SEARCH

SEARCH BY CITATION

Keywords:

  • transcription factor;
  • Pax3;
  • neurocristopathies;
  • Waardenburg syndrome;
  • RCAS virus;
  • tv-a;
  • Gateway;
  • Sox10

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

An in vitro gene complementation approach has been developed to dissect gene function and regulation in neural crest (NC) development and disease. The approach uses the avian RCAS virus to express genes in NC cells derived from transgenic mice expressing the RCAS receptor TVA, under the control of defined promoter elements. Constructs for creating TVA transgenic mice were developed using site-specific recombination GATEWAY (GW), compatible vectors that can also be used to facilitate analysis of genomic fragments for transcriptional regulatory elements. By using these GW vectors to facilitate cloning, transgenic mouse lines were generated that express TVA in SOX10-expressing NC stem cells under the control of the Pax3 promoter. The Pax3-tv-a transgene was bred onto a Sox10-deficient background, and the feasibility of complementing genetic NC defects was demonstrated by infecting the Pax3-tv-a cells with an RCAS-Sox10 expression virus, thereby rescuing melanocyte development of Sox10-deficient NC cells. This system will be useful for assessing genetic hierarchies in NC development. Developmental Dynamics 229:54–62, 2004. © 2003 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

The complete sequencing of the genomes of model organisms has generated a vast amount of genetic information that can be predicted from comparative genomic analysis. Analysis of the transcriptome using gene expression profiles can lead to hypotheses regarding transcriptional hierarchies in developmental pathways and disease. A subsequent challenge is to be able to assay biological functions of gene products, test transcriptional hierarchical relationships, and elucidate the genomic elements required to regulate expression in diverse cell lineages during development.

The vertebrate neural crest (NC) is an excellent model system for addressing these basic questions of developmental genetics. This remarkable multipotent cell population originates along the dorsal line of the closing neural tube but soon migrates along defined routes to reside in a variety of tissues. NC-derived cells eventually differentiate into many specific lineages in vertebrates. These include melanocytes of the skin, inner ear and choroid, neuronal and glial cells of the peripheral nervous system, enteric ganglia, most of the craniofacial skeletal and connective tissues, cardiac muscle, and endocrine cells (for reviews, see Weston, 1986; Le Douarin and Kalchelin, 1999).

An understanding of NC cell development is also medically important as human neurocristopathies result from defects in the development of NC cell lineages (reviewed in Bolande, 1997). Waardenburg syndrome (WS) is characterized by patchy hypopigmentation of the skin, white forelock, and deafness resulting from a lack of melanocytes. WS can also present with dystopia canthorum caused by abnormal cranial NC development, and/or long segment megacolon (long segment Hirschsprung disease) resulting from a reduction of enteric ganglia. To date, WS has been clinically subdivided into four types associated with mutations in the separate genes coding for three transcription factors, PAX3, SOX10, and MITF, and one receptor/ligand system, endothelin receptor-B and its ligand, endothelin 3 (for reviews, see Epstein, 2000; McCallion and Chakravarti, 2001; Arnheiter et al., 2002; Mollaaghababa and Pavan, 2003). PAX3 mutations have been identified in individuals with WS type 1 and III and are clinically distinguished from other WS subtypes by having specific craniofacial and limb abnormalities in addition to observed pigmentation defects (WS type I, OMIM#193500; WS type III, OMIM#148820). Consistent with these defects, Pax3 is expressed in the dorsal neural tube, migrating neural crest, craniofacial crest, and somites (reviewed in Epstein, 2000). A subset of WS type IV individuals (Waardenburg-Shah syndrome, OMIM #277580) have been found to contain mutations in SOX10 and present clinically with enteric ganglia deficiencies in addition to observed pigmentation defects (Pingault et al., 1998). Mice with mutations of Sox10 (Sox10Dom and Sox10LacZ) model WS4, exhibiting similar defects as human patients in melanocytes, enteric neurons, and glial cells of the peripheral nervous system (Herbarth et al., 1998; Southard-Smith et al., 1998; Britsch et al., 2001). Sox10 is a HMG (high mobility group) transcription factor expressed in multiple NC cell lineages (Kuhlbrodt et al., 1998; Southard-Smith et al., 1998; Paratore et al., 2001; Kim et al., 2003). The analysis of Sox10 gene function using mutant mammalian models is hampered because Sox10Dom/Sox10Dom and Sox10LacZ/Sox10LacZ embryos die before birth (Lane and Liu, 1984, Britsch et al., 2001). Although it has been demonstrated that Sox10 is critical for survival of several NC-derived lineages (Southard-Smith et al., 1998; Britsch et al., 2001; Potterf et al., 2001) and several downstream target genes have been identified (Liu et al., 1999; Lang et al., 2000; Lee et al., 2000; Peirano et al., 2000; Potterf et al., 2000, 2001; Bondurand et al., 2001; Britsch et al., 2001), the functional roles of SOX10 in the development of NC-derived lineages is not completely understood.

