SEARCH

SEARCH BY CITATION

Keywords:

  • chorioallantoic membrane;
  • lymphangiogenesis;
  • lymphangioblast;
  • endothelium;
  • VEGF-C;
  • VEGFR-3;
  • Prox1;
  • quail-chick chimera

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The lymphatics of the intestinal organs have important functions in transporting chyle toward the jugulosubclavian junction, but the lymphangiogenic potential of the splanchnic mesoderm has not yet been tested. Therefore, we studied the allantoic bud of chick and quail embryos. It is made up of endoderm and splanchnic mesoderm and fuses with the chorion to form the chorioallantoic membrane (CAM) containing both blood vessels and lymphatics. In day 3 embryos (stage 18 of Hamburger and Hamilton [HH]), the allantoic mesoderm consists of mesenchymal cells that form blood islands during stage 19 (HH). The endothelial network of the allantoic bud, some intraluminal and some mesenchymal cells express the hemangiopoietic marker QH1. The QH1-positive endothelial cells also express the vascular endothelial growth factor receptor-3 (VEGFR-3), whereas the integrating angioblasts and the round hematopoietic cells are QH1-positive/VEGFR-3–negative. The ligand, VEGF-C, is expressed ubiquitously in the allantoic bud, and later predominantly in the allantoic epithelium and the wall of larger blood vessels. Allantoic buds of stage 17–18 (HH) quail embryos were grafted homotopically into chick embryos and reincubated until day 13. In the chimeric CAMs, quail endothelial cells are present in blood vessels and lymphatics, the latter being QH1 and VEGFR-3 double-positive. QH1-positive hematopoietic cells are found at many extra- and intraembryonic sites, whereas endothelial cells are confined to the grafting site. Our results show that the early allantoic bud contains hemangioblasts and lymphangioblasts. The latter can be identified with Prox1 antibodies and mRNA probes in the allantoic mesoderm of day 4 embryos (stage 21 HH). Prox1 is a specific marker of the lymphatic endothelium throughout CAM development. © 2001 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The development of the embryonic lymphatic system has been studied descriptively, but experimental studies have not been performed until recently (Wigle and Oliver, 1999; Schneider et al., 1999; Wilting et al., 2000). The first description of the lymphatics goes back to Asellius (1627) who dissected dogs (cited from Rusznyák et al., 1969). Budge (1882, 1887) was the first to describe lymphatics in avian embryos. Generally, the lymphatics develop much later than the blood vessels (review see: Wilting et al., 1998). In chick embryos, the deep lymphatics are first detectable during days 4–5 of incubation (Clark and Clark, 1920). These deep lymphatics are situated adjacent to large embryonic veins. In the neck region of the chick embryo, a paired deep lymphatic plexus develops adjacent to the junction of the pre- and postcardinal veins (Miller, 1912). This plexus gives rise to the juguloaxillary lymph sac of 6-day-old chick embryos (Schneider et al., 1999). More caudally, the cisterna chyli and a mesenterial (retroperitoneal) lymph sac are found, and, in the lumbosacral region, the paired posterior (pelvic) lymph sacs are located (Sabin, 1909).

Different theories about the origin of the lymphatics have been proposed: Sabin (1909) described that the lymph sacs were derived from adjacent embryonic veins at specific localized areas. These lymph sacs were then suggested to grow by sprouting centrifugally into primarily alymphatic tissues and organs of the embryo. According to this theory, lymphatic endothelial cells were derived exclusively from the endothelium of the venous system. This view seemed to be supported by recent findings by Wigle and Oliver (1999), who showed that the growth of the lymphatics and the lymph sacs is dependent on the function of the Prox1 homeobox gene, which is the vertebrate homolog of the Drosophila gene prospero (Oliver et al., 1993; Tomarev et al., 1996). In contrast, Huntington (1908), McClure (1908), and Kampmeier (1912) assumed mesenchymal cells to be the source of lymphatic vessels, which means that lymphatics develop independently from the veins by confluence of “lymphatic clefts,” fusing with the lymph sacs by centripetal growth. According to van der Jagt (1932), both mechanisms may occur simultaneously. Descriptive studies carried out by serial sectioning and injection methods (Miller, 1912; Clark, 1912) could not solve this basic question about the origin of the lymphatic vessels.

We have recently shown that the lymphatics of birds are not exclusively derived by sprouting from the lymph sacs. Additionally, lymphangioblasts are present in the embryonic mesenchyme (Schneider et al., 1999). This could be shown by interspecific grafting experiments of the early wing bud. The lymphatic endothelium of the avian wing receives a major contribution from lymphangioblasts derived from the paraxial/somitic mesoderm already before the formation of the lymph sacs (Wilting et al., 2000). However, the lymphangiogenic potency of the splanchnic mesoderm, which forms the blood vessels of the inner organs, has not been studied. Therefore, we studied the allantois, which is made up of endoderm and splanchnic mesoderm. The allantois fuses with the avascular chorion to form the chorioallantoic membrane (CAM). The CAM is the respiratory organ of avian embryos. It is fully differentiated by day 13 and contains a dense network of VEGFR-3–positive lymphatics accompanying the arteries and veins (Wilting et al., 1996; Oh et al., 1997). According to the hypothesis of Sabin (1909), the lymphatics of the CAM would develop as sprouts from the posterior lymph sacs. Here, we present a description of the allantois by means of semithin sections, QH1 and Prox1 immunohistology, and in situ hybridization with VEGF-C, Prox1, and VEGFR-3 probes. We have then performed homotopic grafting of the allantois of 3-day-old quail embryos into chick embryos, which means that the grafting was performed approximately 2 days before the lymph sacs are visible. After 10 days of reincubation, we have observed quail-derived lymphatics in the CAM of the chick hosts which are QH1 and VEGFR-3 double-positive. The results show that the splanchnic mesoderm contains lymphangioblasts that are at first Prox1-negative, but soon become Prox1-positive. The lymphatics of the CAM are of endogenous origin, and only a small part of them might also be derived by sprouting from the posterior lymph sacs.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Structure and Molecular Analysis of the Developing CAM

