SEARCH

SEARCH BY CITATION

Keywords:

  • fibroblast growth factor receptor;
  • neural crest;
  • cartilage;
  • electroporation;
  • quail

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Activating mutations in human fibroblast growth factor receptors (FGFR) result in a range of skeletal disorders, including craniosynostosis. Because the cranial bones are largely neural crest derived, the possibility arises that increased FGF signalling may predispose to premature/excessive skeletogenic differentiation in neural crest cells. To test this hypothesis, we expressed wild-type and mutant FGFRs in quail embryonic neural crest cells. Chondrogenesis was consistently induced when mutant FGFR1-K656E or FGFR2-C278F were electroporated in ovo into stage 8 quail premigratory neural crest, followed by in vitro culture without FGF2. Neural crest cells electroporated with wild-type FGFR1 or FGFR2 cDNAs exhibited no chondrogenic differentiation in culture. Cartilage differentiation was accompanied by expression of Sox9, Col2a1, and osteopontin. This closely resembled the response of nonelectroporated neural crest cells to FGF2 in vitro: 10 ng/ml induces chondrogenesis, Sox9, Col2a1, and osteopontin expression, whereas 1 ng/ml FGF2 enhances cell survival and Sox9 and Col2a1 expression, but never induces chondrogenesis or osteopontin expression. Transfection of neural crest cells with mutant FGFRs in vitro, after their emergence from the neural tube, in contrast, produced chondrogenesis at a very low frequency. Hence, mutant FGFRs can induce cartilage differentiation when electroporated into premigratory neural crest cells but this effect is drastically reduced if transfection is carried out after the onset of neural crest migration. © 2002 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Neural crest (NC) cells arise from the tips of the neural folds during early embryonic development and migrate throughout the body, giving rise to a diverse range of cell types including neurons, melanocytes, and glia. However, only cranial NC cells are capable of differentiating into cartilage and bone (Selleck et al., 1993) with NC cells forming a major part of the skull and facial skeleton, including the sutures (Couly et al., 1993). Patency of the sutures enables the growing brain to be accommodated within the developing skull but premature sutural fusion (craniosynostosis) limits brain growth, distorting craniofacial development and leading in some cases to disfiguring malformations and mental deficiency (Cohen, 1993).

A growing list of human skeletal disorders, including several craniosynostosis syndromes, have been associated with mutations in fibroblast growth factor receptors (FGFR)-1, -2, and -3 (Passos-Bueno et al., 1999). Other genes associated with craniosynostosis include TWIST in Saethre-Chotzen syndrome (Jabs et al., 1993) and MSX2 in Boston-type craniosynostosis (Howard et al., 1997).

FGFR mutations identified in craniosynostosis are all thought to produce in-frame alterations of the FGF receptor, such that a functional but constitutively active receptor results (Webster and Donoghue, 1997b). Mutant receptors may be ligand-independent, display an increased ligand affinities (Anderson et al., 1998) or exhibit altered ligand specificities (Yu et al., 2000). The effect of these FGFR mutations appears to be an abnormal hyperactivation of FGF signalling (Webster and Donoghue, 1996; Naski et al., 1996) and transformation of NIH3T3 cells in vitro (Galvin et al., 1996; Webster et al., 1996; Webster and Donoghue, 1997a, b; Robertson et al., 1998).

The effect of FGFR mutations on NC cells and their derivatives in the cranial sutures, is not fully understood. Exposure of sutural cells to increased concentrations of FGF results in premature bony fusion (Iseki et al., 1997; Kim et al., 1998), suggesting that increased FGF signalling by mutant FGFRs, may lead to accelerated and/or excessive skeletogenesis. This finding is supported by our observations that FGFRs are expressed in early migrating cranial NC cells (Sarkar et al., 2001) and that a high (10 ng/ml) but not a low concentration (1 ng/ml) of FGF2 can induce chondrogenesis and osteogenesis in NC cells in vitro (Sarkar et al., 2001). Both membrane and endochondral bone were formed by NC cells in these studies. Consistent with these observations, reduction of FGF signalling by an anti-FGF2 blocking antibody inhibits skeletogenesis in chicken calvarium (Moore et al., 2002).

In the present study, we have extended these studies to examine directly the effects of mutated FGFRs on avian NC differentiation. By transfecting FGFR constructs into premigratory quail NC cells by in ovo electroporation, we demonstrate that mutant FGFRs induce chondrogenic differentiation, whereas wild-type FGFRs lead only to proliferation and enhanced survival of the NC cells. These findings support the hypothesis that FGFR activating mutation leads directly to the enhanced cranial skeletogenesis seen in craniosynostosis.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Chondrogenesis in NC Cells Electroporated With Mutant FGFRs In Ovo

We investigated whether expression of mutant FGF receptors in cranial NC cells can drive cartilage differentiation in the absence of FGF2. To test the effectiveness of delivering DNA by electroporation into premigratory midbrain NC cells, stage 8 quail embryos were electroporated with RCAS-alkaline phosphatase DNA or pEGFP-N1 plasmid DNA. We found that exogenous DNA can be delivered into premigratory NC in ovo (Fig. 1A) and that the electroporated DNA continues to be expressed in NC cells during migration in vivo over a 48-hr period (Fig. 1B,C). NC cultures established immediately after electroporation express alkaline phosphatase and GFP 48 hr after explantation with a maximum efficiency of 90% but with an average frequency of 29.3% (Fig. 1D–G).

thumbnail image

Figure 1. In ovo electroporation of stage 8 quail embryos by using the RCAS-alkaline phosphatase or pEGFP-N1 expression vectors. Twenty-four hours after electroporation with RCAS-alkaline phosphatase into neural plate cells, extensive exogenous alkaline phosphatase activity is seen in the neural folds that have not yet closed (arrows in A), whereas 48 hr after electroporation, migrating neural crest (NC) cells (arrows in B,C) express alkaline phosphatase. D: NC cells cultured immediately after electroporation show similar widespread alkaline phosphatase activity at 48 hr. E: NC cells explanted from embryos electroporated with pEGFP-N1 express GFP 48 hr after explantation. F: Same field as in E photographed by using phase-contrast optics. G: The percentage of NC cells expressing alkaline phosphatase or EGFP in vitro 48 hr after in ovo electroporation, varies from 0 to 90% with an average transfection rate of 29.3%. fb, forebrain; mb, midbrain; hb, hindbrain; s, somites; nf, neural fold. Scale bars = 100 μm in A–F.