The mouse provides a valuable model organism that allows for in vivo dissection of gene function, testing of downstream target genes and definition of promoter regions required for both temporal and lineage specific gene expression. The RCAS-TVA system (RCAS, Replication-Competent ASLV long terminal repeat with Splice acceptor) can be used to facilitate the misexpression of genes in mice in a tissue-specific manner (Federspiel et al., 1994). This system is based upon subcloning a gene of interest into an avian leukosis retroviral expression system, the RCAS vector (Hughes et al., 1987). Because RCAS virus cannot infect mammalian cells, the RCAS virus needs to be coupled with a transgenic mouse line expressing the viral receptor tv-a gene (TVA) from a tissue-specific promoter (for review, see Fisher et al., 1999). Transgenic mice and cells that are engineered to express the TVA receptor are permissive for infection by RCAS virus in actively dividing cells and genes cloned into the RCAS virus are expressed in infected cells from the long terminal repeat (LTR). The RCAS-TVA retroviral delivery technique has been used previously to dissect genetic pathways in human cancer using distinct promoter-tv-a transgenic mice (Holland and Varmus, 1998; Fults et al., 2002; Pao et al., 2003).

We have adapted the RCAS-TVA technology to investigate the role of Wnt1 signaling in NC-derived melanocyte development using Nestin-tv-a and Dct-tv-a transgenic mice (Dunn et al., 2000, 2001). Through targeting infection of WNT signaling genes to subsets of NC cells, we were able to separate cell autonomous and nonautonomous roles of these gene products in NC development. We have previously demonstrated the efficiency of cloning genes into RCAS by using RCASBP-Y viral constructs modified with a GATEWAY (GW) cloning cassette (Loftus et al., 2001). GW cloning technology uses site-specific recombination to clone genes and is based upon the use of modified λ phage att sites and the λ integrase proteins, integrase (INT), integration host factor (IHF), and excisionase (XIS; Landy, 1989). Use of this system allows for one to standardize the cloning of DNA fragments independent of restriction site sequences, in an orientation-specific manner, rapidly and with high efficiency (Hartley et al., 2000).

This study uses the RCAS-TVA system to introduce genes into mutant mouse NC stem cells to aid in our ability to test gene function in development and disease. Vectors were created to facilitate the cloning of promoter fragments needed to generate lines of transgenic mice expressing TVA in defined cell types. These vectors were used to generate a line of transgenic mice, Tg(Pax3-tv-a)HPvn, to direct TVA expression in progenitors of SOX10-positive cells using the Pax3 promoter. To demonstrate the utility of this system for gene complementation, we have introduced the Tg(Pax3-tv-a)Pvn transgene into Sox10 -/- NC cells and demonstrated successful correction of the hypopigmentation defect by infection with RCAS-Sox10. This demonstrates a reliable method to study gene function within the NC lineage and provides a functional assay for correction of phenotypes in mutant NC cells.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

Evolutionarily conserved regions of the genome may represent expressed coding regions, or key regulatory elements that control the temporal and spatial gene expression patterns. To facilitate the study of functional promoter elements during NC development, we created a vector that uses the GW cloning system to efficiently insert promoter elements upstream of a lacZ reporter gene. The vector pGWIlacZ allows for cloning of promoter sequences by means of site-specific recombination at modified λ phage att sites. The pGWIlacZ vector contains intronic sequences from pCI vector and lacZ sequence from pcDNA3.1/Hygro/lacZ. To test that the pGWIlacZ vector construct was functional for generating transgenic mice, the proximal Pax3 promoter was selected. Previously, data have shown that the 1.6-kb proximal Pax3 promoter is sufficient to drive gene expression in the dorsal neural tube but not in craniofacial primordia or somite regions, differing from the expression pattern obtained from endogenous Pax3 gene expression (Li et al., 1999, 2000). We transferred the 1.6-kb proximal Pax3 promoter by means of GW recombination into the pGWIlacZ destination vector construct (Fig. 1). Four clones analyzed by restriction enzyme analysis demonstrated correct transfer and orientation of the Pax3 promoter fragment. This efficiency is consistent with published findings (Hartley et al., 2000; Loftus et al, 2001). The resulting P3PlacZ construct was used to generate three independent founder transgenic lines. Expression patterns in embryonic day (E) 9.5 and E10.5 embryos were confirmed using X-Gal staining for embryos generated from matings of Tg(Pax3-lacZ)Pvn F1 transgenic mice with FVB/N female mice (Fig. 2). Comparison of staining patterns demonstrated that all lacZ lines were similar in sites of expression (Fig. 2, E10.5, data not shown). The expression patterns were consistent with the pattern found by Li et al., (1999). This result demonstrates that the 25-bp flanking attB1 and attB2 sequences that remain as a result of site-specific recombination by means of GW cloning do not interfere with generation of transgenic lines.

thumbnail image

Figure 1. Diagrams of the GATEWAY (GW) compatible transgenic expression vectors. A, B: The destination vector constructs (A) pGWItv-a800 and (B) pGWIlacZ, contain the GW prfA sequences allowing for recombinational cloning of promoter sequences. The Pax3 promoter sequence from P3Pentry vector was introduced by means of recombinational cloning between attR1 and attR2 site sequences flanking the GW prfA and attL1 and attL2 of P3Pentry to generate transgenic vector constructs P3Ptv-a800 and P3PlacZ, respectively. C,D: Transgenic construct fragments P3Ptv-a800, 3.2 kb ClaI (C) and P3PlacZ, 5.5 kb AseI/SphI (D) were used for microinjection of oocytes. C, ClaI; B, BsrgI; K, KpnI; A, AseI; S, SphI; and H, HindIII.

Download figure to PowerPoint

thumbnail image

Figure 2. Appropriate expression of lacZ and tv-a is seen in transgenic lines of mice generated using GATEWAY compatible vectors. A: In situ hybridization of an embryonic day (E) 10.5 wild-type mouse embryos demonstrating endogenous Pax3 expression is present in developing craniofacial promordia (asterisk) and somites (large white arrowhead) in addition to dorsal neural tube (line arrow). B: β-Galactosidase staining of an E9.5 of Tg(Pax3-lacZ)Pvn mouse embryo demonstrates transgene expression in dorsal neural tube (line arrow). C,D: In situ hybridization of Tg(Pax3-tv-a)Hpvn transgenic embryos demonstrates expression of the avian TVA receptor in the dorsal neural tube (line arrow) and dorsal root ganglion (black arrowhead) at E10.5 (C) and E9.5 (D).

Download figure to PowerPoint

To facilitate the ability to generate TVA transgenic mice using promoter fragments, we also created a vector, pGWItv-a800, to subclone fragments of genomic DNA upstream of the RCAS receptor TVA. The vector pGWItv-a800 contains a GW cloning cassette for promoter sequence introduction, intronic sequence from pCI, and the gene tv-a800 that encodes for the smaller GPI-linked isoform of TVA (Fisher et al., 1999). To assess this construct, the same Pax3 promoter sequence was transferred into pGWItv-a800 destination vector construct by using GW recombination as described for P3PlacZ (Fig. 1). The resulting P3Ptv-a800 construct was used to generate five independent founder transgenic lines. Developmental expression patterns of TVA in the Tg(Pax3-tv-a)Pvn transgenic lines were determined by using in situ hybridization (Fig. 2). Expression patterns in E9.5 and E10.5 embryos were as anticipated, with expression in the dorsal neural tube for all Tg(Pax3-tv-a)Pvn lines. In one line, Tg(Pax3-tv-a)HPvn, the tv-a expression in the dorsal neural tube extends further into the anterior region of the embryo than the other transgenic lines. As this is specific to the single transgenic H line, we predict that the slight expansion of expression to the anterior neural tube in line H is due to the sequence environment at the integration site.

The Tg(Pax3-tv-a)HPvn line was next examined by targeted gene transduction to determine whether the transgenic mice expressed functional TVA protein. We assayed for TVA function using an in vitro NC cell culture system that isolates neural tube (NT) explants from E9.5 embryos grown in culture. NC cell cultures were established from matings of Tg(Pax3-tv-a)HPvn/+ males crossed to C57BL/6J females, yielding half Tg(Pax3-tv-a)HPvn/+ and half nontransgenic cultures. All cultures were treated with green fluorescent protein (GFP) -expressing RCAS virus on day 1, and after 5 days of infection in culture, the cells were fixed and visualized with GFP (Fig. 3; Table 1). A total of 18 cultures were established: 9 being transgenic and 9 being nontransgenic as determined by genotype analysis. In all transgenic cultures, numerous NC cells were GFP positive, demonstrating that functional TVA protein was made and RCAS virus transduction occurred (Fig. 3B; Table 1). None of the nontransgenic cultures exhibited GFP-expressing cells, consistent with the requirement for TVA expression (Fig. 3A). To further characterize the identity of TVA cells, cultured NC cells were fixed 5 days after treatment with RCAS-GFP and stained with antibody to the NC stem cell marker SOX10 (Paratore et al., 2001; Potterf et al., 2001; Kim et al., 2003). The majority of GFP-positive cells were also positive for SOX10 expression (Fig. 3C,D). This result demonstrates that a population of Tg(Pax3-tv-a)HPvn cells, which express TVA, are precursors of a SOX10-positive cell population. Therefore, this system allows for specific targeting of SOX10-expressing NC stem cells for analysis of gene function in NC development.

thumbnail image

Figure 3. Descendants of Pax3-tv-a-expressing neural crest (NC) cells include SOX10-expressing NC cells. A–D: Primary neural tube explant cultures were established from E9.5 nontransgenic embryos (A,C) and Tg(Pax3-tv-a)HPvn/+ littermates (B,D). Explants were treated with RCAS-green fluorescent protein (GFP) on day 1, cultured in the presence of EDN3 and stem cell factor for 5 days and subjected to immunofluorescence labeling using a SOX10 specific antibody. A,B: GFP expression in green. Cytoplasmic and nuclear GFP-expressing NC cells are observed in cultures derived from the transgenic (B) but not the nontransgenic embryos (A). C,D: Merged image showing GFP expression in green, SOX10 nuclear expression in red, and coexpression in yellow. C: Cultures derived from the nontransgenic embryos demonstrate only nuclear SOX10-expressing NC cells, while cultures derived from the transgenic littermates demonstrate that the majority of GPF-positive cells are also SOX10 positive (yellow nuclei).

Download figure to PowerPoint

Table 1. Rescue of Melanocyte Differentiation by Infection of NT Explant Cultures Derived From Sox10−/− Embryos with RCAS-Sox10a
GenotypesRCAS virusNumber of NT explants treated with RCAS virusNumber of NT explants infected with RCAS virus (%)Number of NT explants with melanocytes (%)
  • a

    TVA − denotes neural tubes (NTs) that are negative for the Tg(Pax3-tv-a)HPvn transgene and TVA + denotes NTs that are positive for the Tg(Pax3-tv-a)HPvn transgene. GFP, green fluorescent protein.

Sox10+/+; TVA −GFP90 (0%)Not applicable
Sox10+/+; TVA +GFP99 (100%)Not applicable
Sox10−/−; TVA −Sox1040 (0%)0 (0%)
Sox10−/−; TVA +Sox1066 (100%)6 (100%)

Next this approach was used to target ectopic expression of genes in Sox10 mutant NC cells to assess the ability of downstream target genes to complement NC differentiation. Analysis of NC cultures isolated from Sox10Dom/Sox10Dom embryos determined that fully differentiated pigmented melanocytes are absent in 2-week cultures (Potterf et al., 2001). We wanted to determine whether the RCAS-TVA lineage-directed gene transfer system could be used to rescue melanocyte differentiation in the NC cell cultures by introducing Sox10 into Sox10LacZ/Sox10LacZ NC cells. To achieve the goal, we crossed the Tg(Pax3-tv-a)HPvn/+ transgenic mice with Sox10LacZ/+ mice to generate a double heterozygous line (see Experimental Procedures section). NT explants were isolated from the matings between Tg(Pax3-tv-a)HPvn and Sox10LacZ/+ double-heterozygous mice. The NC cells were treated with RCAS-NHA-Sox10 virus on day 1 and grown under conditions supportive of melanocyte differentiation for 2 weeks (Fig. 4; Table 1). In Tg(Pax3-tv-a)HPvn/+; Sox10LacZ/Sox10LacZ mutant cultures many SOX10-hemagglutinin (HA) -positive cells were detected. A subset of the SOX10-HA–positive cells contained melanin pigment, which is indicative of differentiated melanocytes (Fig. 4; Table 1). This finding demonstrated successful complementation of melanocyte development by intrinsic expression of SOX10 from the RCAS virus. In contrast, no evidence of RCAS infection (no HA staining) and no differentiated melanocytes were observed in Tg(Pax3-tv-a)HPvn negative; Sox10LacZ/Sox10LacZ mutant NC cell cultures (Fig. 4; Table 1). These results demonstrate that intrinsic expression of Sox10 is sufficient to rescue melanocyte differentiation of Sox10 -/- NC cells in culture. This study also demonstrates that the RCAS-TVA system can be used to assess the ability of genes to complement NC differentiation.

thumbnail image

Figure 4. Rescue of melanocyte differentiation in Sox10 -/- neural crest (NC) cell cultures. A–F: Primary neural tube explant cultures were derived from embryonic day (E) 9.5 Sox10 -/-; TVA nontransgenic embryos (A–C) and Sox10 -/-; TVA transgenic littermates (D–F). All cultures were treated with RCAS-NHA-Sox10 on day 1 and grown in the presence of EDN3 and stem cell factor for 2 weeks before fixation. NC cells were visualized with DAPI (4′,6-diamidine-2-phenylidole-dihydrochloride; A,D: purple nuclei); exogenous SOX10 was visualized by immunofluorescence for hemagglutinin (HA; B,E: green nuclei); and melanin was visualized by brightfield microscopy (C,F: black cytoplasmic granules). While numerous NC cells were observed in TVA-negative cultures (A), only the TVA-positive cultures demonstrated RCAS infection (E) and rescue of melanocyte differentiation (F). Sox10 -/- NC cells that were TVA negative demonstrated no infection of RCAS-NHA-Sox10 (B) nor rescue of pigmented melanocyte differentiation (C). Arrows denote examples of cells doubly positive for HA and melanin.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

With the availability of whole genome sequences from multiple organisms, it is possible to use informatic approaches to identify regions of conserved noncoding sequence elements on a large scale. Testing these regions for functional transcriptional activity requires manipulation of DNA fragments and subcloning into reporter vectors. To facilitate this process, we have created and tested a GW compatible promoter vector to efficiently and accurately transfer DNA fragments into a lacZ reporter plasmid. We have demonstrated that the presence of the 25-bp attB1 and attB2 sites flanking the Pax3 promoter fragment does not prevent the ability of the transgene to be transmitted through the germline and be expressed appropriately. This is the first demonstration that GW can be used to generate transgenic mice. This vector can be used in future studies to rapidly evaluate predicted promoter fragments and regulatory elements, by both in vitro analysis and promoter-driven lacZ transgenic mouse lines.

We have also generated a GW compatible vector for making transgenic mice that express the tv-a receptor in cell types specified by a promoter fragment. The RCAS-TVA system is well suited for studies of mammalian NC development, providing efficient and specific gene expression. Virus infection does not spread in cultures, as infectious avian RCAS viral particles cannot be formed in mammalian cells. Therefore, the progeny of infected progenitors can be traced using expression of a marker from the LTR of the RCAS virus. We demonstrated that infection of RCAS-GFP into Pax3-tv-a–expressing NC cells marks progenitors of SOX10-positive cells and melanocytes. In addition, infected cells do not block subsequent infections from RCAS viruses; therefore, repeat infections with RCAS viruses containing different genes can be targeted to the same cell. This strategy is well suited to analyze the effects of combinations of multiple genes on NC cell development.

One use of this system will be to introduce genes by means of RCAS infections to complement mouse NC mutants, such as Sox10LacZ. Previously, we have applied the RCAS-TVA system to investigate NC-derived melanocyte development by infecting WNT signaling genes in Dct-tv-a transgenic NC cells (Dunn et al., 2000, 2001). However, as DCT is not expressed in Sox10 mutant NC (Potterf et al., 2001), the Dct-tv-a transgene would not be useful for attempts to complement Sox10 mutants. We have found that RCAS-Sox10 is capable of complementing Tg(Pax3-tv-a)HPvn; Sox10 -/- NC cells. This result demonstrates that this Pax3 promoter retains transcriptional activity in Sox10 -/- NC cells. Because melanocyte differentiation could be rescued by reintroduction of Sox10 gene in Sox10 -/- NC cells, Sox10 is not required for the generation for neural crest cells and Sox10-deficient cells are capable to respond to Sox10-mediated signals under the conditions used to culture these cells. In our rescue experiments, not all of the Sox10-positive cells are pigmented melanocytes when the cells were fixed at 14 days of cultures. This finding might be explained by two reasons. First, Sox10 is not only involved in melanocyte development but also for development of enteric neurons and glial cells. Therefore, some Sox10-positive cells might not have the potential to become melanocytes. Second, pigmentation is a final step of melanocyte differentiation, some Sox10-positive and unpigmented cells may not be fully differentiated at the time the cultured was fixed.

It has been proposed that Mitf is a sole downstream target gene for Sox10 in neural crest-derived melanocyte development (Dutton et al., 2001). Therefore, this system will be ideal for assessing the potential of downstream target gene(s) of Sox10 for the ability to complement aspects of NC development in Sox10 -/- mouse NC cells. For example, we can determine whether ectopic expression of Mitf in Sox10 -/- neural crest cells could rescue all or any of the melanocytic defects. This system is also useful for evaluating biological functions in neural crest development of newly cloned genes obtained from animal mutants or expression arrays (Loftus et al., 2002).

The Tg(Pax3-tv-a)HPvn line provides a powerful tool for investigation of mammalian NC development, as it allows for transduction of genes into SOX10-expressing NC stem cells. The line can be combined with other NC mutant mice that have different primary gene defects for study of genes involved in the developmental programs of cell-fate specification, cellular differentiation, and pattern formation. This approach is particularly valuable, as it allows for dissecting of gene biological functions and defining of complex gene hierarchical networks in NC development. The Tg(Pax3-tv-a)HPvn transgenic mice may also be used to further analyze gene function in neural crest development in vivo as has been described using the Dct-tv-a line of transgenic mice (Dunn et al., 2001).

In summary, transgenic lines of mice were generated that transmit P3PlacZ or P3Ptv-a800 using GW compatible promoter vectors. The functionality of both vectors for producing transgenic mice was demonstrated by determining that the expression of the gene products was localized to the appropriate embryonic tissues. The combination of RCAS-TVA systems with the complementation of NC mutant mice establishes a valuable tool for dissecting gene function and regulation in NC development and disease progression. The approach taken in this study is easily amenable to other systems by incorporation of other tissue specific promoter fragments to target TVA expression.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

RCAS Vector Construction

To produce the plasmid pGWItv-a800,the 1.2-kb BamHI fragment of pCItv-a800 (gift from Harold Varmus) containing tv-a800 and SV40 small intron poly(A) was first ligated into pBSII KS+ BamHI linearized vector. The resulting vector was digested with PstI, and a 3.7 kb fragment was isolated. This fragment was ligated to the 0.7-kb PstI fragment (containing intron sequence) from pCItv-a800. Resulting clones were linearized with EcoRV and Gateway prfA cassette (Invitrogen) inserted to yield pGWItv-a800.

The pGWIlacZ vector was created by ligation of KpnI linearized pcDNA3.1/Hygro/lacZ (Invitrogen) with the 2-kb KpnI fragment from pGWItv-a800 containing the GW cassette and intron sequences. From the resulting plasmid, the 5.8-kb HindIII and XmnI fragment was isolated and cloned into HindIII/EcoRV sites of pBSIIKS+ vector. Pax3 promoter entry clone (P3Pentry) was generated by polymerase chain reaction (PCR) amplification of the 1.8-kb fragment, containing 1.6-kb proximal promoter, from C57BL/6J DNA with primers attB1 p3proF-ggggacaagtttgtacaaaaaagcaggctctcctccccaaatgtggg and attB2 p3proR-ggggaccactttgtacaagaaagctgggtcggatctcggagagctcctc and subsequent cloning into pdonr201 by means of BP reaction (Invitrogen). LR Reactions (Invitrogen) between P3Pentry and destination vectors pGWItv-a800 and pGWIlacZ were performed to obtain corresponding P3Ptv-a800 and P3PlacZ constructs.

Pax3 Promoter Transgenic Mice

The 3.2-kb ClaI fragment from P3Ptv-a800 and the 5.5 kb AseI/SphI fragment from P3PlacZ were used for injection into fertilized one-cell oocytes collected from FVB/N and C57BL/6J females. Microinjected oocytes were then implanted into CByB6F1/J pseudopregnant females. The resulting P3PlacZ and P3Ptv-a800 constructs were used to generate three and five independent founder transgenic lines, Tg(Pax3-lacZ)Pvn and Tg(Pax3-tv-a)Pvn, respectively. Tail biopsies were taken from the pups for screening of founders by PCR. Whole-mount in situ hybridization procedures was performed as described previously (Loftus et al., 2002). Antisense Pax3 probe was made from XhoI linearized plasmid pc3-2 mprd (Goulding et al., 1991) that contains a 2.3-kb Pax3 cDNA insert, using T7 RNA polymerase. Antisense t-va probe was generated as described by Dunn et al. (2000). β-Galactosidase staining was performed as described by Hou et al. (2000).

Genotyping

Sox10LacZ mice were generated by targeted insertion of the lacZ reporter gene into the Sox10 locus (Britsch et al., 2001). To generate mice double heterozygous for Sox10LacZ and Tg(Pax3-tv-a)HPvn, Sox10LacZ/+ mice were bred with Tg(Pax3-tv-a)HPvn/+. To generate embryos of Tg(Pax3-tv- a)HPvn/+;Sox10LacZ/Sox10LacZ and +/+;Sox10LacZ/Sox10LacZ genotypes, matings were set up between double-heterozygous Tg(Pax3-tv-a)HPvn/+;Sox10LacZ/+ mice. Embryos were harvested at E9.5. Genotyping of Sox10 mutant embryos was performed as described previously (Britsch et al., 2001). Genotyping for P3Ptv-a800 transgenics used PCR primers TVAR-out2 CAGTGATCAGCATCCACATGC and Pax3prom39-CTGGAGCCTGTGGACTTGGAT. P3PlacZ transgenics were genotyped with PCR primers LacZ F- GATCCGCGCTGGCTACCGGC with LacZ R-GGATACTGACGAAACGCCTGCC.

