SEARCH

SEARCH BY CITATION

Keywords:

  • Drosophila development;
  • RNA stability;
  • mRNA degradation;
  • ribonucleases;
  • gene regulation;
  • Dis3;
  • Rrp44p;
  • exosome

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The major 3′–5′ pathway of RNA degradation in eukaryotic cells involves the exosome, which is a multi-protein complex of exoribonucleases. The exoribonucleases within this complex are highly conserved and are closely related to prokaryotic ribonucleases. We have identified and characterised the expression pattern of Drosophila tazman (taz), a component of the exosome which is closely related to Escherichia coli RNaseR and yeast Rrp44p. The tazman transcripts are differentially expressed during development, with maximum expression levels in 6–8 hr embryos. In situ hybridisation and immunolocalisation experiments show that tazman transcripts and protein are maternally derived, and are expressed ubiquitously throughout the embryo, with high levels in germ band and head structures. Differential expression of TAZ is likely to reflect changes in the activity of the 3′–5′ mRNA turnover pathway which could have a major impact of the expression of target RNAs. Developmental Dynamics 232:733–737, 2005. © 2005 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Ribonucleases are key factors in the control of mRNA degradation, which is one of the least understood aspects of the control of gene regulation. In multi-cellular organisms, it is increasingly evident that differential regulation of mRNA stability is crucial for normal embryonic development. For example, in all metazoans studied to date, mRNAs provided maternally which are critical in determining initial events such as axis formation during early embryogenesis are degraded at a particular point in development (Cooperstock and Lipshitz, 1997; Fontes et al., 1999; Bashirullah et al., 2001). Therefore, transcript degradation can be selective and also modulated which suggests a hitherto unstudied layer of control of gene expression in multicellular organisms.

In the yeast S. cerevisiae, where mRNA degradation pathways have been extensively analysed, degradation of mRNA in the 3′–5′ direction after de-adenylation occurs by means of a multicomponent complex of ribonucleases known as the exosome, assisted by the helicase Ski2p (Mitchell et al., 1997). The predominant degradation pathway for most RNAs is decapping followed by degradation in a 5′–3′ direction by the processive exoribonuclease Xrn1p (Camponigro and Parker, 1996; van Hoof and Parker, 1999; Mitchell and Tollervey, 2000a, 2001). Mutations in genes encoding proteins in both the 5′ and 3′ degradation pathways are synthetically lethal, showing that these pathways are essential for viability (Jacobs Anderson and Parker, 1998). All of the known ribonucleases and associated factors in yeast are highly conserved in all eukaryotes and those involved in the 3′–5′ pathway show striking homologies with Escherichia coli ribonucleases (Mian, 1997; Mitchell and Tollervey, 2000b). This suggests that degradation pathways of RNAs have been conserved throughout evolution and that degradation of mRNA was an important step in gene regulation, even before the divergence of prokaryotes from eukaryotes.

Our work on the characterisation of Drosophila pacman (a 5′–3′ exoribonuclease) and twister (a helicase involved in RNA processing/degradation) has shown that they are developmentally regulated (Till et al., 1998; Chernukhin et al., 2001; Seago et al., 2001). To further understand the role of RNA stability in Drosophila development we have analysed the expression of an enzyme crucial in the 3′–5′ degradation pathway. In this report we present our findings on the characterisation of Drosophila TAZMAN (TAZ), an enzyme within the exosome and a member of the RNR family of processive, 3′–5′ exoribonucleases that includes E. coli RNaseII and RNaseR.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Identification of Drosophila tazman and Comparison With Orthologues

We have identified a protein of the RNR family in Drosophila (CG6413) which we have named tazman (taz) (see Fig. 1). The sequence of this gene was obtained by searching the Drosophila database with amino-acid sequences derived from the human and yeast gene Dis3/Rrp44p. Two ESTs (SD10981 and LD08354) were completely sequenced and compared with genomic sequence contained within clone AE003747 located on the 3rd chromosome at 95F13-14 (Flybase, 1996). Comparison of TAZ with orthologues from E. coli, yeast, C. elegans and humans shows that it is strikingly well conserved between all these organisms (Fig. 1A,B), suggesting a very ancient origin of this protein. Our analysis also shows that Drosophila TAZ is more similar to E. coli RNaseR (VacB) than RNaseII not only within the RNaseII signature (Fig. 1B) but is also conserved throughout the entire protein. Interestingly, RNaseR is induced during cold shock and is more effective than RNaseII at degrading structured RNAs such as rRNA (Cheng and Deutscher, 2002; Cairrao et al., 2003).