Download figure to PowerPoint

Next, we electroporated neural tubes of stage 8 quail embryos, in ovo, with mutant and wild-type FGFRs before dissecting and culturing the mesencephalic NC in the absence of FGF2. After 15 days of culture, NC cells from nonelectroporated embryos were sparse and exhibited a flat morphology (Fig. 2A). Cells from embryos electroporated with wild-type FGFR1 and FGFR2 looked healthier and had higher cell densities, suggestive of increased survival (Fig. 2B and data not shown). This finding resembles the situation where NC cells are cultured in the presence of 1 ng/ml of FGF2 (Fig. 2C; Sarkar et al., 2001). Nevertheless, NC cells from embryos electroporated with wild-type FGFRs never exhibited condensations typical of cultures that progress to chondrogenesis, nor did they form cartilage nodules (Table 1).

thumbnail image

Figure 2. Chondrogenesis in neural crest (NC) cells explanted from stage 8 quail embryos after electroporation with wild-type or mutant fibroblast growth factor receptor (FGFR) constructs. A: In the absence of FGF2, NC cells stop dividing and become flat and featureless by 15 days. B: NC cells electroporated with wild-type FGFR1 and cultured in the absence of FGF2 grow to a higher density and have a healthier appearance. C: NC cells exposed to 1 ng/ml FGF2 proliferate, develop a fibroblastic appearance and remain healthy after 10 days. D: Nodules composed of round chondrogenic cells develop in NC cultures exposed to 10 ng/ml of FGF2 after 10 days. Note the cellular swirls surrounding the nodule. NC cells electroporated with the mutant FGFR2-C278F construct (E) develop a fibroblastic appearance and adopt a swirl pattern similar to cells exposed to 10 ng/ml FGF2 (D). However, they never differentiate into chondrocytes. F,G: In contrast, extensive chondrogenesis is seen in NC cells electroporated with mutant FGFR1-K656E. H: Higher magnification of panel G shows large round cells within the cartilaginous nodule. Scale bars = 100 μm in A–H.

Download figure to PowerPoint

Table 1. Chondrogenesis in NC Cultures From Embryos Electroporated With Mutant FGFRs In Ovo
DNA electroporatedNo. of NC cultures electroporatedNo. of NC cultures forming condensationsNo. of NC cultures forming cartilage-containing nodules
  1. aStage 8 quail embryos were electroporated bilaterally in the midbrain region with mutant or wild-type FGFR1 or FGFR2. Unelectroporated embryos served as controls. Mesencephalic NC was then dissected and cultured for 15 days in the absence of FGF2. Presence of condensations and cartilage nodules was scored by phase contrast microscopy and confirmed, on selected cultures, by Alcian blue staining. NC, neural crest; FGFR, fibroblast growth factor receptor.

Unelectroporated120 (0%)0 (0%)
FGFR1, wild-type190 (0%)0 (0%)
FGFR1-K656E8017 (21%)17 (21%)
FGFR2, wild-type80 (0%)0 (0%)
FGFR2-C278F294 (14%)0 (0%)

In contrast to these findings, chondrogenesis occurred in many NC cultures derived from embryos electroporated with mutant FGFRs. Expression of FGFR2-C278F caused NC cells to adopt a swirl pattern (Fig. 2E), a cellular arrangement seen immediately before overt chondrogenesis in nonelectroporated NC cells exposed to 10 ng/ml of FGF2 (Fig. 2D; Sarkar et al., 2001). Fifteen days later, 4 of the 29 (14%) mutant cultures derived from embryos electroporated with FGFR2-C278F developed chondrogenic condensations (Table 1), although, interestingly, none progressed to form cartilaginous nodules. A similar proportion (17 of 80; 21%) of NC cultures derived from embryos electroporated with mutant FGFR1-K656E developed chondrogenic condensations but, strikingly, all 17 of these cultures progressed to form cartilaginous nodules after 15 days (Fig. 2F–H; Table 1). Hence, both mutant FGFRs induce changes in NC cells indicative of chondrogenesis with a more exaggerated response to FGFR1-K656E than to FGFR2-C278F.

Expression of Chondrogenic and Osteogenic Markers in NC Cells Electroporated In Ovo With Mutant FGFRs

Electroporated and nonelectroporated NC cultures were evaluated by reverse transcriptase-polymerase chain reaction (RT-PCR) for expression of the chondrogenic markers Sox9 and Col2a1 and for an osteogenic marker, osteopontin. Examples of the expression of these markers in two cultures, one electroporated with FGFR1-K656E and one with FGFR2-C278F, are shown in Figure 3.

thumbnail image

Figure 3. Reverse transcriptase-polymerase chain reaction products of Col2a1, osteopontin (A), Sox9, and α-actin (B) from two NC cultures 15 days after in ovo electroporation with either fibroblast growth factor receptor FGFR1-K656E or FGFR2-C278F. Cells were grown in the absence of FGF2. A: Both Col2a1 and osteopontin are expressed in cultures electroporated with FGFR1-K656E, whereas only Col2a1 is expressed in the FGFR2-C278F electroporated NC culture. B:Sox9 is expressed in both cultures but at higher intensity in FGFR1-K656E electroporated NC cells. α-actin loading control is also shown.

Download figure to PowerPoint

Sox9, a prechondrocytic mesenchymal marker (Weimin et al., 1999), was not expressed in nonelectroporated NC cells cultured in the absence of FGF2, and was expressed only in a single culture after 12 days exposure to 1 ng/ml of FGF2. In contrast, Sox9 was expressed by all cultures treated with 10 ng/ml of FGF2, at both 5 and 12 days time points (Table 2). Sox9 was also expressed by a variable proportion of cultures derived from FGFR-electroporated embryos with no striking difference between those expressing wild-type and mutant FGFRs. Nevertheless, mutant FGFR2-C278F induced Sox9 expression in more than twice the proportion (69%) of NC cultures compared with FGFR1-K656E (28%).

Table 2. Gene Expression in NC Cells Cultured in the Presence of Varying Concentrations of FGF2 or Derived From Embryos Electroporated In Ovo With Mutant or Wild-Type FGFR1 and FGFR2 In Ovo
Genes expressedNonelectroporated NC cultured for 15 daysNC cultures electroporated withNC cultures supplemented with
FGFR1FGFR21 ng/ml FGF210 ng/ml FGF2
WT 15 daysK656E 15 daysWT 15 daysC278F 15 days5 days12 days5 days12 days
  • aData are presented as the number of positive cultures/total number of cultures tested. Percentages are given in parentheses. NC, neural crest; FGF, fibroblast growth factor; FGFR, FGF receptor; WT, wild-type.

  • *

    Significant difference (P < 0.05) from nonelectroporated control.

  • **

    Significantly different (P < 0.05) from each other (Fisher's exact test).

Sox90/12 (0%)5/12 (41%)12/42 (28%)*,**2/8 (25%)11/16 (69%)*,**0/6 (0%)1/4 (25%)5/5 (100%)*5/5 (100%)*
Col2a11/12 (8%)*1/12 (8%)7/25 (28%)1/8 (12%)8/16 (50%)*4/7 (57%)*5/5 (100%)*7/7 (100%)*4/5 (80%)*
5 days26 days5 days26 days
Osteopontin0/12 (0%)*2/12 (16%)12/25 (52%)*0/8 (0%)5/16 (31%)0/3 (0%)0/3 (0%)0/3 (0%)3/3 (100%)*

Col2a1, a chondrogenic marker, was expressed in only 1 of 12 untransfected cultures, whereas treatment of NC cells with either 1 or 10 ng/ml FGF2 led to Col2a1 expression in the majority of cultures (Table 2). Interestingly, semiquantitative RT-PCR analysis showed that Col2a1 was expressed at twice the level in NC cells exposed to 10 ng/ml of FGF2 than to 1 ng/ml of FGF2 (data not shown). In contrast to Sox9, Col2a1 was more frequently expressed by NC cells from mutant than wild-type FGFRs, with a higher proportion of Col2a1 positive cultures observed after electroporation with mutant FGFR2-C278F than with mutant FGFR1-K656E.

Osteopontin, an osteogenic marker, showed the greatest specificity of expression. It was not detected in untransfected cultures, nor in NC cells treated with 1 ng/ml FGF2 (Table 2). Prolonged (26 days) exposure to10 ng/ml FGF2 induced osteopontin expression in all three cultures studied. NC cells from embryos transfected with wild-type FGFRs expressed osteopontin only infrequently, whereas the mutant FGFR1-K656E induced osteopontin expression in half (52%) of the cultures but only 31% of mutant FGFR2-C278F cultures were positive.

Taken together, these results suggest that both mutant FGFR1-K656E and FGFR2-C278F are able to induce expression of chondrogenic markers in NC cells but mutant FGFR1-K656E appears to drive a higher proportion of NC cultures toward osteogenesis.

Effect of FGFR Transfection into Migrating NC Cells

Having demonstrated that electroporation of mutant FGFRs into premigratory NC cells can induce chondrogenesis after subsequent culture, we tested whether transfecting mutant FGFRs in vitro after the onset of migration would have a similar effect. Mesencephalic NCs were explanted and cultured in vitro for 24 hr to allow cells to migrate out and form a monolayer around the explants before being transfected.

Pilot experiments showed that transfection efficiencies into NC cells were poor by using calcium phosphate or commercially available cationic lipid reagents (data not shown). However, a transfection rate averaging 40% was achieved by using a lipid-mediated integrin targeting system (Hart et al., 1998). Furthermore, by using a human FGFR2-specific antibody, we detected FGFR2-C278F expression in 9 of 36 (25%) GFP fluorescent cells studied (not shown). Despite this relatively high transfection rate, chondrogenesis was induced in only 2 cultures of 30 separate transfection experiments with either mutant FGFR1-K656E or FGFR2-C278F.

One NC culture transfected with mutant FGFR1-K656E proliferated rapidly with round refractile cells appearing after 7 days. These cells covered a large area by day 13 (Fig. 4A). By day 40, chondrogenesis was extensive (Fig. 4B) with secondary nodules appearing in peripheral parts of the culture (Fig. 4C). The response was so vigorous that cartilaginous colonies could be seeded when culture medium was transferred into a fresh tissue culture plate (Fig. 4D). The primary culture remained healthy for at least 50 days and stained strongly positive for Alcian blue (Fig. 4E). Expression of Sox9 and Col2a1 in secondary colonies of this culture were confirmed by RT-PCR (data not shown).

thumbnail image

Figure 4. Chondrogenesis in migrating neural crest (NC) cells transfected in vitro with mutant fibroblast growth factor receptor FGFR1-K656E (A–E), wild-type FGFR2 (F) or FGFR2-C278F (G–J). A: Transfection with FGFR1-K656E induced chondrogenesis in one NC culture after 13 days. By day 40, extensive chondrogenesis was seen in this culture (B) with secondary cartilaginous nodules appearing in the periphery (C). Note the cellular swirls surrounding the nodule. D: New cartilage colonies could be seeded when medium was transferred to a new tissue culture dish. E: The culture stained strongly positive for Alcian blue. A NC culture transfected with wild-type FGFR2 remained healthy after 16 days in the absence of FGF2 (F). Cellular swirls (G) and islands of densely packed cells (H) appeared after 16 days in one culture transfected with FGFR2-C278F. By day 28, these developed into small condensations composed of round refractile cells (I) that stained positive for Alcian blue (J). The photographs were taken by using phase contrast optics. Scale bars = 100 μm in A–J.

Download figure to PowerPoint

A second NC culture, transfected with mutant FGFR2-C278F, rapidly increased in size, displayed a fibroblastic appearance, in contrast to the morphology seen in control cultures transfected with wild-type FGFR2 (Fig. 4F). By 16 days, this culture developed prominent swirls containing small islands of cellular condensation (Fig. 4G,H). A similar pattern is seen in NC cells exposed to 10 ng/ml of FGF2 just before overt cartilage differentiation. By 28 days, significant condensations (Fig. 4I) and Alcian blue–positive extracellular matrix were observed in this culture (Fig. 4J).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

During early embryonic development, inductive mechanisms involving FGFs, BMPs, and Wnts at the interface between neural and non-neural ectoderm give rise to the NC (Christiansen et al., 2000; Baker and Bronner-Fraser, 1997). Although NC cells subsequently migrate throughout the embryo and differentiate into a diverse range of cell types, only cranial NC cells can give rise to cartilage and bone (Noden, 1983; Le Douarin et al., 1993; Selleck et al., 1993). Studies in chicken embryos have shown that the cranial skeleton, including the sutures, is largely neural crest derived (Couly et al., 1993). Activating mutations in FGFRs are responsible for a range of craniofacial skeletal disorders (Burke et al., 1998). We have, therefore, introduced mutant FGFRs into early uncommitted quail NC cells and show here that they can drive skeletogenic differentiation.

Electroporation as a Gene Targeting System for the Neural Crest

Electroporation is a quick and efficient method for introducing foreign DNA into cells and has been adapted recently to target DNA into the neural tube of chick embryos (Swartz et al., 2001). One advantage of in ovo electroporation is that DNA constructs can be used directly, for instance without the need to package them into live retroviral particles (Morgan and Fekete, 1996). In addition, the delivery of exogenous DNA by electroporation can be precisely targeted by using very fine electrodes (Swartz et al., 2001). Here, we show that electroporation is a powerful experimental technique for delivery of foreign DNA into premigratory NC cells.

Mutant FGFRs Induce Chondrogenesis in NC Cells Electroporated In Ovo

When we electroporated mutant FGFRs into stage 8 quail embryo NC in ovo, and cultured the mesencephalic NC cells from these embryos, chondrogenesis was observed in the absence of any exogenous FGF2. Cartilage nodules formed in 21% of FGFR1-K656E-expressing cultures and islands of chondrogenic condensations developed in a similar percentage (14%) of cultures expressing FGFR2-C278F. These changes were accompanied by significant increases in the levels of Col2a1, Sox9, and osteopontin transcripts compared with nonelectroporated controls.

A 100% chondrogenic response was not expected in these circumstances because chondrogenesis occurs in only 75% of NC cultures even after continuous exposure to a high concentration (10 ng/ml) of FGF2 (Sarkar et al., 2001). Although the transfected NC cells expressed osteopontin, osteogenesis was not observed. We showed previously that ascorbic acid and β-glycerophosphate are required in the culture medium for the onset of mineralization in FGF-treated NC cells. The present studies did not use these “osteogenic cofactors.” Nevertheless, it seems likely that the chondrogenic effect of mutant FGFR transfection would extend also to osteogenesis, given the appropriate culture conditions.

Cartilage nodules or condensations were never seen in NC cultures electroporated in ovo with wild-type FGFR1 or FGFR2. On the other hand, these cultures survived better, and looked healthier than nonelectroporated cells cultured in the absence of FGF2. Large numbers of exogenous DNA molecules are introduced into cells during electroporation, raising the possibility that overexpressed wild-type receptors may have undergone spontaneous dimerization. This process may have led to a level of FGF signalling activity that, although insufficient to drive differentiation, could lead to elevation of the level of Col2a1, osteopontin, or Sox9 transcripts in some NC cells.

Chondrogenesis in Migrating NC Cells Transfected In Vitro With Mutant FGFRs

By using a novel transfection technique (Hart et al., 1998), we obtained 40% of NC cells GFP-positive after transfection in vitro. Although 10% of cells, overall, appeared to express transfected FGFRs, chondrogenesis was seen in only two NC cultures out of a large number transfected. Interestingly, once chondrogenesis was triggered in these two cultures, it continued unabated for at least 15–50 days.

Several factors may be responsible for the low level of response seen after in vitro transfection compared with in ovo electroporation. Continuous exposure to high FGF concentration (10 mg/ml) within the first 48 hr of culture is critical for chondrogenesis (Sarkar et al., 2001). By the time NC monolayers are transfected, 24 hr after explantation, it may be too late for the NC cells to respond to the constitutively active FGFRs. Both a critical density of NC cells with chondrogenic potential and high levels of FGF signalling may be required for inducing chondrogenic differentiation. It is likely that 24 hr after explantation the simultaneous occurrence of a very high transfection rate and high cell density in vitro is a rare event and may explain why only two of our transfected cultures differentiated.

Responses of NC Cells, Chondrocytes, and Osteoblasts to FGF Signalling

Cells at different stages of the skeletogenic lineages appear to respond differently to increase or decreased FGF/FGFR signalling. For instance, like NC cells, immature osteoblasts proliferate when exposed to FGF2 (Mansukhani et al., 2000). In contrast, excess FGFR activity inhibits the proliferation of chondrocytes, slows osteoblast differentiation, and induces apoptosis (Legeai-Mallet et al., 1998; Naski et al., 1998; Fragale et al., 1999; Mansukhani et al., 2000; Segev et al., 2000; Henderson et al., 2000). FGF2 inhibition of chondrocyte proliferation is mediated via p21, resulting in dephosphorylation of the retinoblastoma protein and cell cycle arrest at G1 phase (Aikawa et al., 2001). It remains unclear how these differentiation-stage specific responses (Debiais et al., 1998) may be brought about. It is conceivable that FGF signalling operates on different intracellular signalling pathways at different stages along the skeletogenic lineages. Peters et al. (1992) and Mohammadi et al. (1992) have shown that, although the Y766F mutation in human FGFR1 abolishes phospholipase Cγ association, phosphatidylinositol signalling, and calcium flux, it does not prevent receptor autophosphorylation and proliferation in L6 myoblasts. On the other hand, induction of apoptosis and inhibition of proliferation by FGF2 and FGFR3 appears to be mediated entirely by the intracellular signalling molecule STAT1 in growth plate chondrocytes but not in calvarial osteoblasts (Sahni et al., 1999; 2001).

Chondrogenesis and Mutant Receptors

Although the FGFR2-C278F mutant, found in Crouzon syndrome patients, has increased tyrosine kinase activity, it is unable to transform NIH-3T3 cells on its own (Galvin et al., 1996). On the other hand, the FGFR3-K650E mutant, identified in patients with thanatophoric dysplasia type II (a severe and fatal bone dysplasia), is a highly active tyrosine kinase that stimulates c-fos expression and transforms NIH 3T3 cells (Naski et al., 1996; Webster et al., 1996; Webster and Donoghue, 1997a). The mutant FGFR1-K656E used in our experiments had the corresponding mutation introduced into the FGFR1 tyrosine kinase domain and is also known to be highly activated (Donoghue, personal communication).

Although the differences in activation state of the two FGFR mutants cannot be directly compared, it is interesting that chondrogenic condensations in mutant FGFR2-C278F expressing NC cells never progressed to cartilage nodules, whereas mature chondrocytes consistently developed in mutant FGFR1-K656E expressing cultures. In addition, the osteogenic marker osteopontin was detected in more NC cultures expressing FGFR1-K656E than FGFR2-C278F (52% vs. 31%). On the other hand, fewer mutant FGFR1-K656E cultures expressed the chondrogenic markers Sox9 and Col2a1 when compared with FGFR2-C278F cultures. Taken together, these data appear to suggest that FGFR1-K656E is a stronger FGFR mutant and that at the time of assay, NC cells expressing mutant FGFR1-K656E are being driven toward osteogenesis. However, FGFR2 mutants from patients with Aperts syndrome, phenotypically the most severe type of craniosynostosis resulting from FGFR2 mutation, can induce premature osteoblast differentiation and osteopontin expression in calvarial cells (Lomri et al., 1998; Lemonnier et al., 2000). It would be interesting to see whether these “Apert-type” FGFR2 mutants may have similar effects on the differentiation of NC cells. An alternative explanation for the observed differences in the effects of FGFR1-K656E and FGFR2-C278F may be receptor specificity. For instance, FGFR1 activity in vivo is associated with chondrogenic differentiation, whereas FGFR2 activity is associated with cell proliferation at the cranial sutures (Iseki et al., 1999). Hence, mutations that increase the activity of these receptors may exaggerate their respective chondrogenic and proliferation-promoting effects.

Craniosynostosis and NC Cells

Although our work suggests that mutant FGF receptors can induce NC cells to differentiate into chondrocytes, the formation of cartilage does not occur in an uncontrolled manner in patients with craniosynostosis. Rather, they develop craniofacial skeletons, albeit abnormally shaped. Therefore, NC cells in patients with constitutional FGFR mutations must arise and migrate normally during development. It seems that the effect of abnormal FGFR signalling in human cranial skeletogenesis becomes apparent only after NC cells have reached their final destinations. Although membrane bone formation in the skull occurs independently of chondrogenesis, nonetheless the cartilage differentiation that we observe in vitro may reflect relative overexpression of mutant FGFRs leading to more rapid skeletogenic differentiative events. Reciprocal interactions between NC cells and mesenchymal cells in vivo, may act to ensure normal spatial and temporal onset of skeletogenic differentiation (Le Douarin, 1999).

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

cDNA Constructs and Vectors

The following were subcloned into the expression vector pTracer-CMV1 (Invitrogen) downstream of a CMV promoter: a 2.5-kb XbaI fragment of wild-type FGFR1 and mutant FGFR1-K656E, a highly activated receptor carrying a mutation corresponding to the mutant FGFR3-K650E found in patients with thanatophoric dysplasia type II (Tavormina et al., 1995); and a 2.6-kb KpnI fragment of wild-type FGFR2 and mutant FGFR2-C278F, a mutation found in humans with Crouzon's syndrome (Oldridge et al., 1995). Within the same plasmid, an SV40 early promoter cassette directs concomitant expression of an indicator-resistance fusion gene, SuperGFP-Zeocin. For in ovo electroporation, the chicken retroviral DNA construct RCAS-alkaline phosphatase and the plasmid pEGFP-N1 (Invitrogen) were used as electroporation or transfection indicators.

In Ovo Electroporation

Fertile quail eggs (Coturnix coturnix japonica) were incubated for 30–32 hr at 37°C until they reached Hamburger and Hamilton (HH) stage 8–9. DNA for electroporation (4 μg/ml) was suspended in calcium-free phosphate buffered saline (PBS, Gibco BRL) containing 1 mM MgCl2 and 0.1% v/v carboxymethyl-cellulose (Sigma, UK) to thicken the solution. A trace of Fast green (Sigma, UK) was added to aid visualisation. The resultant solution was injected between the mesencephalic neural folds by using a glass capillary needle. Three pulses (50 msec, 50 volts each) were then immediately delivered by tungsten electrodes positioned on either side of the embryo. The polarity of the electrodes was reversed and three further identical pulses were delivered in the opposite direction. After electroporation, the mesencephalic neural crest was either immediately dissected to establish cultures (see below) or the electroporated embryos were transferred with their yolk into 35-mm dishes and incubated for a further 24 hr at 37°C in a humidified atmosphere.

Detection of Alkaline Phosphatase Activity

Embryos electroporated with RCAS-alkaline phosphatase were fixed in 4% paraformaldehyde, rinsed in PBS, washed in 0.1% Tween-20, 2 mM levamisole (Sigma) in PBS, and then incubated at 65°C for 1 hr to inactivate endogenous alkaline phosphatase. After washing in 100 mM NaCl, 100 mM Tris-HCl pH 9.5, 50 mM MgCl2, 0.1% Tween-20, 2 mM levamisole, the embryos were stained with 3.5 μl/ml BCIP (5-bromo-4-chloro-3-indolyl-phosphate) and 6 μl/ml NBT (nitro blue tetrazolium) in the same buffer for 5 min to 4 hr until a blue colour developed. Embryos were then re-fixed in 4% paraformaldehyde and stored in PBS at 4°C.

NC cells cultured from RCAS-alkaline phosphatase electroporated embryos were washed in PBS, fixed with 4% paraformaldehyde, and then incubated at 65°C in 100 mM Tris-HCl pH 9.5, 5 mM MgCl2. The NC cells were stained by the same method as for whole embryos.

Isolation, Preparation, and Culture of NC Cells

The apices of the mesencephalic neural folds from electroporated and nonelectroporated stage 8–9 embryos were isolated and cultured, with or without the addition of 1 ng/ml or 10 ng/ml of bovine brain-derived FGF2 (R&D Systems, UK). Briefly, a sterile paper ring was placed on top of the yolk isolating the embryo in the centre of the ring. After cutting the membranes around the ring with sterile scissors, the paper ring with the embryos still attached through its membranes was lifted with a pair of sterile forceps and washed thoroughly in αMEM (with ribosides and deoxyribonucleosides, Gibco BRL, UK) supplemented with 10% fetal calf serum (FCS; Sigma, UK) and penicillin and streptomycin (Sigma, UK). The neural fold apices were excised from the mesencephalic region by using sharp tungsten needles and cultured as explants on plastic in αMEM/10% FCS in 5% CO2 at 37°C. The explants were left undisturbed for 24 hr to allow NC cells to migrate out and form cellular monolayers.

Neural Crest Cell Transfection In Vitro

The lipofectin-mediated integrin targeted system developed by Hart et al. (1998) was used to transfect wild-type and mutant FGFRs into NC cells in vitro, 24 hr after explantation. Briefly, transfection solution was made by mixing 0.01 μg/μl lipofectin (Gibco BRL), 0.1 μg/μl peptide 6 ([K]16GACRRETAWACG), 0.08 μg/μl DNA all diluted in Optimem (Gibco BRL) in a ratio of 0.75 μg lipofectin:4.0 μg peptide 6:1.0 μg DNA. The solution was left at room temperature for 30 min to allow complex formation. Then PBS-washed NC cells were overlaid with the transfection solution and incubated for 2 hr at 37°C in 5% CO2. The transfection solution was replaced by fresh αMEM/10% FCS medium, and transfection efficiency was assessed 24 hr later by determining the percentage of fluorescent cells.

Immunocytochemistry

Cells grown on glass coverslips in 24-well tissue culture plates were washed in PBS, fixed in 4% paraformaldehyde for 30 min at 4°C, and blocked for 30 min with 1% bovine serum albumin, 10% FCS, 0.1% Tween-20 (Sigma) in PBS. They were then incubated for 1 hr with a 1:1,000 diluted sheep anti-human FGFR2 primary antibody. After several PBS washes, a rhodamine-conjugated anti-sheep secondary antibody was applied at 1:100 dilution for 30 min followed by a wash with 1% Tween-20 in PBS. Coverslips were then mounted on slides by using Citifluor (Cilifluor, Ltd., London, UK) and kept protected from light at 4°C for 24 hr. The cells were photographed through a Zeiss Axiophot microscope with Kodak Ektachrome 160T colour reversal film under ultraviolet light at 550 nm.

Alcian Blue Staining

NC cells were washed with PBS, stained overnight at room temperature in 0.015% Alcian blue dissolved in 20% acetic acid/70% ethanol, and then dehydrated through an increasing ethanol gradient.

RT-PCR

Sequences of external and internal primer pairs, the annealing temperatures used, and the expected PCR product sizes are given in Table 3. All oligonucleotide pairs target regions of cDNA that span an intron. Total RNA extracted from cultured cells with TRI REAGENT (Sigma, UK) was reverse transcribed with Moloney murine leukaemia virus reverse transcriptase (Gibco BRL, UK) by using 100 pmol of random hexanucleotides primers pN6 (Promega, UK) in a 20-μl reaction. Two microlitres of the cDNA product was used as template for nested PCR reactions. An initial 10 cycles of PCR was carried out by using the following conditions: 30 sec at 94°C, 20 sec at the annealing temperature (see Table 3), 20 sec at 72°C each. Two microlitres of the first round amplification products was further amplified with a second set of internal primers by using identical conditions and a further 25 cycles.

Table 3. Primer Sequences, Annealing Temperatures, and Expected Polymerase Chain Reaction Fragment Sizes
Gene TargetPrimersAnnealing temperature (°C)Expected fragment size (bp)
α-Actin
5′ TGCTATCCAGGCTGTGCTAT 3′55490
5′ GATGGAGTTGAAGGTAGTTT 3′
Col2a1External primers58248
 5′ TTCTGCAACATGGAGACAGG 3′
 5′ GCTGTTCTTGCAGTGGTAGG 3′
Internal primers55113
 5′ CAAGACGAAAGACAAGAAGC 3′
 5′ AAGGTCATCCTGGATGCTGG 3′
Sox9External primers61226
 5′ TGAACGCCTTCATGGTGTGG 3′
 5′ GTTCTTCACCGACTTCCTCC 3′
Internal primers5795
 5′ TGCTGAATGAGAGCGAGAAGC 3′
 5′ GTGGTTGGTAATTGTAGTCG 3′
OsteopontinExternal primers57272
 5′ TGAAGCTGGCATTTCTTTGC 3′
 5′ TAGGAATGTCAGGAAAGTCC 3′
Internal primers57181
 5′ GTGCTTTATCAGCATTGCTGC 3′
 5′ TGAGTCTGCTGAAGTGAAGC 3′

Semiquantitative RT-PCR

After determining the linear amplification range for each gene, semiquantitative PCR was performed in triplicate by using 25 cycles for Col2a1, Sox9, and α-actin, and 30 cycles for osteopontin. Band intensities were quantified by using an Alpha Imager 1200 (Alpha Innotech Corporation) and normalized against α-actin. The data were analysed statistically by using two-way analysis of variance followed by pairwise t-tests or Fisher's exact test for proportions.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

This project was initiated by the late Prof. Peter Thorogood. Memories of him, his encouragement, and support were always with us during this project. We thank Dr. Dan Donoghue, University of California, for providing the FGFR cDNAs and Prof. John Heath for the human FGFR2 specific antibody. We also thank Dr. Steve Hart for his technical advice and support with the lipid mediated transfection system. We thank Dr. Andy Stoker for the RCAS-alkaline phosphatase and Dr. John Chilton for his help and advice in developing the in ovo electroporation system.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Aikawa T, Segre GV, Lee K. 2001. FGF inhibits chondrocytic growth through induction of p21 and subsequent inactivation of cyclin E-Cdk2. J Biol Chem 276: 2934729352.
  • Anderson J, Burns HD, Enriquez-Harris P, Wilkie AM, Heath JK. 1998. Apert syndrome mutations in fibroblast growth factor receptor 2 exhibit increased affinity for FGF ligand. Hum Mol Genet 7: 14751483.
  • Baker CV, Bronner-Fraser M. 1997. The origins of the neural crest. I. Embryonic induction. Mech Dev 69: 311.
  • Burke D, Wilkes D, Blundell TL, Malcolm S. 1998. Fibroblast growth factor receptors: lessons from the genes. Trends Biochem Sci 23: 5962.
  • Christiansen JH, Coles EG, Wilkinson DG. 2000. Molecular control of neural crest formation, migration and differentiation. Curr Opin Cell Biol 12: 719724.
  • Cohen MM. 1993. Sutural biology and the correlates of craniosynostosis. Am J Med Genet 47: 581616.
  • Couly GF, Coltey PM, Le Douarin NM. 1993. The triple origin of skull in higher vertebrates: a study in quail-chick chimeras. Development 117: 409429.
  • Debiais F, Hott M, Graulet AM, Marie PJ. 1998. The effects of fibroblast growth factor-2 on human neonatal calvaria osteoblastic cells are differentiation stage specific. J Bone Miner Res 13: 645654.
  • Fragale A, Tartaglia M, Bernardini S, Di Stasi AM, Di Rocco C, Velardi F, Teti A, Battaglia PA, Migliaccio S. 1999. Decreased proliferation and altered differentiation in osteoblasts from genetically and clinically distinct craniosynostotic disorders. Am J Pathol 154: 14651477.
  • Galvin BD, Hart KC, Meyer AN, Webster MK, Donoghue DJ. 1996. Constitutive receptor activation by Crouzon syndrome mutations in fibroblast growth factor receptor (FGFR)2 and FGFR2/Neu chimeras. Proc Natl Acad Sci U S A 93: 78947899.
  • Hart SL, Arancibia-Carcamo CV, Wolfert MA, Mailhos C, O'Reilly NJ, Ali RR, Coutelle C, George AJ, Harbottle RP, Knight AM, Larkin DF, Levinsky RJ, Seymour LW, Thrasher AJ, Kinnon C. 1998. Lipid-mediated enhancement of transfection by a nonviral integrin-targeting vector. Hum Gene Ther 9: 575585.
  • Henderson JE, Naski MC, Aarts MM, Wang D, Cheng L, Goltzman D, Ornitz DM. 2000. Expression of FGFR3 with the G380R achondroplasia mutation inhibits proliferation and maturation of CFK2 chondrocytic cells. J Bone Miner Res 15: 155165.
  • Howard TD, Paznekas WA, Green ED, Chiang LC, Ma N, Rosa FW, Delgado CG, Gonzalez-Ramos M, Kline AD, Jabs EW. 1997. Mutations in TWIST, a basic helix loop helix transcription factor, in Saethre-Chotzen syndrome. Nat Genet 15: 3641.
  • Iseki S, Wilkie AOM, Heath JK, Ishimaru T, Eto K, Morriss Kay GM. 1997. Fgfr2 and osteopontin domains in the developing skull vault are mutually exclusive and can be altered by locally applied FGF2. Development 124: 33753384.
  • Iseki S, Wilkie AO, Morriss-Kay GM. 1999. Fgfr1 and Fgfr2 have distinct differentiation- and proliferation-related roles in the developing mouse skull vault. Development 126: 56115620.
  • Jabs EW, Müller U, Li X, Ma L, Luo W, Haworth IS, Klisak I, Sparkes R, Warman ML, Muliken JB, Snead ML, Maxson R. 1993. A mutation in the homeodomain of human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell 75: 443450.
  • Kim H-J, Rice DPC, Kettunen PJ, Thesleff I. 1998. FGF-, BMP- and Shh-mediated signalling pathways in the regulation of cranial suture morphogenesis and calvarial bone development. Development 125: 12411251.
  • Le Douarin N. 1999. The neural crest. Cambridge: Cambridge University Press. p 1445
  • Le Douarin NM, Ziller C, Couly GF. 1993. Patterning of neural crest derivatives in the avian embryo: in vivo and in vitro studies. Dev Biol 159: 2449.
  • Legeai-Mallet L, Benoist-Lasselin C, Delezoide AL, Munnich A, Bonaventure J. 1998. Fibroblast growth factor receptor 3 mutations promote apoptosis but do not alter chondrocyte proliferation in thanatophoric dysplasia. J Biol Chem 273: 1300713014.
  • Lemonnier J, Delannoy P, Hott M, Lomri A, Modrowski D, Marie PJ. 2000. The Ser252Trp fibroblast growth factor receptor-2 (FGFR-2) mutation induces PKC-independent downregulation of FGFR-2 associated with premature calvaria osteoblast differentiation. Exp Cell Res 256: 158167.
  • Lomri A, Lemonnier J, Hott M, de Parseval N, Lajeunie E, Munnich A, Renier D, Marie PJ. 1998. Increased clavaria cell differentiation and bone matrix formation induced by fibroblast growth factor receptor 2 mutations in Apert Syndrome. J Clin Invest 101: 13101317.
  • Mansukhani A, Bellosta P, Sahni M, Basilico C. 2000. Signaling by fibroblast growth factors (FGF) and fibroblast growth factor receptor 2 (FGFR2)-activating mutations blocks mineralization and induces apoptosis in osteoblasts. J Cell Biol 149: 12971308.
  • Mohammadi M, Dionne CA, Li W, Li N, Spivak T, Honegger AM, Jaye M, Schlessinger J. 1992. Point mutation in FGF receptor eliminates phosphatidylinositol hydrolysis without affecting mitogenesis. Nature 358: 681684.
  • Moore RL, Ferretti P, Copp A, Thorogood P. 2002. Blocking endogenous FGF-2 activity prevents cranial osteogenesis. Dev Biol 243: 99114. (Published electronically 23rd January 2002 doi:10.1006/dbio. 2001.0533).
  • Morgan BA Fekete DM. 1996. Manipulating gene expression with replication-competent retroviruses. Methods Cell Biol 51: 185218.
  • Naski MC, Wang Q, Xu J, Ornitz DM. 1996. Graded activation of fibroblast growth factor receptor 3 by mutations causing achondroplasia and thanatophoric dysplasia. Nat Genet 13: 233237.
  • Naski MC, Colvin JS, Coffin JD, Ornitz DM. 1998. Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development 125: 49774988.
  • Noden DM. 1983. The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues. Dev Biol 96: 144165.
  • Oldridge M, Wilkie AOM, Slaney SF, Poole MD, Pulleyn LJ, Rutland P, Hockley AD, Wake MJC, Goldin JH, Winter RM, et al. 1995. Mutations in the third immunoglobulin domain of the fibroblast growth factor receptor-2 gene in Crouzon syndrome. Hum Mol Genet 4: 10771082.
  • Passos-Bueno MR, Wilcox WR, Jabs EW, Sertie AL, Alonso LG, Kitoh H. 1999. Clinical spectrum of fibroblast growth factor receptor mutations. Hum Mutat 14: 115125.
  • Peters KG, Marie J, Wilson E, Ives HE, Escobedo J, Del Rosario M, Mirda D, Williams LT. 1992. Point mutation of an FGF receptor abolishes phosphatidylinositol turnover and Ca2+ flux but not mitogenesis. Nature 358: 678681.
  • Robertson SC, Meyer AN, Hart KC, Galvin BD, Webster MK, Donoghue DJ. 1998. Activating Mutations in the Extracellular Domain of FGFR2 Function by Disruption of the Ig-3 Disulfide Bond. Proc Natl Acad Sci U S A 95: 45674572.
  • Sahni M, Ambrosetti DC, Mansukhani A, Gertner R, Levy D, Basilico C. 1999. FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 13: 13611366.
  • Sahni M, Raz R, Coffin JD, Levy D, Basilico C. 2001. STAT1 mediates the increased apoptosis and reduced chondrocyte proliferation in mice overexpressing FGF2. Development 128: 21192129.
  • Sarkar S, Petiot A, Copp A, Ferretti P, Thorogood P. 2001. FGF-2 promotes skeletogenic differentiation of cranial neural crest cells. Development 128: 21432152.
  • Segev O, Chumakov I, Nevo Z, Givol D, Madar-Shapiro L, Sheinin Y, Weinreb M, Yayon A. 2000. Restrained chondrocyte proliferation and maturation with abnormal growth plate vascularization and ossification in human FGFR-3(G380R) transgenic mice. Hum Mol Genet 9: 249258.
  • Selleck MA, Scherson TY, Bronner Fraser M. 1993. Origins of neural crest cell diversity. Dev Biol 159: 111.
  • Swartz M, Eberhart J, Mastick GS, Krull CE. 2001. Sparking new frontiers: using in vivo electroporation for genetic manipulations. Dev Biol 233: 1321.
  • Tavormina PL, Shiang R, Thompson LM, Zhu YZ, Wilkin DJ, Lachman RS, Wilcox WR, Rimoin DL, Cohn DH, Wasmuth JJ. 1995. Thanatophoric dysplasia (types I and II) caused by distinct mutations in fibroblast growth factor receptor 3. Nat Genet 9: 321328.
  • Webster MK Donoghue DJ. 1996. Constitutive activation of fibroblast growth factor receptor 3 by the transmembrane domain point mutation found in achondroplasia. EMBO J 15: 520527.
  • Webster MK, Donoghue DJ. 1997a. FGFR activation in skeletal disorders: too much of a good thing. Trends Genet 13: 178182.
  • Webster MK, Donoghue DJ. 1997b. Enhanced signaling and morphological transformation by a membrane-localized derivative of the fibroblast growth factor receptor 3 kinase domain. Mol Cell Biol 17: 57395747.
  • Webster MK, D'Avis PY, Robertson SC, Donoghue DJ. 1996. Profound ligand-independent kinase activation of fibroblast growth factor receptor 3 by the activation loop mutation responsible for a lethal skeletal dysplasia, thanatophoric dysplasia type II. Mol Cell Biol 16: 40814087.
  • Weimin B, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. 1999. Sox9 is required for cartilage formation. Nat Genet 22: 8589.
  • Yu K, Herr AB, Waksman G, Ornitz DM. 2000. Loss of fibroblast growth factor receptor 2 ligand-binding specificity in Apert syndrome. Proc Natl Acad Sci U S A 97: 1453614541.