Neural Tube Explant Culture and Virus Infection

RCAS-NHA-Sox10 vector was generated by introduction of Sox10 cDNA into a GW-compatible RCASBP-Y NHA vector containing an amino HA tag and RCAS viruses were produced as previously described (Loftus et al., 2001). Trunk neural tubes were harvested from embryos at E9.5, a stage at which neural crest cells have not yet emigrated from the neural tube as described previously (Ito and Takeuchi, 1984) and defined as day 0 for NC culture. NC cells were cultured under conditions of 90% DMEM, 1 mM L-glutamine, 1 mM penicillin–streptomycin, and 10% fetal bovine serum, EDN3 (Sigma) at 10 nM, and stem cell factor (R&D Systems) at 100 ng/ml, 5% CO2. After 1 day of the cultures, the NC cells were infected with RCAS-GFP or RCAS-NHA-Sox10 expressing virus for 8 to 12 hr.

Antibodies and Immunostaining

The NC cells of various culture days were fixed in 4% PFA in PBS (pH 7.5) for 25 min at room temperature and then permeabilized with 0.1% Triton X-100 for 5 min. For double immunolabeling, SOX10 (Potterf et al., 2001) and hemagglutinin (HA; Covance) were diluted 1:200 and added to the cells for incubation at 37°C for 60 min, respectively. The primary antibodies were revealed with rhodamine isothiocyanate–coupled goat anti-rabbit (Fab)2 or fluorescein isothiocyanate-coupled goat anti-mouse (Fab)2. Melanocyte differentiation from NC cells was identified by the presence of melanin granules and typical dendrite morphology under phase-contrast and bright-field microscopy.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES

We thank Dr. Michael Wegner for providing Sox10LacZ mice; Dr. Harold Varmus for the pCI tv-a800 vector, and Dr. Doug Foster for DF-1 cells. We also thank Dr. Ramin Mollaaghababa and Karen J. Dunn for sharing reagents. We thank Drs. Laura Baxter and Dawn Watkins-Chow for valuable comments and critical reading of the manuscript.

REFFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFFERENCES
  • Arnheiter H, Hou L, Nguyen MT, Nakayama A, Champagne B, Hallsson JH, Bismuch K. 2002. The role of microphthalmia in pigment cell development. In: OrtonneJP, BalottiR, editors. Mechanisms of suntanning. London: Martin Dunitz Publication. p 4963.
  • Bolande RP. 1997. Neurocristopathy: its growth and development in 20 years. Pediatr Pathol Lab Med 17: 125.
  • Bondurand N, Girard M, Pingault V, Lemort N, Dubourg O, Goossens M. 2001. Human Connexin 32, a gap junction protein altered in the X-linked form of Charcot-Marie-Tooth disease, is directly regulated by the transcription factor SOX10. Hum Mol Genet 10: 27832795.
  • Britsch S, Goerich DE, Riethmacher D, Peirano RI, Rossner M, Nave KA, Birchmeier C, Wegner M. 2001. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev 15: 6678.
  • Dunn KJ, Williams BO, Li Y, Pavan WJ. 2000. Neural crest-directed gene transfer demonstrates Wnt1 role in melanocyte expansion and differentiation during mouse development. Proc Natl Acad Sci U S A 97: 1005010055.
  • Dunn KJ, Incao A, Watkins-Chow D, Li Y, Pavan WJ. 2001. In utero complementation of a neural crest-derived melanocyte defect using cell directed gene transfer. Genesis 30: 7076.
  • Dutton KA, Pauliny A, Lopes SS, Elworthy S, Carney TJ, Rauch J, Geisler R, Haffter P. Kelsh RN. 2001. Zebrafish colourless encodes sox10 and specifies non-ectomesenchymal neural crest fates. Development 128: 41134125.
  • Epstein JA. 2000. Pax3 and vertebrate development. Methods Mol Biol 137: 459470.
  • Federspiel MJ, Bates P, Young JA, Varmus HE, Hughes SH. 1994. A system for tissue-specific gene targeting: transgenic mice susceptible to subgroup A avian leukosis virus-based retroviral vectors. Proc Natl Acad Sci U S A 91: 1124111245.
  • Fisher GH, Orsulic S, Holland E, Hively WP, Li Y, Lewis BC, Williams BO, Varmus HE. 1999. Development of a flexible and specific gene delivery system for production of murine tumor models. Oncogene 18: 52535260.
  • Fults D, Pedone C, Dai C, Holland EC. 2002. MYC expression promotes the proliferation of neural progenitor cells in culture and in vivo. Neoplasia 4: 3239.
  • Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P. 1991. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J 10: 11351147.
  • Hartley JL, Temple GF, Brasch MA. 2000. DNA cloning using in vitro site-specific recombination. Genome Res 10: 17881795.
  • Herbarth B, Pingault V, Bondurand N, Kuhlbrodt K, Hermans-Borgmeyer I, Puliti A, Lemort N, Goossens M, Wegner M. 1998. Mutation of the Sry-related Sox10 gene in Dominant megacolon, a mouse model for human Hirschsprung disease. Proc Natl Acad Sci U S A 95: 51615165.
  • Holland EC, Varmus HE. 1998. Basic fibroblast growth factor induces cell migration and proliferation after glia-specific gene transfer in mice. Proc Natl Acad Sci U S A 95: 12181223.
  • Hou L, Panthier JJ, Arnheiter H. 2000. Signaling and transcriptional regulation in the neural crest-derived melanocyte lineage: interactions between KIT and MITF. Development 127: 53795389.
  • Hughes SH, Greenhouse JJ, Petropoulos CJ, Sutrave P. 1987. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. J Virol 61: 30043012.
  • Ito K, Takeuchi T. 1984. The differentiation in vitro of the neural crest of the mouse embryo. J Embryol Exp Morphol 84: 4962.
  • Kim J, Lo L, Dormand E, Anderson DJ. 2003. SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron 38: 1731.
  • Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M. 1998. Sox10, a novel transcriptional modulator in glial cells. J Neurosci 18: 237250.
  • Landy A. 1989. Dynamic, structural, and regulatory aspects of lambda site-specific recombination. Annu Rev Biochem 58: 913949.
  • Lane PW, Liu HM. 1984. Association of megacolon with a new dominant spotting gene (Dom) in the mouse. J Hered 75: 435439.
  • Lang D, Chen F, Milewski R, Li J, Lu MM, Epstein JA. 2000. Pax3 is required for enteric ganglia formation and functions with Sox10 to modulate expression of c-ret. J Clin Invest 106: 963971.
  • Le Douarin NM, Kelchelin C. 1999. The neural crest. Cambridge, UK: Cambridge University Press.
  • Lee M, Goodall J, Verastegui C, Ballotti R, Goding CR. 2000. Direct regulation of the Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated hypopigmentation and deafness to WS2. J Biol Chem 275: 3797837983.
  • Li J, Liu KC, Jin F, Lu MM, Epstein JA. 1999. Transgenic rescue of congenital heart disease and spina bifida in Splotch mice. Development 126: 24952503.
  • Li J, Chen F, Epstein JA. 2000. Neural crest expression of Cre recombinase directed by the proximal Pax3 promoter in transgenic mice. Genesis 26: 162164.
  • Liu Q, Melnikova IN, Hu M, Gardner PD. 1999. Cell type-specific activation of neuronal nicotinic acetylcholine receptor subunit genes by Sox10. J Neurosci 19: 97479755.
  • Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. 2001. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 8: 221226.
  • Loftus SK, Larson DM, Baxter LL, Antonellis A, Chen Y, Wu X, Jiang Y, Bittner M, Hammer JA III, Pavan WJ. 2002. Mutation of melanosome protein RAB38 in chocolate mice. Proc Natl Acad Sci U S A 99: 44714476.
  • McCallion AS, Chakravarti A. 2001. EDNRB/EDN3 and Hirschsprung disease type II. Pigment Cell Res 4: 161169.
  • Mollaaghababa R, Pavan WJ. 2003. The importance of having your SOX on: role of SOX10 in the development of neural crest-derived melanocytes and glia. Oncogene 22: 30243034.
  • Pao W, Klimstra DS, Fisher GH, Varmus HE. 2003. Use of avian retroviral vectors to introduce transcriptional regulators into mammalian cells for analyses of tumor maintenance. Proc Natl Acad Sci U S A 100: 87648769.
  • Paratore C, Goerich DE, Suter U, Wegner M, Sommer L. 2001. Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor Sox10 and extrinsic combinatorial signaling. Development 128: 39493961.
  • Peirano RI, Goerich DE, Riethmacher D, Wegner M. 2000. Protein zero gene expression is regulated by the glial transcription factor Sox10. Mol Cell Biol 20: 31983209.
  • Pingault V, Bondurand N, Kuhlbordt K, Goerich DE, Prehu MO, Puliti A, Herbarth B, Hermans-Borgmeyer I, Leguis E, Matthijs G, Amile J, Lyonnet S, Ceccherini I, Romeo G, Smith JC, Read AP, Wegner M, Goossens M. 1998. SOX10 mutations in patients with Waardenburg-Hirschprung disease. Nat Genet 18: 171173.
  • Potterf SB, Furumura M, Dunn KJ, Arnheiter H, Pavan WJ. 2000. Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3. Hum Genet 107: 16.
  • Potterf SB, Mollaaghababa R, Hou L, Southard-Smith EM, Hornyak TJ, Arnheiter H, Pavan WJ. 2001. Analysis of SOX10 function in neural crest-derived melanocyte development: SOX10-dependent transcriptional control of dopachrome tautomerase. Dev Biol 237: 245257.
  • Southard-Smith EM, Kos L, Pavan, WJ. 1998. Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat Genet 18: 6064.
  • Weston JA. 1986. Phenotypic diversification in neural crest-derived cells: the time and stability of commitment during early development. Curr Top Dev Biol 20: 195210.