The CAM contains an almost regular pattern of interdigitating arteries and veins. Additionally, lymphatics are a major constituent of the CAM vasculature (Fig. 1). A pair of lymphatics was regularly seen along the arteries and arterioles, with anastomoses connecting the larger lymphatics (Fig. 1A). A dense plexus of lymphatic capillaries accompanied the CAM veins (Fig. 1B). The lymphatics are drained into lymphatic trunks of the umbilicus (Fig. 6A) and connected to the posterior lymph hearts (Wilting et al., 1999). The lymphatic endothelial cells of the differentiated CAM were characterized by the expression of VEGFR-3/Quek2 mRNA (Fig. 1C,D). In accordance with previous studies, none of the endothelial cells of the blood vascular tree expressed this receptor in the differentiated CAM (Wilting et al., 1996; Oh et al., 1997).

thumbnail image

Figure 1. Differentiated chorioallantoic membrane (CAM) of day 13 chick (A,B) and day 12 quail embryos (C,D). A,B: Intralymphatic injection of Merkox-blue shows a typical pair of lymphatics (arrows) accompanying the arterial system (A), and the lymphatic plexus around larger veins (B). C,D: In situ hybridization of paraffin sections with a VEGFR-3/Quek2 probe reveals a positive signal in the lymphatics (l). The vein (v) is negative. D: Higher magnification of C.

Download figure to PowerPoint

The CAM develops by fusion of the allantoic bud with the avascular chorion. The high angiogenic potential of the allantoic mesoderm is well known, but the origin of the lymphatics has not been studied yet. The semithin sections showed that the allantois of stage 18 (Hamburger and Hamilton [HH]) chick embryos (day 3) is made up of endoderm and mesoderm (Fig. 2A,B). The mesoderm consisted of ramified cells organized as a mesenchyme and covered by a mesothelial lining. Some of the mesodermal cells were arranged in clusters (Fig. 2B). In stage 19 (HH) chick embryos, hemangiopoietic differentiation of mesodermal cells became visible (Fig. 2C–E). Formation of blood islands was observed both close to the mesothelium (Fig. 2D) and in central parts of the mesoderm (Fig. 2E). The central cells of the blood islands differentiated into erythroblastic cells, the peripheral ones took up an endothelial morphology. The blood islands were covered by a layer of mesenchymal cells (Fig. 2E). The allantoic mesoderm contained various QH1-positive cells (Fig. 3). QH1 is a marker of quail hemangiopoietic cells and lymphatic endothelial cells (Pardanaud et al., 1987; Wilting et al., 1997). The endothelial cells of the perfused blood vessels of the allantois of stage 18 (HH) quail embryos stained strongly with the QH1 antibody, whereas the nonperfused endothelial networks stained only to a weaker extent (Fig. 3A,B). Additionally, round cells located either in the lumen of blood vessels or in the mesoderm were QH1-positive (Fig. 3B). Furthermore, the QH1 antibody stained ramified mesodermal cells, which appeared to become integrated into the endothelial network (Fig. 3C) and were, therefore, identified as angioblasts. The QH1 and VEGFR-3 double staining showed that the endothelial network of the allantois was positive for both markers. In contrast, neither the round QH1-positive cells nor the angioblasts expressed VEGFR-3 (Fig. 3C,D).

thumbnail image

Figure 2. Sagittal, semithin sections of the caudal end of stage 18 (of Hamburger and Hamilton [HH]) (A,B) and stage 19 (HH) (C–E) chick embryos. A: Low magnification showing the somites (s), amnion (a), chorion (c), posterior intestinal port (white arrow), and the allantoic bud (black arrow). B: Higher magnification of A showing the allantoic endoderm (e) and mesoderm (m). C: Low magnification showing the neural tube (n), posterior intestinal port (white arrow), and the allantoic bud (black arrow). D,E: Higher magnifications of C. Note formation of blood islands (b) in peripheral (D) and central parts (E) of the allantoic mesoderm.

Download figure to PowerPoint

thumbnail image

Figure 3. QH1 staining (A,B), and QH1 plus VEGFR-3 double-staining (C,D) of the allantoic bud of stage 17–18 (Hamburger and Hamilton [HH]) quail embryos. A: Overview showing allantoic endoderm (e) and mesoderm (m). B: Higher magnification of (A). Note strong QH1 signal in luminised vessels and a weaker signal in the nonperfused endothelial networks. Some round QH1-positive cells (arrowheads) are located in the mesoderm. C,D: Double staining of a section with QH1 (C) and VEGFR-3 (D). The endothelial network is double-positive. Some round cells (arrowheads) and some ramified angioblasts (arrows) are QH1-positive but VEGFR-3–negative. The cells are not visible in D, but their positions are marked accordingly.

Download figure to PowerPoint

It has been shown that VEGF-C is of major importance during early embryonic angiogenesis (Dumont et al., 1998), and a mitogen of lymphatic endothelial cells (Jeltsch et al., 1997; Oh et al., 1997). Therefore, we have studied the expression of VEGF-C in the early allantois and in the differentiated CAM. Whereas the sense probe did not reveal a signal (Figs. 4A, 5A,C), the antisense probe showed that VEGF-C is expressed ubiquitously in the allantoic mesoderm and endoderm of stage 18 (HH) embryos (Fig. 4B,C). In the CAM of 13-day-old embryos, VEGF-C expression was strongest in the allantoic epithelium (Fig. 5B) and in the wall of the large blood vessels (Fig. 5D).

thumbnail image

Figure 4. In situ hybridization of the allantoic bud of stage 18 (HH) quail embryos with a VEGF-C sense probe (A) and antisense probe (B,C). A,B: Overview of the allantoic bud. C: Higher magnification of (B). Note ubiquitous expression of VEGF-C in the allantoic mesoderm. No signal can be detected with the sense probe.