thumbnail image

Figure 1. A: Comparison of Drosophila TAZ with orthologues from C. elegans (accession number Q17632), human (accession number Q9Y2L1), S. cerevisiae (accession number Q08162), S. pombe (accession number P37202), E. coli RNaseII (accession number P30850), and E. coli RNaseR (accession number P21499). Protein motifs are shown as coloured rectangles representing particular motifs as shown in the key. Protein motifs were determined using Interpro (http://www.ebi.ac.uk/interpro/), SMART (http://smart.ox.ac.uk) or CLUSTALW alignment (http://www.es.embnet.org/Doc/phylodendron/clustal-form.html). B: Alignment of part of the Drosophila TAZ protein containing the RNaseII signature with some of its orthologues. Sequences were aligned using CLUSTALW and coloured using BOXSHADE (http://www.ch.embnet.org/software/BOX_form.html). Identical amino-acids are shown in red and similar amino-acids in blue. Dm, Drosophila melanogaster; h, human; Ce, C. elegans; Sp, S. pombe; Sc, S. cerevisiae; Ec, E. coli.

Download figure to PowerPoint

The tazman gene contains an open reading frame of 983 amino acids (112 kD). The encoded protein includes a CR3 domain (a cysteine-rich domain with 3 cysteines) a PINc domain, a S1-like domain, a ribonucleaseII domain, a RNaseII signature, and a S1 domain (Mian, 1997; Anantharaman et al., 2002)(Fig. 1A). The latter three domains are conserved in both eukaryotic and prokaryotic orthologues whereas the CR3 domain and PINc domains are only found in eukaryotic versions of the protein. The CR3 domain is a cysteine-rich domain with 3 cysteines that is thought to be involved in protein-protein binding (http://www.ebi.ac.uk/interpro). The PINc (PilT-amino terminal) domain is predicted to bind divalent cations and is also found in proteins involved in nonsense-mediated decay such as SMG-5 in C. elegans and NMD4 in yeast. By similarity with 5′–3′ exonucleases, it has been proposed to have ribonuclease or RNA-binding activity (Clissold and Ponting, 2000). The S1-like domain is known to be very similar in structure to both the “cold-shock” domain and the S1 RNA binding domain in that the protein module consists of five anti-parallel β-strands forming a barrel structure (the OB fold) (Graumann and Marahiel, 1998; Ponting et al., 2000). This RNA binding domain has regularly been found in proteins involved in translation control and RNA turnover such as FRGY2 in Xenopus and PNPase in E. coli. It is thought that this domain may bind to RNA and act as a RNA chaperone to maintain the mRNA in a single-stranded conformation in readiness for translation or degradation (Sommerville, 1999).

The extremely high conservation of Drosophila TAZ with other members of the RNaseII family strongly suggests that it also has 3′–5′ exoribonuclease activity. Indeed, our unpublished results show that full length TAZ protein, expressed in E. coli and purified using the His-tag system, efficiently degrades structured RNAs in vitro at 25°C. Therefore TAZ, like its orthologues Rrp44p, RNaseII and RNaseR has intrinsic activity in vitro.

taz mRNA Is Differentially Expressed Throughout Development

To determine whether the expression of taz varies throughout development, we isolated polyA mRNA from Drosophila at different stages of their life cycle and analysed the amounts of taz mRNA by Northern blotting. Figure 2A shows that the taz transcripts are expressed throughout embryonic development (0–12 hr) and are most abundant in 6-8 hr embryos. The taz mRNA is expressed at high levels at early larval stages, but then declines throughout subsequent larval and pupal stages. The expression pattern of taz is different from that of pacman, which is the major 5′–3′ cytoplasmic exoribonuclease in Drosophila (Till et al., 1998; Chernukhin et al., 2001). pacman mRNA is most abundant during oogenesis and early embryogenesis, reaching a peak at 0–4 hr postfertilisation with undetectable levels during larval stages (L2 and L3). This suggests that the importance of the 3′–5′ and 5′–3′ pathways varies during development.

