al., 1997). Accordingly, we found a very early onset of sex reversal in goat XX (PIS-/-) gonads. Histologic observations showed that cord formation was only delayed by 4–5 days compared with normal XY testis differentiation (40 dpc vs. 35 dpc). Thereafter, the structure of the XX (PIS-/-) testes was very similar to XY testes until birth. These histologic data were confirmed by the transcription analysis of several genes involved in the sex determination cascade.

The first effect of the PIS mutation was a reduction in aromatase expression as early as 36 dpc. Aromatase (CYP19), which converts androgens into estrogens in follicle precursor cells in the ovarian context, has been shown to play a very important role in many vertebrate species. In turtles and birds, aromatase inhibitor administration leads to gonadal sex reversal (Abinawanto et al., 1996; Belaid et al., 2001; Vaillant et al., 2001). In bovids, in contrast to mice, CYP19 expression was detected early in the fetal ovary, at the same stage as AMH in the fetal testis (Payen et al., 1996; Quirke et al., 2001). CYP19 presents with a limited expression window in ruminants, starting from the sex-determination period and culminating before the onset of meiosis. Its down-expression in goat XX sex-reversed gonads is correlated with the first histologic sign of gonadal de-feminization: the reduction of the ovarian cortex. Mice lacking aromatase activity (ARKO) have been produced by targeted disruption of Cyp19 (Toda et al., 2001) and showed a depletion of ovarian follicles without any sign of sex reversal. The interspecific discrepancy described here between rodents and ruminants could result from the absence of aromatase expression in mice before birth (Greco and Payne, 1994).

Parallel to this study, we have recently shown that expression of FOXL2 was dramatically inhibited as early as 36 dpc in XX (PIS-/-) sex-reversed gonads and was probably the cause of the sex-reversal phenotype (Pailhoux et al., 2001). FOXL2 normally expressed in follicular cells (Crisponi et al., 2001; and our unpublished observations) could directly or indirectly regulate the expression of aromatase in these cells.

In our study, the up-regulation of “male” genes in the XX (PIS-/-) gonads was observed between 36 and 40 dpc instead of 32–35 dpc during normal testicular differentiation. SOX9, which is a primary testis-differentiating gene, is capable of triggering male differentiation (Foster et al., 1994; Wagner et al., 1994; Morais da Silva et al., 1996; Vidal et al., 2001), directly activating AMH gene transcription (De Santa Barbara et al., 1998; Arango et al., 1999). In contrast to SRY, SOX9 is highly conserved among amniotes and expressed exclusively in Sertoli cells. To date, no intermediate has been found between SRY and SOX9. The up-expression of SOX9 very early in XX (PIS-/-) fetuses is consistent with the fact that the supporting cell lineage is first affected by PIS mutation and that gene(s) disrupted by this mutation rank(s) high in the cascade of sex-determination. After the increase of SOX9 expression, AMH is also strongly up-regulated in XX (PIS-/-) intersex gonads as early as 40 dpc. AMH has been shown to inhibit CYP19 expression in rat and sheep fetal ovaries (Vigier et al., 1989; Rouiller-Fabre et al., 1998), but here the down-regulation of aromatase expression precedes the AMH appearance. Despite this second rank, AMH could participate in the complete cutoff of CYP19 expression. Absence of aromatase activity results in the secretion of testosterone instead of estrogens. AMH and testosterone then work together to constitute the male internal and external phenotype.

In contrast to supporting cell markers, the expression of steroidogenic-cell specific genes such as WNT4 and 3β-HSD was not clearly affected at 36, 40, and 44 dpc. A significant difference in their expression was only observed at 56 dpc. Accordingly, the steroidogenic cells are affected by the PIS mutation after Sertoli cell differentiation that occurred at 40 dpc.

Among other cells contributing to the interstitium, vascular endothelial cells and peritubular myoid cells migrate into the testis from the mesonephros (Buehr et al., 1993; Martineau et al., 1997). Capel and coworkers have shown that Sry is essential to this mesonephric cell migration (Capel et al., 1999; Schmahl et al., 2000) that is necessary for testicular cord formation and is absent in the ovary-determining pathway. From sections of XX (PIS-/-) testes followed by Tuchmann du Plessis coloration, peritubular myoid cells could be observed surrounding the cords producing the basal lamina in association with Sertoli cells. We show, therefore, that mesonephric cells migrated into the gonads without the presence of SRY. This result seems to indicate that FGF9, the growth factor responsible for this migratory process (Colvin et al., 2001), is up-regulated in the testis by a gene acting downstream of SRY. SOX9, which induces a complete masculinization of the gonads in XX transgenic mice (Vidal et al., 2001), seems to be the best theoretical candidate for FGF9 up-regulation.

In the PIS phenotype, sex reversal occurred very early in the supporting cells of the developing gonad and is completely different from freemartinism, where masculinization results from AMH exchanges much later in fetal life (Vigier et al., 1984). In this later case, AMH destroyed meiotic germ cells leading to follicular/ Sertoli cells transdifferentiation.

How to Explain the Variability of Phenotypes Visible as Early as 56 dpc?

In the polled goat model, the same mutational event induces a variable masculinization of XX (PIS-/-) sex-reversed gonads detectable as early as 56 dpc. Contrary to the dog XX sex-reversal model (Meyers-Wallen et al., 1994), this variability in goats was not due to a delay in the timing of the mutated gene expression, because all five sex-reversed fetuses studied at 40 dpc presented a similar degree of sex-reversal. The starting point was the same but, with time, the magnitude of the defects varied.

Variable phenotypes have been encountered in many cases of sex-reversal, like Sry-associated sex reversal in mice (Eicher et al., 1982), SOX9-associated sex reversal in humans (Sinclair, 1998), and recently, Fgf9-associated sex reversal in mice (Colvin et al., 2001). In this case, Fgf9 disruption in XY fetuses leads to phenotypes ranging from testicular hypoplasia to complete sex reversal. The sex-determining pathway is governed by several genes having a very subtle gene dosage such as WT1, SOX9, DAX1 (Veitia et al., 2001), and all slight modifications of this dosage could affect gonadal differentiation and be at the origin of the variability of masculinization observed here.

Why Did Germ Cells Die in XX (PIS-/-) Sex-Reversed Gonads?

An invariable feature of XX (PIS-/-) sex-reversed gonads is the fact that testicular parts are always devoid of germ cells in the adult. One aim of this study was to determine the critical developmental stage of germ cell loss. Surprisingly, germ cell loss seems to be an ongoing process occurring from the moment when female germ cells enter meiosis (56 dpc) until birth. Similar results have been described in both XXSxr and XXY mouse testes, where germ cell number significantly decreased in the early stages of testis differentiation and was absent after birth (McLaren, 1981, 1983; Hunt et al., 1998). It seems that germ cell loss could principally be due to an altered X-chromosome dosage. Indeed in normal females, the XX PGCs undergo X-inactivation at the onset of migration from the gut endoderm and re-activate the silenced X-chromosome when they enter the urogenital ridge. In XX sex-reversed testis, germ cells do not enter meiosis, they undergo X-chromosome reactivation at the same time as XX germ cells in ovary (McLaren and Monk, 1981). It has been postulated that the presence of two active X-chromosomes was incompatible with both prenatal and postnatal male germ cell development, suggesting also that the regulation of X-chromosome activity is independent of ovarian morphogenesis.

Another factor that could explain the loss of germ cells in these XX (PIS-/-) gonads is the presence of AMH. Indeed, it has been demonstrated that fetal rat ovaries cultured in the presence of AMH show massive loss of germ cells around the time of onset of meiotic prophase (Vigier et al., 1987). Similar results have also been observed in mouse by transgenesis experiments (Behringer et al., 1990; Lyet et al., 1995). The inhibitory effect of AMH on meiotic germ cells could be responsible for the loss of germ cells located in the ovarian part of ovotestes. Indeed, we showed that these germ cells enter meiosis as in normal female gonads (around 56 dpc) but concomitantly, XX Sertoli-like cells present in the testicular part of the same gonad produce AMH. Meiotic germ cells, therefore, could be destroyed by AMH (synthesized by Sertoli cells), causing prefollicle cells to disappear or to transdifferentiate. This mechanism could explain why the ovarian parts observed during fetal life were generally missing at adulthood.

In conclusion, female-to-male sex reversal in polled goats results from a unique mutational event that affects early gonadal differentiation. In XX (PIS-/-) gonads, ovarian differentiation does not occur, either because it is not initiated, or because it is arrested by a missing element of the cascade. The second hypothesis seems to be more likely, because the aromatase gene is faintly expressed in XX (PIS-/-) gonads at 40 dpc, attesting the beginning of ovarian determination. After the female pathway blockage, the testis-determining pathway is started and SOX9 seems to be the conductor. This finding suggests that the missing elements in XX (PIS-/-) gonads enabled male genes to be expressed and that their normal counterpart inhibited male differentiation during ovary development. These findings are in complete agreement with the Z hypothesis (McElreavey et al., 1993), except that Z in this case is not a gene but a regulatory element acting on at least two genes (Pailhoux et al., 2001). Investigations are currently in progress to understand the role of the three different actors of the PIS locus: the PIS regulatory element, PISRT1, and FOXL2.

EXPERIMENTAL PROCEDURES

Animals and Treatments for Recovering Fetuses

To obtain normal and sex-reversed fetuses, a herd of hornless animals was produced. This herd was composed of 4 bucks and 23 females. All 27 animals were heterozygous (PIS+/-) for the PIS locus.

Oestrus cycles of all animals were synchronized by using intravaginal progestagen sponges impregnated with fluorogestone acetate (FGA, Chronogest N.D., Intervet). The 45-milligram FGA sponges were placed for 11 or 13 days, followed by an intramuscular injection of 400 U of pregnant mare serum gonadotropin and 50 μg PgF analogue, cloprostenol (Estrumate N.D., Schering-Plough), the day of sponge withdrawal. Goats were checked for oestrus at 8-hr intervals from 36 to 72 hr after sponge removal. Day 0 post coitum corresponds to the day of mating.

Gestation was diagnosed by plasma progesterone assay at 21 dpc and/or transabdominal echography after 30 dpc, with a 5 MHz probe (Aloka N.D.). The goats were delivered by classic caesarean mid-line section. Animals were anaesthetized by intramuscular injection of atropin sulfate (250 μg/kg) and xylazine (0.2 mg/kg, Rompun N.D., Bayer) 15 min before intravenous administration of ketamine (3 mg/kg, Clorketam 1,000 N.D., Vetoquinol).

In total, 86 fetuses were collected at six different developmental stages and 3 sex-reversed animals were also observed during the prepubertal period (Table 1). Among 49 XX fetuses, 12 intersexes were detected, which fits well with the expected ratio of 1/4 of homozygous (PIS-/-). The chromosomal sex of all fetuses was determined by PCR analysis. Genomic DNA was extracted from the liver and used to test two genes of the Y chromosome (SRY and ZFY) and one of the X chromosomes (ZFX) (Aasen and Medrano, 1990). DNA was also used to determine the genotype of all fetuses for two genetic markers (Pailhoux et al., 2001) encompassing the PIS locus, to deduce their status with regard to the PIS mutation. For all fetuses, one gonad was frozen in liquid nitrogen for molecular analysis, the other one was used for immunocytochemical reactions and histologic study.

RNA Extraction and DNAse Treatment

Total RNA was extracted from gonads by using RNA-Plus solution (Bioprobe Systems) then quantified with a spectrophotometer at 260 nm. Twenty micrograms of each sample was treated with 40 U of DNaseI, RNase free (Roche), for 2 hr at 37°C, to avoid genomic DNA contamination. After phenol/chloroform extraction and ethanol precipitation, the Dnase-treated RNA was resuspended in 20 μl of RNase-free water. An aliquot of 1 μg was electrophoresed on a 1% agarose gel to verify the quality and the quantity of each sample.

Reverse Transcription Assays and PCR

Five micrograms of Dnase-treated RNA were mixed with 7.5 μM of random hexamers (Roche), heated to 65°C for 10 min, then placed on ice. A reaction mix containing 200 U of Superscript II RNase H-reverse transcriptase (Gibco-BRL), 1 mM of each dNTP, 20 U of RNase inhibitor (Roche), and 2 μCi of α-32PdCTP (Amersham Pharmacia Biotech) was added to each sample. The reaction was carried out at 42°C for 50 min, followed by a 5-min denaturation step at 95°C. An aliquot of 2 μl was electrophoresed on a 1% agarose gel, then fixed with 10% trichloroacetic acid, dried, and autoradiographed. These autoradiograms make it possible to control the quality (length of cDNA) and the quantity of the RT reaction. For each independent series (same developmental stage), only samples with a comparable autoradiogram signal were used for PCR amplification.

One-tenth (2 μl) of RT mix was amplified in 50 μl of PCR reaction by using 0.5 U of Taq polymerase (TaKaRa), 200 μM of each dNTP, and 150 nM of each primer. PCR conditions and primer sequences for each gene are given in Table 2. After amplification, 10 μl of each sample were electrophoresed on agarose-TBE gels then Southern blotted on nylon N+ membrane (Amersham Pharmacia Biotech). The blots were probed with an internal oligonucleotide radiolabeled with [α-32P]ATP, specific to each gene studied (Table 2).

Table 2. Primers and PCR Conditionsa
GenePrimer sequencesConditionsCyclesMgCl2 (mM)Other
  • a

    PCR, polymerase chain reaction; DMSO, dimethylsulfoxide.

SOX9CATGAGCGAGGTGCACTCCC94°C-30 sec.
GTAGGTGACCTGGCCGTGCG58°C-30 sec.322,55% Formamide
ProbeGGCAAGGCTGACCTGAAGCG72°C-30 sec.
CYP19CTGTCGTGGACTTGGTCATG94°C-30 sec.
GGGGCCCAAAGCCAAATGGC58°C-30 sec.301,5
ProbeCCCCAAACCCAATGAATTTAC72°C-30 sec.
AMHAAGGCGCTGCAGGGCCTGCG94°C-30 sec.2,5% DMSO
CACCACGTGGTTGCCGTAGC58°C-30 sec.301,52.5% Formamide
ProbeGGTTGCGGTCGGACTGAGGC72°C-30 sec.
β-actinCATCCGTAAAGACCTCTATGCC94°C-30 sec.
TAGAGCCACCAATCCACACAG55°C-30 sec.302,5
ProbeCCACCATGTACCCTGGCATC72°C-30 sec.
WNT4TACGCCATCTCTTCRGCAGG94°C-30 sec.
CACTTGCAYTCCACCCGCATG58°C-30 sec.322
ProbeTTCCAGTGGTCAGGATGCTC72°C-30 sec.
claudin 11GGAYGARCTGGGCTCCAAGGG94°C-30 sec.
GGCGCAGAGAGCCAGCAGAAT58°C-30 sec.301,5
ProbeCCTGGTGGACATCCTCATCC72°C-30 sec.
3β-HSDGTGACAGGAGGAGGAGG94°C-30 sec.
AGGAAGCTCACTATTTCCA58°C-30 sec.281,5
ProbeGGCCTGGGCCCACATTCTGG72°C-30 sec.

Histologic and Immunohistochemical Processing

Freshly dissected gonads and genital tracts were fixed in Bouin's fluid for 24 hr, dehydrated, embedded in paraffin, and sectioned at 7 μm. One of every 10 sections was mounted and stained with hematoxylin-erythrosin or according to the trichrome technique of Tuchmann du Plessis.

The posterior part of the gonad was fixed in paraformaldehyde 4% in phosphate saline buffer (PBS) 2–4 hr at 4°C. After washing in PBS with increasing concentrations of sucrose (0, 12%, 15%, and 18%), tissue specimens were embedded in Tissue-Tek O.C.T. compound (Leica France) and frozen at −80°C. Cryostat sections (7 μm thick) were mounted on poly-L-lysine–coated slides and stored at −20°C.

AMH indirect immunodetection was performed on PBS-rehydrated sections incubated for 2 hr at room temperature with a primary rabbit polyclonal anti-bovine AMH antibody (Vigier et al., 1985) and then with a second biotinylated polyvalent antibody revealed by streptavidin-peroxidase (horseradish peroxidase/diaminobenzidine) according to the manufacturer's instructions (UltraVision Detection System Polyvalent, Lab Vision Co., Microm France). In some cases, the second antibody was revealed by immunofluorescence by using streptavidin–fluorescein isothiocyanate (Pierce, Perbio France) instead of streptavidin-peroxidase.

Acknowledgements

We thank Jean-François Alkombre and Jean Hervieu for goat herd management and Christian Poirier for his assistance during surgical operations.

Ancillary