Download figure to PowerPoint

thumbnail image

Figure 5. VEGF-C in situ hybridization of the differentiated chorioallantoic membrane (CAM) of 13-day-old quail embryos (A–D). The sense probe does not reveal a specific labelling (A,C). Note VEGF-C expression in the allantoic epithelium (B) and in the endothelium and smooth muscle cells of large blood vessels (D). a, allantoic epithelium; ar, artery; c, chorionic epithelium.

Download figure to PowerPoint

It has been shown recently that the homeobox-containing transcription factor Prox1 is a very early marker of lymphatic endothelial cells (Wigle and Oliver, 1999). Therefore, we have studied the expression of Prox1 in the allantois and the CAM on protein and mRNA levels. In 13-day-old embryos, the Prox1 protein is located in the nucleus of lymphatic endothelial cells. This was observed in the lymphatics of the umbilicus (Fig. 6A) and the CAM (Fig. 6B). No staining was found in the allantois of 3-day-old (stage 18 HH) chick embryos (Fig. 6C), whereas the liver of these embryos stained brightly (Fig. 6D). The same expression pattern was observed on mRNA level (Fig. 7A,B). A strong signal was found in the liver, whereas the allantois was negative. Additionally, Prox1 was expressed in the lens, retina, otic placode, spinal and sympathic nerves, cardiac trabeculae, and apical ectodermal ridge (partially visible in Fig. 7). However, on day 4, Prox1 mRNA expression was observed in the allantoic bud of stage 21 (HH) chick embryos (Fig. 7C,D). Single cells and networks of Prox1-positive cells were distributed evenly throughout the allantois. This finding could be confirmed by immunohistologic studies. In stage 21 (HH) embryos, some Prox1-positive cells were found in the mesoderm of the allantois (Fig. 8A). Their number increased during later stages, and they were then preferentially located in the vicinity of larger blood vessels of 5-day-old chick embryos (Fig. 8B,C).

thumbnail image

Figure 6. Prox1 immunofluorescence. A,B: Staining of the lymphatics of the day 13 chick umbilical cord (A) and chorioallantoic membrane (CAM; B). A: Lymphatics (l) accompanying the umbilical artery (a) and vein (v) are Prox1-positive. Lymphatic trunk (lt). B: Lymphatics (l) surrounding a small CAM artery (a). The Prox1 protein is located in the nuclei. C: Staining of the allantoic bud of a stage 18 (HH) chick embryo. No Prox1 signal is visible. m, mesoderm; e, endoderm. D: Staining of the nuclei of hepatocytes in the liver of the same embryo as in (C).

Download figure to PowerPoint

thumbnail image

Figure 7. Prox1 in situ hybridization of stage 18 (of Hamburger and Hamilton [HH]) chick embryos (A,B) and stage 21 (HH) chick embryos (C,D). A: A signal is visible in the lens, retina, liver (arrowhead), and, to a weaker extent, in the trabeculae of the heart. The allantois (arrow) is negative as demonstrated at higher magnification in B. C: On day 4, a signal is visible in the allantois (arrow). D: Higher magnification of (C) showing evenly distributed Prox1-positive cells in the allantois.

Download figure to PowerPoint

thumbnail image

Figure 8. Prox1 immunofluorescence of lymphangioblasts in the allantois. A: On day 4 (stage 21 HH), a few Prox1-positive cells (arrows) can be observed in the mesoderm. B: On day 4.5 (stage 24 HH) Prox1-positive cells are almost evenly distributed in the allantoic mesoderm. C: On day 5, Prox1-positive cells are preferentially located around large blood vessels (star).

Download figure to PowerPoint

Experimental Studies on CAM Lymphatics

To determine the lymphangiogenic potential of the early allantoic mesoderm, we grafted the allantoic bud of stage 17–18 (HH) quail embryos homotopically into corresponding chick embryos (schematically illustrated in Fig. 9). The hosts were reincubated until day 13. Several pieces of each CAM and the umbilicus, and various organs of the host embryos proper, were fixed and studied for quail endothelial cells with the QH1 antibody, and with QH1 and VEGFR-3 double staining. We observed that the allantoic bud possesses an extremely high regenerative potential. Most parts of the CAM of the host embryos were exclusively of chick origin, although the allantoic bud had been removed. However, in 6 of 10 experiments, we found major contributions of the graft to the host CAM. In these specimens, the quail endothelial cells were identified with the QH1 antibody (Fig. 10A,C). These endothelial cells contributed to arteries (Fig. 10A), veins (Fig. 10C), and to capillaries surrounding these vessels. The QH1 and VEGFR-3 double staining showed that quail endothelial cells also contributed to lymphatics accompanying both arteries and veins (Fig. 10A–D). This clearly shows that the allantoic mesoderm of stage 17–18 (HH) embryos possesses lymphangiogenic potential, before development of the posterior lymph sacs and also before expression of the lymphatic marker, Prox1.

thumbnail image

Figure 9. Schematic illustration of the interspecific grafting. The allantoic bud of a stage 18 (of Hamburger and Hamilton [HH]) quail embryo (grey) was grafted homotopically into a corresponding chick embryo (white). The host embryos were reincubated until day 13.

Download figure to PowerPoint

thumbnail image

Figure 10. Homotopic grafting of the allantoic bud of a stage 18 (of Hamburger and Hamilton [HH]) quail embryo into a corresponding chick embryo. Reincubation of the hosts lasted until day 13. QH1 (A,C) and VEGFR-3 (B,D) double-staining. A: Note integration of QH1-positive quail endothelial cells into a chorioallantoic membrane (CAM) artery (a) and surrounding lymphatics (l), which are VEGFR-3-positive (B). C: Integration of QH1-positive quail endothelial cells into a CAM vein (v) and surrounding lymphatics (l), which are VEGFR-3–positive (D).

Download figure to PowerPoint

To study the distribution and behaviour of the endothelial precursors of the allantoic bud mesoderm, we additionally performed QH1 staining of serial sections of various parts of the body of the host embryos, focussing on lymphoid organs. We did not observe QH1-positive endothelial cells at intraembryonic sites, but ramified QH1-positive cells were found at various locations. They were frequently observed in the tunica media and adventitia of the abdominal vessels (Fig. 11A), and in the bone marrow of the ilium (Fig. 11B). Additionally, such cells were found in the perichondrium of the pelvis and within soft connective tissue.

thumbnail image

Figure 11. Homotopic grafting of the allantoic bud of a stage 18 (HH) quail embryo into a corresponding chick embryo. Reincubation of the hosts until day 13 and QH1 staining of paraffin sections. A: QH1-positive cells in the tunica media and adventitia of the intra-abdominal part of the umbilical artery. B: QH1-positive cells in the bone marrow of the ilium.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Lymphangioblasts in the Allantoic Mesoderm

The CAM develops at the inner surface of the egg shell by fusion of the densely vascularized allantois with the avascular chorion. The differentiated CAM is lined by an outer, ectodermal, chorionic epithelium, and an inner, endodermal, allantoic epithelium. The capillary plexus is located within the chorionic epithelium, and the blood-air-barrier of this respiratory organ is, therefore, extremely thin. The larger blood vessels are located in the mesodermal stroma (Leeson and Leeson, 1963). The allantoic (umbilical) artery and vein are originally paired, but the right member in each case regresses. In accordance with previous studies (Wilting et al., 1996; Oh et al., 1997; Papoutsi et al., 2000), we have shown that the arteries and veins of the differentiated CAM are accompanied by lymphatics which are characterized by the expression of two markers: VEGFR-3 and Prox1.

It is well known that the blood vessels of the CAM originate from the allantoic mesoderm (Hamilton, 1965), but the embryonic development of CAM lymphatics has not been studied yet. According to the theories proposed by Sabin (1909), the lymphatics are exclusively derived by sprouting of the early embryonic lymph sacs. Therefore, the lymphatics of the CAM would be derived from the posterior (pelvic) lymph sacs. These lymph sacs are not detectable before day 5 of incubation (Miller, 1913). We have investigated the origin of CAM lymphatics by means of descriptive studies and with the quail/chick chimera model (Le Douarin, 1969). We have grafted the allantoic bud of 3-day-old quail embryos (stage 17–18 HH) homotopically into chick embryos. The hosts were reincubated until day 13 when the CAM is fully differentiated and VEGFR-3 serves as a specific marker of lymphatic endothelial cells in the CAM. Our results unequivocally show that on day 3 the allantoic mesoderm has lymphangiogenic potential. The CAM of the host (chick) contained areas where the endothelium of the blood vessels and the lymphatics were of donor (quail) origin. The lymphatics in these areas are QH1 and VEGFR-3 double-positive, and they are located in their typical position around arteries and veins. The results demonstrate lymphangiogenic potential of the allantoic mesoderm long before the development of the posterior lymph sacs. On day 3, the allantoic mesoderm contains ramified cells that aggregate and form blood islands. In contrast to the blood islands in the yolk sac (Wilting et al., 1995a), the allantoic blood islands are immediately covered by additional mesodermal cells. Neither VEGFR-3 nor Prox1 are markers of the allantoic lymphangioblasts on day 3 (stage 17–18 HH). VEGFR-3 is expressed as soon as blood vascular endothelial networks have formed. During tissue maturation, the receptor expression then becomes restricted to the lymphatic endothelium (Kaipainen et al., 1995; Wilting et al., 1997). However, VEGFR-3 is not expressed in isolated mesenchymal cells, and is, therefore, neither a marker of angioblasts nor of lymphangioblasts. VEGF-C, the ligand of VEGFR-3, is expressed ubiquitously in the early allantoic bud and may serve as an angiogenic growth factor during early development. This finding is in line with the observation that VEGFR-3–deficient mice die of cardiovascular failure during early embryonic development (Dumont et al., 1998). In the differentiated CAM, high levels of VEGF-C expression are restricted to two sites: the allantoic epithelium and the wall of larger blood vessels. The lymphatics of the CAM are located immediately adjacent to the larger blood vessels, and it can be assumed that the expression of VEGF-C in the blood vascular wall serves for the patterning of lymphatics. In the adult, constitutive expression of VEGF-C may then serve as a maintenance factor for the lymphatics (Eriksson and Alitalo, 1999). This function seems to be of major importance for the lymphatic capillaries, because these are not stabilized by a continuous basal lamina and pericytes. We have previously shown that the application of VEGF-C on the differentiated CAM induces development of lymphatics, which are derived by proliferation and growth of the preexisting lymphatics (Oh et al., 1997). VEGF-C, is synthesized as a prepropeptide of 61 kDa and undergoes proteolytic maturation (Korpelainen and Alitalo, 1998). The immature and mature forms of VEGF-C bind VEGFR-3 (flt4, Quek2) with high affinity (Joukov et al., 1996; Lee et al., 1996; Eichmann et al., 1998), whereas only the mature form binds VEGFR-2 (KDR, flk1, Quek1) (Joukov et al., 1997). The two receptors are expressed in the lymphatic endothelium of the CAM (Oh et al., 1997).

The earliest known marker of the lymphatic endothelium is the homeobox-containing transcription factor Prox1. In mice, Prox1 mRNA is expressed in a subpopulation of endothelial cells of the early jugular vein and in the endothelium of the lymph sacs. Expression is then found in differentiated lymphatics, but not in blood vessels (Oliver et al., 1993; Wigle and Oliver, 1999). We have observed the same expression pattern in chick embryos (unpublished data). In Prox1-deficient mice, the development of the lymphatics is arrested shortly after the lymph sacs have formed, and the embryos show severe edema (Wigle and Oliver, 1999). These mice die during early stages of development, probably due to malformations of the liver, which also expresses Prox1 (Wigle et al., 1999). The expression pattern of Prox1 in the chick is identical to that of the mouse (Tomarev et al., 1996). Additionally, in the differentiated CAM Prox1 is a specific marker of lymphatic endothelial cells. No Prox1-positive cells can be observed in the allantoic bud of stage 18 (HH) chick embryos (day 3) neither on protein nor on mRNA levels, although the experiments demonstrate the existence of lymphatic precursors in this tissue. However, 1 day later, Prox1 is expressed in scattered cells of the allantoic mesoderm of stage 21 (HH) embryos and there is no indication of a localized budding or sprouting of the lymphatics from the allantoic veins. Unlike the jugular vein, there is no expression of Prox1 in restricted areas of the allantoic veins, which might have indicated a venous origin of the allantoic lymphatics. Furthermore, early lymph sacs are retrogradely filled with blood and have been identified by their dark, stagnant blood (Clark and Clark, 1920). Such features have never been observed in the allantois. In contrast, the scattered Prox1-positive cells of the allantois soon form lymphatic networks, which are preferentially located adjacent to the large blood vessels of the CAM of day 5 embryos. It seems to be of great functional importance that the two vascular systems do not fuse with each other. Only in the coccygeal region do lymphovenous anastomoses exist and are characterized by the development of specialized contractile structures, the lymph hearts (Berens von Rautenfeld and Budras, 1981; Wilting et al., 1999). Later, these anastomoses become severed and the thoracic duct takes up function. Our results strongly suggest that lymphangioblasts are at first Prox1-negative, but expression of the gene then starts during commitment of mesenchymal cells to the lymphatic endothelial lineage. Our results demonstrate that lymphangioblasts are present in the allantois, and, therefore, the mechanisms driving angiogenesis and lympangiogenesis are very much alike. Lymphangiogenesis seems to be a complex process involving both the development of lymphatics from specialized parts of specific veins, and the fusion and tube formation of lymphangioblasts located in the mesoderm.

Circulating Angioblasts From the Allantois?

In our experiments, we have not been able to detect either blood vascular or lymphatic endothelial cells in places other than the CAM. The emergence of circulating angioblasts from the allantoic bud has been reported recently (Caprioli et al., 1998). We have observed QH1-positive cells, most likely representing macrophages, in numerous intraembryonic sites such as the walls of arteries, connective tissue, and bone marrow. That we could not detect circulating angioblasts could mean that this population of cells is either very small, and we have, therefore, missed them, or these cells are not all present in early avian development. The latter seems to be supported by the fact that circulating angioblast were not detected in quail/chick parabiosis studies in which the chick becomes perfused by quail blood cells (Kurz and Christ, 1998, Kurz et al., 2001). The major difference of our studies and those by Caprioli et al. (1998) resides in the fact that these authors have grafted the allantoic bud into the coelomic cavity, whereas we have performed homotopic grafting. Several studies of various groups have shown that angioblasts grafted into the coelomic cavity migrate through the mesenchyme and integrate into the lining of blood vessels (Christ et al., 1990; Pardanaud and Dieterlen-Lièvre, 1999). By this means, the cells may also have become integrated into the bone marrow vasculature, where they have been observed by Caprioli et al. (1998). However, the emergence of circulating angioblasts in avian development calls for further investigations.

In summary, our study shows that lymphangioblasts are present in the splanchnic mesoderm of the allantoic bud. This finding is in line with the observation of lymphangioblasts in the paraxial mesoderm (Wilting et al., 2000). Angioblasts and lymphangioblasts are obviously derived from identical mesodermal subcompartments. Lymphangioblasts are at first Prox1-negative, but start expressing this transcription factor while still located in the mesenchyme.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Embryos

Fertilized chick and quail eggs were incubated in a humidified atmosphere at 37.8°C. Staging was performed according to Hamburger and Hamilton (1952). Embryos were fixed at various stages of development for descriptive studies. Interspecific grafting experiments were performed as described below.

Injection Method

The lymphatics of 13-day-old chick embryos were perfused with 3% glutaraldehyde and 2% formaldehyde fixative. Two milliliters of Merkox-blue (Norwald, Hamburg, Germany) were mixed with 25 μl of accelerator and injected into the lymphatics of the CAM or the umbilicus by using fine glass needles and a micromanipulator.

Plastic Sections

Specimens were fixed with 3% glutaraldehyde and 2% formaldehyde in 0.12 M sodium-cacodylate buffer. They were dehydrated and embedded in Epon resin (Serva, Heidelberg, Germany) according to standard procedures. Semithin sections of 0.75 μm thickness were cut with an Ultracut S (Leica) and stained with 1% methylene blue and 1% azure II (Fluka, Buchs, Switzerland).

Grafting Experiments

To study the origin of the lymphatic endothelium in the chorioallantoic membrane (CAM), we performed homotopic grafting of the allantois, making use of the quail/chick chimera model (Le Douarin, 1969). Grafting was performed on day 3 embryos of stages 17–18 (HH). The allantois of quail embryos was dissected and transplanted homotopically into corresponding chick embryos (10 experiments). For that purpose, quail donors were removed from the eggs, placed into agar dishes, and the allantois was dissected. The chick hosts were operated in ovo. The allantois was removed and substituted by the quail allantois (Fig. 9). The hosts were reincubated until day 13 of development when the CAM is fully differentiated. Then the CAMs were fixed and studied with the methods described below.

Hybridization of Paraffin Sections

Normal and experimental embryos were fixed overnight at 4°C in Serra's fixative (Serra, 1946). The samples were dehydrated and embedded in paraffin wax, and 8-μm sections were mounted onto silanized slides. The sections were post-fixed in 4% paraformaldehyde solution (PFA) and, in older specimens, treated with proteinase K, and refixed in 4% PFA. The quail VEGFR-3/Quek2 mRNA riboprobe has been described previously. Quek2 has 70% identity with the human flt4 (VEGFR-3) gene (Eichmann et al., 1996). The 1500-bp probe was cloned into pcDNA/Amp (Invitrogen, San Diego), linearised, and sense and antisense riboprobes (Eichmann et al., 1993, 1996; Wilting et al., 1997) were labelled with digoxigenin RNA labelling kit as recommended (Boehringer, Mannheim, Germany).

The full-length quail VEGF-C cDNA has been described recently (Eichmann et al., 1998). This cDNA was used as a template to produce a specific probe for in situ hybridization by excluding the highly conserved secretion and Balbiani ring sequences. PCR was performed by using the primer pair 5′ primer: TGGCAACACAACAGGGAACACTC and the 3′ primer: CACAGCTTATGGGCCGCACACC, which amplifies a 645-bp VEGF-C sequence ranging from bp 265 to 910. PCR was carried out in a volume of 50 μl (5 μl 10 × PCR buffer, 5 μl 25 mM MgCl2, 35.75 μl H2O, 1 μl dNTPs [10 mM], 1 μl 3′Primer, 1 μl 5′Primer, 0.25 μl Taq-Polymerase [5 U/ μl; Promega], inocculated with 1 μl DNA template). For amplification, we used 40 cycles: 94°C (30 sec) - 58°C (30 sec) - 72°C (60 sec). The PCR fragment was cloned into pCR3.1 vector (Invitrogen). For generation of the in situ riboprobes, we amplified the 645-bp VEGF-C–specific sequence by using primers containing T3 and T7 promoter sites; primer T7: 5′-GTAATACGACTCACTATAGGG-3′ and primer T3(T/A): 5′-AATTAACCCTCACTAAAGGGCTAGAAGGCACAGTCGAGGC-3′. This T3 primer contains the T3 promoter site necessary for T3-polymerase reaction and the Bgh site, which is complementary to the vector specific sequence and, therefore, necessary for amplification. PCR was carried out in a volume of 50 μl (5 μl of 10 × PCR buffer containing 15 mM MgCl2; 0.4 μl of dNTPs [10 mM], 2.5 μl of DMSO [1 M], 2 μl of Primer T7 [10 μM], 2 μl of Primer T3 (T/A) [10 μM], 0.5 μl of Tag-Polymerase [5 U/ μl; Promega], inoculated with 1 ng of DNA template). Thirty eight cycles were used for amplification: 94°C (30 sec) - 42°C (30 sec) - 72°C (60 sec). Upon amplification, 10 μl of the PCR products were loaded onto an agarose gel for verification. PCR product was then purified by means of QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) to achieve an RNase free template. Digoxigenin labelling (DIG RNA Labelling Mix; Roche, Mannheim, Germany) was performed in a total volume of 20 μl (5.5 μl of purified PCR template, 2 μl of transcription buffer, 2 μl of DTT [1M], 2 μl of labelling mix, 0.5 μl of RNase inhibitor, 2 ml of RNA-polymerase [20U/ μl]) and incubated overnight at 37°C. The transcripts were precipitated by adding 80 μl of DEPC-H2O, 1 μl of glycogen, 35 μl of ammonium acetate (10 M), and 20 μl of EtOH (−20°C), and immediately frozen in liquid nitrogen. After centrifugation with maximal speed at room temperature, supernatant was discarded and the pellet was washed in 70% EtOH, air-dried, and resuspended in 100 μl of DEPC-H2O.

For the detection of Prox1 mRNA, a probe was used that has been cloned by Tomarev et al. (1996). The 1,880-bp probe was cloned into bluescript SK- and corresponded to position 1442-3322 of the coding region of the Prox1 cDNA. Linearisation was performed with EcoRI and SacI for the preparation of sense and antisense probes, respectively. Probe labelling was the same as described above.

A hybridization mixture of 40% formamide, 25% 20 × SSC, 1% Denhardt's solution, 1% tRNA, 1% herring sperm DNA, 2% labelled sense or antisense probe, and 30% DEPC-treated water was prepared. Sixty microliters of hybridization mixture was placed on each slide, and the slides were incubated overnight at 65°C. After standard washing, the location of the digoxigenin was detected by using a 1:4,000 solution of an alkaline phosphatase-conjugated antidigoxigenin antibody (Boehringer) in a blocking agent (1% bovine serum albumin in malate buffer) at 4°C overnight. The antibody was detected by using BCIP/NBT (Boehringer) in alkaline phosphatase buffer for 3–5 days, revealing a blue reaction product. The background was stained with nuclear fast red and the slides mounted. Representative photographs of the hybridization sites were photographed onto Kodak Ectachrome and Agfa Ortho film. The sense controls did not reveal a specific signal (Figs. 4, 5; Tomarev et al., 1996; Wilting et al., 1997).

Immunohistochemistry

Endothelial cells of quail embryos were stained with the QH1 antibody (Pardanaud et al., 1987; Developmental Studies Hybridoma Bank, Iowa City, IA). Staining was performed according to the indirect peroxidase method as described previously (Wilting et al., 1995b). To stain all quail cells, we used the anti-quail antibody QCPN (DSHB). The antibody was diluted 1:100. The secondary antibody was peroxidase-conjugated goat anti-mouse Ig (Sigma, Deisenhofen, Germany), diluted 1:300. DAB was used as chromogen.

VEGFR-3/Quek2 and QH1 Double Staining

In several specimens, we combined VEGFR-3 in situ hybridization and QH1 immunofluorescence. For this purpose, in situ hybridization on paraffin sections was performed as described above, with slight modifications. The sections were not treated with proteinase K. Furthermore, the antidigoxigenin/AP antibody and the QH1 antibody were applied simultaneously; diluted 1:4,000 and 1:500, respectively. Thereafter, the alkaline phosphatase reaction was performed as usual. When the blue reaction product was visible in the sections, the alkaline phosphatase reaction was stopped with 1% EDTA in alkaline phosphatase buffer. The slides were rinsed with distilled water and PBS and the sections were blocked with 1% BSA, and again incubated with QH1 antibody, 1:500. After several washings with PBS, the secondary Cy3-conjugated goat anti-mouse antibody (Dianova, Hamburg, Germany) was applied; diluted 1:200. The slides were rinsed in PBS and mounted with Moviol (Hoechst). The sections were studied with Zeiss Axioskop by using brightfield and fluorescence optics.

Production of Prox1 Antibodies

Prox 1 cDNA fragment encoding the homeodomain and C-terminal prospero domain [position 546-736 in the human Prox1 amino acid sequence (Zinovieva et al., 1996); human and chick Prox1 proteins are identical in this region] was subcloned in pGEX-2 and expressed as a fusion protein with glutathione-S-transferase according to standard procedures. The fusion protein, purified by glutathione-affinity chromatography, was used to immunize rabbits (performed as a service by Covance Laboratories, Inc., Vienna, VA). Antibodies were partially purified from immune sera by using protein A-affinity columns under conditions recommended by the manufacturer (Pierce, Rockford, IL). The antibodies detected a single band in Western blotting assay with chicken lens nuclear extract.

Immunofluorescence

For immunofluorescence studies specimens remained unfixed and were embedded in Tissue Freeze Medium (Leica, Bensheim, Germany). Cryosections of 20 μm thickness were fixed for 10 min in 100% methanol. Nonspecific binding of antibodies was blocked by incubation with 1% bovine serum albumin (BSA) for 10 min. The Prox 1 antibody was diluted 1:500; incubation 1 hr. After rinsing, the secondary Cy3-conjugated goat anti-rabbit antibody (Dianova, Hamburg, Germany) was applied at 1:200 for 1 hr. After rinsing, the slices were mounted under coverslips with Mowiol (Hoechst, Frankfurt, Germany). They were studied with an epifluorescence microscope (Axioskop).

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

We thank Mrs S. Antoni, Mrs. M. Ast, Mrs. E. Gimbel, Mrs. S. Konradi, Mrs. L. Koschny, Mrs. U. Pein, Mrs. M. Schüttoff, and Mr. G. Frank for their excellent technical assistance, Mrs. Ch. Micucci for photographic work, and Mrs. U. Uhl for typing of the manuscript. The QH1 and QCPN antibodies were obtained from the Developmental Studies Hybridoma Bank, maintained by the Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, MD, and the Department of Biological Sciences, University of Iowa, Iowa City, IA, under contract N01-HD-6-2915 from the NICHD.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Asellius G. 1627. De Lacteibus sive lacteis venis Quarto Vasorum Mesaroicum genere novo invente Gasp. Asellii Cremonesis Antomici Ticiensis Qua Sententiae Anatomicae multae, nel perperam receptae illustrantur. Mediolani, apud Jo. Baptistam Bidellium.
  • Berens von Rautenfeld D, Budras KD. 1981. TEM and SEM investigations of lymph hearts in birds. Lymphology 14: 186190.
  • Budge A. 1882. Über Lymphherzen bei Hühnerembryonen. Arch Anat Entwicklgesch 350359.
  • Budge A. 1887. Untersuchungen über die Entwicklung des Lymphsystems beim Hühnerembryo. Arch Anat Entwicklgesch 5989.
  • Caprioli A, Jaffredo T, Gautier R, Dubourg C, Dieterlen-Lièvre F. 1998. Blood-born seeding by hematopoietic and endothelial precursors from the allantois. Proc Natl Acad Sci USA 95: 16411646.
  • Christ B, Poelmann RE, Mentink M, Gittenberger-de Groot AC. 1990. Vascular endothelial cells migrate centripetally within embryonic arteries. Anat Embryol (Berl) 181: 333339.
  • Clark EL. 1912. Injection and reconstruction of the jugular lymph “sac” in the chick. Anat Rec 6: 261264.
  • Clark ER, Clark EL. 1920. On the origin and early development of the lymphatic system of the chick. Contr Embryol 9: 447482.
  • Dumont DJ, Jussula L, Taipale J, Lymboussaki A, Mustonen T, Pajusola K, Breitman M, Alitalo K. 1998. Cardiovascular failure in mouse embryos deficient in VEGF receptor-3. Science 282: 946949.
  • Eichmann A, Marcelle C, Bréant C, Le Douarin NM. 1993. Two molecules related to the VEGF receptor are expressed in early endothelial cells during avian embryonic development. Mech Dev 42: 3348.
  • Eichmann A, Marcelle C, Bréant C, Le Douarin NM. 1996. Molecular cloning of Quek 1 and 2, two quail vascular endothelial growth factor (VEGF) receptor-like molecules. Gene 174: 38.
  • Eichmann A, Corbel C, Jaffredo T, Breant C, Joukov V, Kumar V, Alitalo K, Le Douarin NM. 1998. Avian VEGF-C: cloning, embryonic expression pattern and stimulation of the differentiation of VEGFR2-expressing endothelial cell precursors. Development 125: 743752
  • Eriksson U, Alitalo, K. 1999. Structure, expression and receptor-binding properties of novel vascular endothelial growth factors. In: Claesson-WelshL, editor. Current topics in microbiology and immunology. Vol 237. Vascular growth factors and angiogenesis. Berlin: Springer. p 4157.
  • Hamburger V, Hamilton HL. 1952. A series of normal stages in development of the chick embryo. J Morphol 88: 4992.
  • Hamilton HL. 1965. In: Lillie's development of the chick. An introduction to embryology. New York: Holt, Rinehart, and Winston.
  • Huntington GS. 1908. The genetic interpretation of the development of the mammalian lymphatic system. Anat Rec 2: 1946.
  • Jeltsch MM, Kaipainen A, Joukov V, Meng X, Lakso M, Rauvala H, Swartz M, Fukumura D, Jain RK, Alitalo K. 1997. Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science 276: 14231425.
  • Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, Saksela O, Kalkinnen N, Alitalo K. 1996. A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J 15: 290298.
  • Joukov V, Sorsa T, Kumar V, Jeltsch M, Claesson-Welsh L, Cao Y, Saksela O, Kalkkinen N, Alitalo K. 1997. Proteolytic processing regulates receptor specificity and activity of VEGF-C. EMBO J 16: 38983911
  • Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VW, Fang GH, Dumont D, Breitman M, Alitalo K. 1995. Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc Natl Acad Sci USA 92: 35663570.
  • Kampmeier OF. 1912. The value of the injection method in the study of lymphatic development. Anat Rec 6: 223233.
  • Korpelainen EI, Alitalo K. 1998. Signaling angiogenesis and lymphangiogenesis. Curr Opin Cell Biol 10: 159164.
  • Kurz H, Christ B. 1998. Embryonic CNS macrophages and microglia do not stem from circulating, but from extravascular precursors. Glia 22: 98102
  • Kurz H, Korn J, Eggli PS, Huang R, Christ B. 2001. Embryonic CNS angiogenesis does not involve blood-borne endothelial progenitors. J Comp Neurol 436: 263274.
  • Le Douarin NM. 1969. Particularités du noyau interphasique chez la caille japonaise (Coturnix coturnix japonica). Utilisation de ces particularitès comme “marquage biologique” dans les recherches sur les interactions tissulaires et les migrationes cellulaires au cours de l'ontogenése. Bull Biol Fr Belg 103: 435452.
  • Lee J, Gray A, Yuan J, Louth SM, Avraham H, Wood W. 1996. Vascular endothelial growth factor-related protein: a ligand and specific activator of the tyrosine kinase receptor Flt4. Proc Natl Acad Sci USA 93: 19881992.
  • Leeson TF, Leeson CR. 1963. The chorioallantois of the chick. Light and electron microscopic observations at various times of incubation. J Anat 97: 585595.
  • McClure C. 1908. The development of the thoracic and right lymphatic ducts in the domestic cat (Felis domestica). Anat Anz 32: 533543.
  • Miller AM. 1912. The development of the jugular lymph sac in birds. Am J Anat 12: 473490.
  • Miller AM. 1913. Histogenesis and morphogenesis of the thoracic duct in the chick; development of blood cells and their passage to the blood stream via the thoracic duct. Am J Anat 15: 131197.
  • Oh SJ, Jeltsch MM, Birkenhäger R, McCarthy JEG, Weich HA, Christ B, Alitalo K, Wilting J. 1997. VEGF and VEGF-C: Specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane. Dev Biol 188: 96109.
  • Oliver G, Sosa-Pineda B, Geisendorf S, Spana EP, Doe CQ, Gruss P. 1993. Prox 1, a prospero-related homeobox-gene expressed during mouse development. Mech Dev 44: 316.
  • Pardanaud L. Dieterlen-Lièvre F. 1999. Manipulation of the angiopoietic/hemangiopoietic commitment in the avian embryo. Development 126: 617627.
  • Pardanaud L, Altmann C, Kitos P, Dieterlen-Lièvre F. 1987. Vasculogenesis in the early quail blastodisc as studied with a monoclonal antibody recognizing endothelial cells. Development 100: 339349.
  • Papoutsi M, Siemeister G, Weindel K, Tomarev S, Kurz H, Schächtele C, Martiny-Baron G, Christ B, Marmé D, Wilting J. 2000. Active interaction of human A375 melanoma cells with the lymphatics in vivo. Histochem Cell Biol 114: 373385.
  • Rusznyák I, Földi M, Szabó G. 1969. Lymphologie. Physiologie und Pathologie der Lymphgefässe und des Lymphkreislaufes. Stuttgart: G. Fischer Verlag.
  • Sabin FR. 1909. The lymphatic system in human embryos, with a consideration of the system as a whole. Am J Anat 9: 4391.
  • Schneider M, Othman-Hassan K, Christ B, Wilting J. 1999. Lymphangioblasts in the avian wing bud. Dev Dyn 216: 311319.
  • Serra JA. 1946. Histochemical tests for protein and amino acids: the characterization of basic proteins. Stain Technol 21: 518.
  • Tomarev SI, Sundin O, Banerjee-Basu S, Duncan MK, Yang JM, Piatigorsky J. 1996. Chicken homeobox gene Prox 1 related to Drosophila prospero is expressed in the developing lens and retina. Dev Dyn 206: 354367.
  • Van der Jagt ER. 1932. The origin and development of the anterior lymph-sacs in the sea-turtle (Thalassochelys caretta). Q J Microsc Sci 75: 151165.
  • Wigle JT, Oliver G. 1999. Prox1 function is required for the development of the murine lymphatic system. Cell 98: 769778.
  • Wigle JT, Chowdhury K, Gruss P, Oliver G. 1999. Prox1 function is crucial for murine lens fiber elongation. Nat Genet 21: 318322.
  • Wilting J, Brand-Saberi B, Kurz H, Christ B. 1995a. Development of the embryonic vascular system. Cell Mol Biol Res 41: 219232.
  • Wilting J, Brand-Saberi B, Huang R, Zhi Q, Köntges G, Ordahl CP, Christ B. 1995b. Angiogenic potential of the avian somite. Dev Dyn 202: 165171.
  • Wilting J, Birkenhäger R, Eichmann A, Kurz H, Martiny-Baron G, Marmé D, McCarthy JEG, Christ B, Weich HA. 1996. VEGF121 induces proliferation of vascular endothelial cells and expression of flk-1 without affecting lymphatic vessels of the chorioallantoic membrane. Dev Biol 176: 7685.
  • Wilting J, Eichmann A, Christ B. 1997. Expression of the avian VEGF receptor homologues Quek1 and Quek2 in blood-vascular and lymphatic endothelial and non-endothelial cells during quail embryonic development. Cell Tissue Res 288: 207233.
  • Wilting J, Kurz H, Oh SJ, Christ B. 1998. Angiogenesis and Lymphangiogenesis: Analogous mechanisms and homologous growth factors. In : LittleCD, MironovV, SageEH, editors. Vascular morphogenesis: in vivo, in vitro, in mente. Basel: Birkhäuser. p 2134.
  • Wilting J, Neeff H, Christ B. 1999. Embryonic lymphangiogenesis. Cell Tissue Res 297: 111.
  • Wilting J, Papoutsi M, Schneider M, Christ B. 2000. The lymphatic endothelium of the avian wing is of somitic origin. Dev Dyn 217: 271278.
  • Zinovieva RD, Duncan MK, Johnson TR, Torres R, Polymeropoulos MH, Tomarev SI. 1996. Structure and chromosomal localization of the human homeobox gene Prox 1. Genomics 35: 517522.