thumbnail image

Figure 2. A: Expression of taz mRNA through the Drosophila life cycle. The Northern blot was probed with a 1,210 bp fragment of taz cDNA and a 140 bp fragment from the ribosomal protein gene rp49 (control). rp49 is known to be expressed at constant levels throughout development and is used as a loading control. Developmental stages are: 0–2 hr, 0–2 hr embryos; 2–4 hr, 2–4 hr embryos; 4–6 hr, 4–6 hr embryos; 6–8 hr, 6–8 hr embryos; 8–12 hr, 8–12 hr embryos; 12–20 hr, 12–20 hr embryos; L1, L1 larvae; L2, L2 larvae; L3, L3 larvae. Quantitation of the taz transcripts relative to the control is given below. B: Spatial and temporal distribution of taz mRNA in wild-type embryos. Whole-mount in situ hybridisation was carried out by using DIG-labelled antisense probes. Panel A; stage 9 egg chambers. Panel B; syncytial blastoderm (stage 4, 2.5 hr after fertilisation). Panel C; germ band extension (stage 10, 5 hr after fertilisation). Panel D; germ band retraction, (stage 13, 10 hr after fertilisation). Panel E; control using a “sense” taz RNA probe.

Download figure to PowerPoint

Because the Drosophila exosome has been shown to be associated with elongating RNA polymerase II (Andrulis et al., 2002), it is possible that the changes in levels of RNAs encoding taz could simply reflect the levels of overall transcription in Drosophila embryos. However, the levels of RNA encoding the large subunit of RNA polymerase II (RpII215 (CG1554), as determined by microarray analysis, do not show the same expression pattern as taz (http://quantgen.med.yale.edu/). This suggests that expression of this exosomal component can be independent of its activity associated with transcription elongation. taz may, therefore, play a role in degradation of mRNAs during particular stages of development.

To detect the spatial and temporal expression of taz RNA in oocytes and embryos, we carried out whole-mount in situ hybridisation using antisense probes labelled with digoxygenin. The taz mRNA is expressed from stage 3 of oogenesis and is abundant in the nurse cells (Fig. 2B, panel A). These maternal transcripts are maternally contributed to the embryo and are present at high levels throughout cellularisation (Fig. 2B, panel B). During gastrulation (5 hr after fertilisation), taz mRNA is ubiquitous and is particularly abundant in the mesoderm (Fig. 2B, panel C) in agreement with the Northern blotting results. After germ band retraction (10 hr after fertilisation), the mRNA is present at lower levels (Fig. 2B, panel D). Our data, therefore, shows that the levels of taz transcripts vary throughout development.

TAZ Protein Is Differentially Expressed During the Drosophila Life-Cycle

To determine whether TAZMAN levels change during early development, we raised polyclonal antibodies against TAZ using the purified full length H6-TAZ protein. These antibodies were highly specific to TAZ in that a single band was obtained on immunoblotting total Drosophila extracts. Analysis of taz protein levels throughout developmental stages reveals that expression is predominant in the early stages of embryogenesis with a peak of expression between 6 and 8 hr (Fig. 3A), which parallel the results of the developmental Northern. Expression of TAZ is significantly higher in female adults compared with males, consistent with the maternal contribution of TAZ during oogenesis. The high levels of tazman mRNA and protein expression at 6–8 hr suggest high levels of RNA turnover at these stages of development. Because development and differentiation are very rapid during this period and many RNAs are transcribed, it is likely that high levels of mRNA turnover are required to maintain the correct levels of these transcripts. The much lower levels of taz mRNA and protein between 2nd instar larvae and the late pupal stages (2–3% of the amounts in 6–8 hr embryos in the case of TAZ protein) suggests that lower levels of mRNA turnover are required, perhaps because a smaller subset of genes are transcribed at that time and/or that mRNAs are degraded by other ribonucleases during these stages of development.

thumbnail image

Figure 3. A: Developmental Western blot of protein samples extracted from wild-type Drosophila, probed with rabbit anti-TAZ polyclonal antibodies. As a loading control, the blot was reprobed with mouse monoclonal anti-actin antibody (lower panel) which recognises Drosophila actin. Developmental stages are: 0–2 hr, 0–2 hr embryos; 2–4 hr, 2–4 hr embryos; 4–6 hr, 4–6 hr embryos; 6–8 hr, 6–8 hr embryos; 8–12 hr, 8–12 hr embryos; 12–20 hr, 12–20 hr embryos; L1, L1 larvae; L2, L2 larvae; L3, L3 larvae; EP, early pupae; MP, mid pupae; LP, late pupae; Fem, adult females; Male, adult males. Quantitation of the TAZ protein relative to the control is given below. B: Spatial and temporal distribution of taz protein in wild-type embryos. Panel A; Stage 1 embryo (approximately 1 hr after fertilisation). Panel B; syncytial blastoderm (stage 4, 2.5 hr after fertilisation). Panel C; germ band extension (stage 10, 5 hr after fertilisation). Panel D; germ band retraction (stage 13, 10 hr after fertilisation).

Download figure to PowerPoint

By using the same polyclonal antibodies to TAZ, we also examined the spatial and temporal distribution of TAZ protein during embryogenesis. The pattern of TAZ protein expression is similar to that of the taz mRNA, with ubiquitous expression of protein throughout embryogenesis and high levels of protein in the mesoderm (Fig. 3B, panel B). In embryos, there was no other obvious variation in taz mRNA or TAZ protein from one cell type to another. At syncytial blastoderm, TAZ protein is clearly seen in the nuclei as well as the cytoplasm (Fig. 3B, panel B), suggesting that, similarly to yeast Rrp44p, this enzyme is involved in the processing of nuclear and nucleolar RNAs (Mitchell et al., 1997; Andrulis et al., 2002).

The results in this report show that Drosophila TAZ, which has 3′–5′ exo-ribonuclease activity in vitro, is differentially expressed both at the mRNA level and at the protein level during development. The differential expression of taz and other ribonucleases such as pacman during the life cycle of Drosophila suggest that these ribonucleases may play a role in the modulation of the levels of developmentally important RNAs.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

For the Northern blotting analysis, total RNA was prepared from different life stages of Oregon R wild-type Drosophila using a RNeasy kit (Quiagen). PolyA+ mRNA was then extracted from total RNA by using oligo(dT)-cellulose spin columns (New England BioLabs) according to manufacturer's instructions. RNA (5 μg) was separated on a 1.2% agarose, 2.2 M formaldehyde gel in running buffer (20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA, pH 7.0). The radiolabelled probe used for detection of taz mRNA was a 1,210 bp PstI-XhoI DNA fragment from EST LD08354. Ribosomal protein 49 (rp49) mRNA was used as a loading control (Till et al., 1998). Two independent Northern blots were prepared which gave identical results.

In situ hybridisations were performed on wild-type (Oregon R) Drosophila embryos or egg chambers by using digoxygenin-labelled (DIG) anti-sense RNA probes. Techniques were performed as described previously (Till et al., 1998). Antisense taz probes were generated by linearising the EST LD08354 with EcoR1 and transcribing a 1.2 kb RNA with T7 polymerase according to the manufacturers instructions (Boehringer-Mannheim). Embryos were stained and mounted in JB-4 methacrylate (Polysciences). Three different anti-sense probes were used and all gave identical results. In addition a “sense” RNA control was performed by linearising LD08354 with Xho1 and transcribing the control “sense” RNA with T3 polymerase.

For preparation of an antibody to TAZ, full length taz was amplified from EST SD10981 (Research Genetics) by PCR using primers incorporating a Nde1 site at the 5′ end and a HindIII site at the 3′ end.

Dis3-F 5′ GCAGGAGCCATATGCAAACTTTACGCGATTTAC 3′ and Dis3-R 5′ CGGTGGAAAAGCTTTACGAAACG 3′. The resulting 3,079 bp fragment was first inserted into pST1Blue (Invitrogen) and then cloned into pET28a to give an in-frame His6 tag fusion. Sequencing of the inserted cDNA showed that no mutations had been incorporated. His6 –TAZ was expressed in the E. coli strain BL21(DE3) and purified using Ni-NTA affinity resin according to the manufacturer's instructions (Quiagen). Analysis by SDS-PAGE revealed a protein of the expected size. Rabbit polyclonal antibodies to full length TAZ were prepared by Eurogentec.

SDS-PAGE and Western blotting was performed essentially as described (Sambrook et al., 1989). The binding of the polyclonal antibody to TAZ was detected by using the Amersham ECL Western blot reagent kit. Primary polyclonal anti-TAZ antibody was used at 1:2,500 and the monoclonal anti-actin antibody (Sigma) at 1:5,000. The secondary monoclonal anti-rabbit HRP conjugated antibody (Sigma) and the monoclonal anti-mouse HRP conjugated antibody (Sigma) were both used at 1:12,000. Western blotting was repeated 4 times and gave identical results.

Immunocytochemistry on embryos was performed essentially as described (Patel, 1994). The primary polyclonal antibody anti-TAZ was used at 1:600 and the secondary polyclonal goat anti-rabbit HRP conjugated antibody (Jackson laboratories) was used at 1:1,000. Immunocytochemistry was repeated three times and gave very similar results.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We thank Chris Ponting for advice on the bioinformatics. We also thank Cathy Browne for excellent technical assistance. F.C. was a recipient of a doctoral grant from the Fundação para a Ciência e Tecnologia (Portugal).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES