SEARCH

SEARCH BY CITATION

Keywords:

  • macroarray;
  • larvae;
  • regeneration;
  • tail;
  • Xenopus laevis

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Xenopus larvae possess a remarkable ability to regenerate their tails after they have been severed. To gain an understanding of the molecular mechanisms underlying tail regeneration, we performed a cDNA macroarray-based analysis of gene expression. A Xenopus cDNA macroarray representing 42,240 independent clones was differentially hybridized with probes synthesized from the total RNA of normal and regenerating tails. Temporal expression analysis revealed that the up-regulated genes could be grouped into early or late responding genes. A comparative expression analysis revealed that most genes showed similar expression patterns between tail development and regeneration. However, some genes showed regeneration-specific expression. Finally, we identified 48 up-regulated genes that fell into several categories based on their putative functions. These categories reflect the various processes that take place during regeneration, such as inflammation response, wound healing, cell proliferation, cell differentiation, and control of cell structure. Thus, we have identified a panel of genes that appear to be involved in the process of regeneration. Developmental Dynamics 233:1394–1404, 2005. © 2005 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Like many other amphibians, Xenopus can regenerate their limbs or tails after they have been severed at larval stages. The Xenopus larval tail contains complex, patterned tissues, including the spinal cord, notochord, and muscles, and is able to completely regenerate within just a week after tail amputation. In contrast, axolotls require several weeks to completely regenerate their tails, which contain cartilage rather than notochord tissue (Sugiura et al., 2004; Echeverri et al., 2001).

Amputation is known to trigger wound healing, followed by the emergence of proliferating cells that eventually form the complete array of tissue types. In the regenerating tail of Xenopus larvae, the notochord and spinal cord regenerate from their pre-existing notochord and spinal cord tissue, while muscle tissue regenerates from satellite cells rather than from pre-existing myofibers (Sugiura et al., 2004; Gargioli and Slack, 2004). In contrast, undifferentiated pluripotent cells comprising the typical blastema are responsible for regeneration of the urodele limb and tail. Several genes have been reported to have similar expression patterns in the embryonic tail bud and regenerating tail (Beck et al., 2003; Christen et al., 2003). On the other hand, some genes showed different expression patterns (Sugiura et al., 2004). However, still little is known about the mechanisms underlying tail regeneration.

Recent progress in DNA macro/microarray technology has allowed us to screen the expression of thousands of genes simultaneously. This technique is well suited for studying differential gene expression patterns between two or more cell populations (Galitski et al., 1999; Mochii et al., 1999; Lockhart and Winzeler, 2000; Young, 2000; Altmann et al., 2001). To elucidate the molecular mechanisms underlying Xenopus larval tail regeneration, we performed a comprehensive analysis using a cDNA macroarray. Here we report the identification of genes involved in tail regeneration, which provides an initial step towards understanding the molecular mechanisms underlying the process of Xenopus larval tail regeneration.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Identification of Genes Involved in Regeneration by Differential Hybridization of Macroarray Filters

To identify genes involved in larval tail regeneration, we performed differential hybridizations of cDNA macroarrays on which 42,240 independent clones were spotted. These cDNA macroarrays represent 19,200 neurula- and 23,040 tailbud-stage Xenopus EST clones, which are considered to represent 17,000 unigenes by 3′ sequence and contig analyses. The sequence information of the cDNA clones is available at the XDB3 website (http://xenopus.nibb.ac.jp). Many genes with unique expression profiles have been identified using this set of 42,240 cDNAs (Chung et al., 2004; Shin et al., 2005; Peiffer et al., 2005). It is well known that gene expression patterns observed during normal development are also observed during regeneration (Stocum, 1995), and Xenopus larval tail regeneration is not an exception, as several genes are reported to have similar expression patterns in the embryonic tail bud and regenerating tail (Beck et al., 2003; Christen et al., 2003; Sugiura et al., 2004). For these reasons, we used this 42,240 cDNA set for differential hybridization studies to elucidate the molecular mechanisms underlying tail regeneration.

Figure 1 illustrates the strategy we used in this study. As in our previous study (Sugiura et al., 2004), we chose two stages of the regeneration process: 1.5 days post-amputation, when the cells proliferate without apparent differentiation, and 3 days post-amputation, when the first morphological evidence of tissue differentiation can be seen. We compared the gene expression profiles of day 0 and day 1.5 or 3 tails by using cDNA macroarrays. To minimize false signals, which may be caused by variability in the amount of DNA spotted onto different arrays, we used two duplicate filters for each probe. Figure 2 shows the changes in the numbers of clones and contigs whose intensities changed by more than twofold in the regeneration process. We found 216 clones (163 contigs) that were up-regulated, and 157 clones (81 contigs) that were down-regulated between day 0 and day 1.5 or 3 post amputation by more than twofold. The amount of DNA in each spot of the macroarray was quite different, as the DNA was directly amplified by PCR from bacterial stocks of the EST library and was not checked by electrophoresis. To obtain more consistent results, clones containing the longest insert for each contig (selected by the first differential hybridization) were PCR amplified using plasmid DNA as a template and checked by electrophoresis. Duplicate spots for each insert were re-arrayed onto the same nylon membrane so that the false signals should be distinguished clearly. To confirm the results obtained by the first differential hybridization, re-arrayed filters were hybridized once again, and our data set was reduced to 98 up-regulated and 39 down-regulated contigs. These clones were sequenced and BLAST searched against the XDB3 database to confirm EST information. Some clones whose sequence information was not present in XDB3 overlapped with other contigs that were isolated in the macroarray screen. We were finally able to narrow down our data set to 56 up-regulated and 28 down-regulated contigs (Fig. 2, Tables 1, 2).

thumbnail image

Figure 1. Scheme of the macroarray-based screen for genes involved in tail regeneration. A macroarray filter containing 42,240 EST clones was hybridized with probes prepared from normal and regenerating tails. Differentially expressed genes were re-arrayed onto a nylon membrane. The re-arrayed filter was hybridized again and differentially expressed genes were further analyzed by whole mount in situ hybridization. The re-arrayed filter was also used for temporal expression analysis.

Download figure to PowerPoint

thumbnail image

Figure 2. Results of the changes of number of clones whose expression was up-regulated or down-regulated through the macroarray-based screening. Finally, 48 up-regulated genes and 28 down-regulated genes were identified.

Download figure to PowerPoint

Table 1. Summary of the Up-Regulated Genes Identified in the Screena
Clone IDSequence similarityTemporal expression patternFold increases over day 0
1st screening (macroarray)2nd screening (rearray)Real-time RT-PCRLimb regeneration
1.5d3d1.5d3d1.5d3d
  • a

    Clones were categorized based upon functions assigned by sequence homology. Numbers in the column indicates the fold increases over day 0.

  • b

    Indicates clone whose relative expression level showed less than a twofold increase by quantitative real-time RT-PCR.

Inflammation response
 XL004j13Complement factor B [Xenopus laevis]Early2.02.72.02.8   
 XL028a02Complement component C3 [Xenopus laevis]Early2.53.43.67.2   
Wound healing
 XL040b13Cathepsin B [Gallus gallus]Early2.24.03.74.4  2.7
 XL068g15Annexin II protein (type1) [Xenopus laevis]Early2.01.82.24.0  2.0
 XL073e04Annexin II protein (type2) [Xenopus laevis]Early2.22.12.23.6   
 XL074b06Plasminogen activator inhibitor 1 [Rattus norvegicus]Early2.11.72.02.23.95.3 
 XL093119Apolipoprotein C-I [Canis familiaris]Late1.03.70.72.9  7.9
Cell proliferation
 XL076a07XGadd45-gamma [Xenopus laevis]Early2.02.32.02.49.94.84.3
 XL020j06Tyrosine phosphatase [Xenopus laevis]Late1.42.00.04.4   
 XL021l23Putative ribosomal RNA methyltransferase 1 [Homo sapiens]Late1.72.30.72.42.92.3 
 XL054f02Variant histone H2A.Z12 [Xenopus laevis]Late1.52.11.03.2   
 XL092g11Histone H3.3B [Gallus gallus]Late1.72.11.72.8   
 XL040d11Serotransferrin precursor [Xenopus laevis]Early1.52.02.57.3   
Cell signaling
 XL040a14Secreted frizzled-related protein 2 [Xenopus laevis]Early2.02.56.313.829.326.7 
 XL005m14KLG/PTK7 [Gallus gallus]Late1.72.40.52.31.92.4 
Cell differentiation
 XL049c20Activating transcription factor 5 [Rattus norvegicus]Early2.12.23.74.0  2.2
 XL014c20Cysteine-rich protein [Coturnix japonica]Late1.62.01.82.43.43.5 
 XL034a15HMG-17 [Xenopus laevis]Late1.52.61.33.3   
 XL069101HMG-X [Xenopus laevis]Late1.42.11.83.1   
Cell structure
 XL009e24Filamin A [Mus musculus]Early1.52.02.72.6   
 XL024e24XK endo B keratin [Xenopus laevis]Early5.24.36.712.48.09.3 
 XL030k15Fibronectin [Xenopus laevis]Early2.13.13.99.2  2.6
 XL073g19Keratin K12 [Oryctolagus cuniculus]Early2.75.03.28.534.910.15.6
 XL080o09Keratin, type II cytoskeletal 8 [Xenopus laevis]Early2.33.03.75.7  2.4
 XL101b10Non-muscle tropomyosin [Xenopus laevis]Early2.42.42.53.4   
 XL106g06Desmin [Xenopus laevis]Early2.21.92.62.2   
 XL071h02Keratin 19 [Mus musculus]Late1.92.11.63.3   
 XL092a09Calponin H3 [Xenopus laevis]Late1.02.91.62.95.66.0 
 XL028a13XB-cadherin [Xenopus laevis]Late1.62.00.06.2  2.0
Unclassified
 XL031g21Ribonucleoprotein A1a [Xenopus laevis]Early1.92.22.12.9   
 XL044m11Proteasome [Homo sapiens]Early1.32.32.32.4   
 XL066j10HN1 [Mus musculus]Early2.11.74.14.8   
 XL075a09Muscle acetylcholine receptor gamma subunit [Xenopus laevis]Early3.12.14.07.2  2.7
 XL003e20Caveolin-1 [Xenopus laevis]Late1.72.31.02.01.42.5 
 XL011b20ES1 [Homo sapiens]Late3.27.91.53.2  3.1
 XL019n09rap55 [Pleurodeles waltI]Late1.62.11.02.46.811.6 
 XL052117NO38 [Xenopus laevis]Late1.72.01.42.01.56.4 
 XL069d03Vacuolar proton pump [Gallus gallus]Late1.92.31.82.9  2.2
 XL070a0914 kDa transmembrane protein [Torpedo marmorata]Late1.42.11.42.02.51.82.2
 XL106n21Glutamine synthetase [Bostrychus sinensis]Late2.02.41.92.5   
Novel
 XL064e17cDNA FLJ12953 fis, clone NT2RP2005490 [Mus musculus]Early1.62.02.83.6   
 XL009g22No significant homologyEarly2.71.73.23.0   
 XL025e24No significant homologyEarly3.02.22.35.9   
 XL051a01No significant homologyEarly2.22.12.53.6   
 XL063b01No significant homologyEarly1.42.62.02.4  3.1
 XL016b14No significant homologyLate2.63.81.86.1  2.2
 XL025c16No significant homologyLate1.42.01.13.4   
 XL109f05No significant homologyLate2.01.91.62.6   
 XL057m04Oocyte membrane potein [Xenopus laevis]b 1.32.11.62.01.11.8 
Table 2. Summary of the Down-Regulated Genes Identified in the Screena
Clone IDSequence similarityWISHFold increases over day 0
MacroarrayRearray
1.5d3d1.5d3d
  • a

    Clones were categorized based upon functions assigned by sequence homology. Numbers indicate the fold increases over day 0.

Cell structure
 XL009p23MLC1f/3f [Xenopus laevis]Muscle0.90.40.50.4
 XL050j22Myosin regulatory light chain 2 cardiac actin [Oryctolagus cuniculus]Muscle0.70.40.50.6
 XL052a20Alpha-actinin 3 [Mus musculus]Muscle0.70.40.40.3
 XL057h03Troponin T [Mus musculus]Muscle0.80.50.50.4
 XL061i18Cardiac troponin C [Xenopus laevis]Muscle0.70.40.50.4
 XL073e15Myosin heavy chain [Rana catesbeiana]Muscle0.70.40.50.4
 XL076o02Alpha-tropomyosin [Xenopus laevis]Muscle0.90.40.50.5
 XL081p04Slow troponin 1 [Xenopus laevis]Muscle0.70.40.60.5
 XL097f14Cardiac actin [Xenopus laevis]Muscle0.70.30.50.4
 XL031h07Alpha-1 type II collagen [Xenopus laevis]Notochord0.60.50.50.6
Unclassified
 XL030g10Copine 1 [Homo sapiens]N.D.0.70.50.50.7
 XL035n22Adenylate kinase [Gallus gallus]Muscle1.00.50.50.4
 XL046f11Alycine amidinotransferase [Xenopus laevis]Muscle1.00.40.40.4
 XL058j20Lumican [Homo sapiens]CNS0.50.40.40.6
 XL074p09M-protein striated muscle [Gallus gallus]Muscle0.70.40.30.2
 XL084g20Reticulon 3 protein isoform a [Rattus norvegicus]Muscle and CNS0.70.50.50.8
 XL087f21Arno protein (ARF exchange factor) [Homo sapiens]CNS0.90.50.50.7
Novel
 XL027m21Hypothetical protein [Thermotoga maritima] (strain MSB8)CNS0.80.50.60.5
 XL072b17Unnamed protein product [Homo sapiens]Muscle0.80.50.50.5
 XL075o02Similar to KIAA0971 protein [Mus musculus]CNS1.00.50.50.7
 XL034g19No significant homologyMuscle0.70.50.50.5
 XL059j17No significant homologyMuscle0.40.60.40.4
 XL081g12No significant homologyMuscle and CNS0.60.50.20.4
 XL027d24No significant homologyCNS0.80.40.50.7
 XL041b23No significant homologyCNS0.90.50.50.7
 XL083g20No significant homologyCNS0.70.50.40.6
 XL079h10No significant homologyN.D.0.50.60.50.6
 XL093h17No significant homologyN.D.0.50.50.50.8

To assess the reliability of our macroarray screen, we performed quantitative real-time RT-PCR. We chose 14 clones from among the up-regulated genes and analyzed their relative expression during regeneration. The real-time RT-PCR results yielded 1.8- to 34.9-fold increases in expression, while our macroarray data showed 2.0- to 13.8-fold up-regulation. Only one clone had a relative ratio of less than twofold (Table 1), indicating that our macroarray analysis was reliable.

Whole Mount In Situ Hybridization Analysis of Identified Genes

As a secondary screen to verify the expression of the genes that appeared to be up-regulated during tail regeneration, we performed whole mount in situ hybridization analysis on tailbud stage embryos and the regenerating larval tail. In some cases, sections were used to verify expression observed by whole mount. Of the 56 genes analyzed by the secondary screen, 48 were expressed in the regenerating tail and eight were not detected. Following several rounds of hybridization, we considered the expression level of these eight genes to be below detectable levels because these genes exhibited low intensities in the array analyses.

For down-regulated genes, expressions in embryos and normal larval tails were examined by whole mount and sections, respectively. Of the 28 genes examined, 15 were expressed in muscle, seven in the spinal cord, two in the muscle and spinal cord, one in the notochord, and the remainder undetermined (Table 2). Genes associated with the differentiated muscle cell phenotype are down-regulated during myofiber dedifferentiation in newt limb regeneration (Simon et al., 1995). In the case of Xenopus larval tail regeneration, however, dedifferentiation of myofibers does not occur (Gargioli and Slack, 2004). Apparent down-regulation of these muscle genes might depend on the degradation of myofibers during Xenopus tail regeneration. In the regenerating tail, very few myofibers are present in the distal region of the regenerating tail, and the lack of differentiated muscle cells in the collected tissues produces this apparent down-regulation of muscle differentiation genes. Since these genes, such as myosin light chain, appeared to be involved in late differentiation steps, we focused on genes that were up-regulated during regeneration in order to examine early steps in the regeneration process.

Categorization of Up-Regulated Genes

Forty-eight genes identified in the screen were categorized into several groups according to their putative function during regeneration. These categories include genes involved in wound healing, inflammation response, cell proliferation, cell signaling, cell differentiation, and cell structure (Table 1). Individual examples of genes in these categories are highlighted below.

Wound healing.

Five genes (10%) from this screen appear to be involved in the wound healing process. For example, annexin II (XL073e04) and plasminogen activator inhibitor 1 (PAI1) (XL074b06), which are part of the fibrinolytic surveillance cascade (Hajjar and Krishnan, 1999), show similar expression patterns in the regenerating tail (Fig. 3B,C,E,F). These genes are expressed on the tip of the notochord at early stages of regeneration (Fig. 3B,E) and in blood cells and prenotochordal cells at later stages (Fig. 3C,F).

thumbnail image

Figure 3. Whole mount in situ hybridization of up-regulated genes, grouped according to function as wound healing, inflammation response, and cell proliferation genes. Tailbud stage embryo (A, D, G, J, L, N), regenerating tail on day 2 (B, E, H), and regenerating tail on day 5 (C, F, I, K, M, O) were hybridized with DIG-labeled RNA probes. Lateral view, dorsal side up, anterior to the left. White arrowheads, notochord; white arrows, blood cells; red arrowhead, uncharacterized cells; black arrowheads, wound epidermis; broken line, the plane of amputation. AC: Expression of annexin II (XL073e04). DF: Expression of PAI1 (XL074b06). GI: Expression of cathepsin B (XL040b13). J, K: Expression of complement component C3 (XL028a02). L, M: Expression of histone H3.3B (XL092g11). N, O: Expression of serotransferrin precursor (XL040d11).

Download figure to PowerPoint

Cathepsin B (XL040b13), which was one of the earliest molecules identified in regenerating amphibian limbs and tails (Schmidt, 1966), is first expressed in injured stump tissues (Fig. 3H). At later stages, it is expressed in blood cells and in cells flanking the spinal cord (Fig. 3I).

Inflammation response.

Two genes (4%), complement factor B (XL004j13) and complement component C3 (XL028a02), appear to be involved in inflammation response. Complement component C3 is expressed in blood cells and the wound epidermis (Fig. 3K).

Cell proliferation.

Six genes (13%) identified in our screen appear to be involved in cell proliferation. Histone H3.3B (XL092g11), for example, is expressed ubiquitously in the regeneration bud (Fig. 3M). Serotransferrin precursor (XL040d11), which is thought to be required for proliferation of nearly all cells in serum-free medium (Barnes and Sato, 1980), is expressed in the regenerating notochord (Fig. 3O).

Cell signaling.

Two genes (4%) identified in our screen appear to be involved in cell signaling. Secreted frizzled-related protein 2 (SFRP2) (XL040a14), a Wnt antagonist (Ladher et al., 2000), is expressed in the proximal region of the regenerating tail (Fig. 4B). SFRP2 may interact with XWnt5a, which is expressed in the distal region of the regenerating tail (Sugiura et al., 2004). SFRP2 has also been reported to be expressed in the regenerating caudal fin of the medaka, suggesting that it plays an important role in the regenerating tail of both species (Katogi et al., 2004).

thumbnail image

Figure 4. Whole mount in situ hybridization of up-regulated genes categorized according to function as cell signaling, cell differentiation, and cell structure genes. Tailbud stage embryo (A, C, E, G, I, K, M, O) and regenerating tail on day 5 (B, D, F, H, J, L, N, P). Lateral view, dorsal side up, anterior to the left. Red arrowheads, the proximal region of the regenerating tail; white arrowheads, notochord; black arrows, spinal cord; white arrows, fin epidermis; broken line, the plane of amputation. A, B: Expression of SFRP2 (XL040a14). C, D: Expression of KLG/PTK7 (XL005m14). E, F: Expression of ATF5 (XL049c20). G, H: Expression of cysteine-rich protein (XL014c20). I, J: Expression of HMG-17 (XL034a15). K, L: Expression of HMG-X (XL069l01). M, N: Expression of endo B keratin (XL024e24). O, P: Expression of keratin 8 (XL080o09).

Download figure to PowerPoint

KLG/PTK7 (XL005m14), a receptor tyrosine kinase that lacks endogenous kinase activity (Chou and Hayman, 1991), is expressed in prenotochordal cells and spinal cord in the regenerating tail (Fig. 4D). Recently, PTK7 was reported to be required for convergent extension and neural tube closure (Lu et al., 2004), suggesting that it may function in a similar way in the process of regeneration.

Cell differentiation.

Four genes (8%) identified in our screen appear to be involved in cell differentiation. For example, ATF5 (XL049c20), a member of the activating transcription factor/CREB protein family, which plays a major regulatory role in the progression of neural progenitor cells to neurons (Angelastro et al., 2003), was identified in our screen. Interestingly, ATF5 is expressed in the spinal cord in the regenerating larval tail (Fig. 4F), although no expression was observed in the neural tube at tailbud stage (Fig. 4E).

XL014c20 encodes a gene similar to genes in the cystein-rich protein (CRP) family, which are potent smooth muscle differentiation cofactors (Chang et al., 2004). This gene is expressed in the notochord (Fig. 4G, H), suggesting that it might be involved in differentiation of notochord.

HMG-17 (XL034a15) is a member of the high mobility group family of proteins, and is a chromosomal non-histone protein that marks differentiating tissues and cells during organogenesis (Lehtonen et al., 1998). HMG-17 is expressed in the regenerating tail, particularly in the differentiating cells (Fig. 4J). HMG-X (XL069l01), also a high mobility group protein that is involved in neurogenesis (Kinoshita et al., 1994), is expressed in the regenerating spinal cord and epidermis (Fig. 4L).

Cell structure.

Ten genes (21%) identified in our screen appear to be involved in cell structure. For example, endo B keratin (XL024e24) is expressed in the fin, notochord, and spinal cord in the regenerating bud (Fig 4N).

Keratin 8 (XL080o09) has a very similar pattern of expression as endo B keratin, except that it is also expressed in the epidermis at the tailbud stage (Fig 4O) and is not expressed in the fin in the regenerating tail (Fig. 4P).

Unclassified.

Eleven genes (23%) identified in our screen could not be easily classified, and their functions during the tail regeneration process were not predictable. For example, clone XL070a09, which resembles 14-KDa transmembrane protein (Morel et al., 1991), is expressed in the regenerating muscle (Fig. 5B).

thumbnail image

Figure 5. Whole mount in situ hybridization of unclassified and novel up-regulated genes. Tailbud stage embryo (A, C, E, G, I, K) and regenerating tail on day 5 (B, D, F, H, J, L). Lateral view, dorsal side up, anterior to the left. White arrowhead, regenerating muscles; black arrowhead, the terminal vesicle of the regenerating spinal cord; black arrows, spinal cord; white arrows, blood cells; broken line, the plane of amputation. A, B: Expression of 14kDa transmembrane protein (XL070a09). C, D: Expression of glutamine synthetase (XL106n21). E, F: Expression of XL064e17. G, H: Expression of XL025c16. I, J: Expression of XL051a01. K, L: Expression of XL063b01.

Download figure to PowerPoint

Glutamine synthetase (XL106n21) is expressed in the terminal vesicle of the regenerating spinal cord (Fig. 5D).

Novel.

Eight genes (17%) that had no significant homology to known proteins were classified as novel genes. For example, clone XL064e17, XL025c16, XL051a01, and XL063b01 are expressed in the regenerating spinal cord (Fig. 5E–L). XL025c16 is also expressed in the blood cells (Fig. 5H). Interestingly, XL063b01 is not expressed in the tailbud stage embryo (Fig. 5K), suggesting that this gene may be a regeneration-specific gene.

Regeneration-Specific Expression Patterns

Many of the morphological changes and gene expression patterns observed during normal development are also observed during regeneration (Stocum, 1995). In the case of Xenopus tail regeneration, several genes that are expressed in the embryonic tail bud are re-expressed in the regenerating tail (Beck et al., 2003; Christen et al., 2003; Sugiura et al., 2004). Many genes identified in this study had similar expression patterns during tail regeneration and embryonic development. A few genes, however, are known to have different expression patterns during embryonic stages and regeneration. For example, chordin was expressed in the embryonic tail bud but not in the regenerating tail (Sugiura et al., 2004). We show that Keratin 8 (XL080o09) shows a similar loss of expression in the regenerating epidermis (Fig. 4P), though it is highly expressed in the embryonic tail bud (Fig. 4O). At least two genes, ATF5 and XL063b01, were not expressed in the embryonic tail bud but were expressed in the regenerating tail (Figs. 4E,F and 5K,L), suggesting that there exist some regeneration-specific pathways.

Temporal Expression Patterns of Genes Involved in Regeneration

One of the advantages of cDNA array-based analyses is the ability to simultaneously examine a large number of genes at different time points. We used the re-arrayed filter to examine the temporal expression pattern at 0, 1.5, 3, 4.5, and 6 days post-amputation. Genes that showed greater than twofold up-regulation by 1.5 days post-amputation were defined as early responding, while those that were up-regulated at later stages were defined as late responding genes (Fig. 6A,C and Table 1). There were 26 early responding genes, which fell into the following functional categories: inflammation response (2/26), wound healing (4/26), cell signaling (1/26), cell proliferation (2/26), cell differentiation (1/26), cell structure (7/26), unclassified (4/26), and novel (5/26) (Fig. 6B and Table 1). There were 22 late responding genes, which including wound healing (1/22), cell signaling (1/26), cell proliferation (4/22), cell differentiation (3/22), cell structure (3/22), unclassified (7/22), and novel (3/22) genes (Fig. 6D and Table 1). These temporal expression patterns are consistent with the timing of morphological events that occur during regeneration (for example, inflammation response and wound healing are known to be early responses, whereas cell differentiation occurs later). In the case of down-regulated genes, the expression level decreased immediately at 1.5 days post-amputation (Fig. 6E and Table 2).

thumbnail image

Figure 6. Temporal expression patterns of identified genes. Relative expression ratios were plotted during each regenerative day. A: Temporal expression patterns of early responding genes whose relative expression ratios reach twofold by 1.5 days post-amputation. B: Categories of early responding genes. C: Temporal expression pattern of late responding genes whose relative ratios reach twofold after 1.5 days post-amputation. D: Categories of late responding genes. E: Temporal expression pattern of down-regulated genes. F: Categories of late down-regulated genes.

Download figure to PowerPoint

Analysis of Genes Expressed During Limb Regeneration

To determine whether there is a common set of genes involved in regeneration of both the tail and the limb, we hybridized re-arrayed filters with probes made from normal and regenerating limbs. There were 15 genes, categorized as being involved in wound healing (3/15), cell proliferation (1/15), cell differentiation (1/15), cell structure (4/15), unclassified (4/15), and novel (2/15), whose expression levels were greater than twofold higher in the regenerating limb than in the normal limb (Table 1). It was previously reported that cathepsins, fibronectin, and keratin 8 are expressed in the regenerating limb (Schmidt, 1966; Grinnell, 1984; Ferretti et al., 1989). Interestingly, ATF5 and XL063b01, which were also pulled out in our tail regeneration screen, were among the genes we found to be up-regulated in the regenerating limb.

CONCLUSIONS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Here, we present the first identification of candidate genes involved in Xenopus larval tail regeneration using DNA macroarray technology. Many of the genes identified in this screen are thought to be involved in processes associated with regeneration, such as wound healing, inflammation response, cell proliferation, cell signaling, cell differentiation, and cell structure.

One interesting question in the field of regeneration is whether the molecular mechanisms underlying regeneration resemble those of normal development, or whether regeneration-specific gene regulation exists. To answer this question, it is necessary to isolate the genes that are expressed specifically during regeneration. Through a macroarray-based comprehensive screen, we identified two genes with regeneration-specific expression. Interestingly, these two genes were expressed not only in the regenerating tail but also in the regenerating limb, which suggests the possibility that these genes are important for the regeneration process in general. To investigate the function of these genes, manipulation of gene expression will be necessary. Several techniques, such as transgenic methods and electroporation of plasmids or morpholino oligos, have been established (Beck et al., 2003; Echeverri and Tanaka, 2003; Schnapp and Tanaka, 2005). These techniques should prove useful to investigate the function of genes identified in this study and provide a more detailed understanding of the molecular mechanisms underlying the process of Xenopus larval tail regeneration.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Animals and Surgical Operation

Xenopus laevis tadpoles obtained after ovulation and copulation induced by gonadotropic hormones (Teikoku Zouki) were subjected to 50% tail removal at stage 48 (according to Nieuwkoop and Faber, 1956). Operated tadpoles were cultured in autoclaved tap water with 10,000 IU/ml penicillin (Meiji) and 10 mg/ml streptomycin (Meiji) at 22°C.

Macroarray Libraries

The bacterial stocks of 42,240 independent cDNA clones, ranging from XL001a01 to XL110p24 from the NIBB Mochii normalized gastrula and tailbud cDNA libraries, generated by the NIBB/NIG Xenopus laevis EST project (Kitayama, unpublished data), were as used templates to PCR amplify the inserts using vector-specific primers. Inserts were arrayed onto a nylon membrane filter (Hybond-N; Amersham Pharmacia) using a gridding robot (Bio Robotic) at a high-density (384 × 5 × 5 cDNA grids per 8 × 12 cm filter). The sequence information of the cDNA clones is available at the XDB3 website (http://xenopus.nibb.ac.jp). The filters were denatured with 0.5M NaOH and 1.5M NaCl, neutralized with 0.5M Tris-HCl (pH 7.0), 1 mM EDTA, and 1.5M NaCl, and baked at 80°C for 2 h.

RNA Purification

The regenerating tails were cut again at about 0.5 mm from the point of amputation at each stage (0, 1.5, 3, 4.5, 6 days after operation). Total RNA was extracted using Trizol reagent (Invitrogen, La Jolla, CA), according to the manufacturer's instructions.

Differential Hybridization

For probe labeling, 10 μg of total RNA (days 0, 1.5, 3) was incubated with oligo(dT) primer, Superscript RTase (Invitrogen) and 32P-dCTP at 37°C for 2.5 h. Two duplicate filters were hybridized as previously described (Mochii et al. 1999). Hybridized signals were detected using the Fuji BAS system and quantified with Array Gauge software (Fuji film). After quantification, the intensities of corresponding spots from the two duplicate filters were averaged. The averaged intensities for day-1.5 and -3 samples were normalized to the total intensity of the day-0 spots.

cDNA Clone Recovery and Rearray

Clones that were up-regulated or down-regulated during tail regeneration were isolated from the library and their plasmid DNA was purified using the Automatic DNA Isolation System PI-50 (Kurabo). Inserts that were PCR amplified using plasmid DNA as templates were then re-arrayed at high density (384 × 4 × 4 cDNA grids per 8 × 12 cm filter), as described above. EF1-alpha was used to normalize the data.

Real-Time Quantitative RT-PCR

Complementary DNA was synthesized from total RNA (1 μg) using Ready-to-Go You-Prime First-Strand Beads (Amersham Biosciences) and random hexamers, according to the manufacturer's instructions. The quantification of each gene was done using real-time RT-PCR. The specific primers used to quantitate were as described in Table 3. The amplification profile for these primer pairs was as follows: 95°C for 10 min, 40 cycles of 95°C for 15 s, and 65°C for 1 min, performed in an ABI PRISM 7000 Sequence Detection System (PE Applied Byosystems). Standard curves were generated for each gene and unknown quantities relative to the standard curve for each gene were calculated, yielding transcriptional quantitation of each gene relative to the endogenous standard (EF1-alpha).

Table 3. Primer Pairs Used for Quantitative Real-Time RT-PCR
Clone IDSense primerAntisense primer
EF1-alphaCAGGCCAGATTGGTGCTGGATATGCGCTCTCCACGCACATTGGCTTTCCT
XL074b06CACTGACCCGTCTGGTGCTATTAAGTGCTAAACTCACCGTAGTTGTATTTCCCAGTGTTG
XL076a07GCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAAAACTCCTCCAACTTCATGGCATGACTGA
XL021l23AAGCTCCGGTAAGTATCCCATGTCTGTTTGCAGTGGAGACCTTTGTGATATCCCCCTGAA
XL040a14GCAGTGCCACCAGGACACCAAGAAGTTCCTGCAGCTGTCCTTCACCTGCTCACACAGAGA
XL005m14CCCAGGCTGCTGTTCTACTGTTTGTTAAGGATCTCACACCAGTATCTGCGCTTTCAATGT
XL014c20TAGGTGTGCAAAGTGTGGAAAGAGTCTAGATGTGTTGTCTCCAGAACAAGCTGCATCCTT
XL024e24TCTATGTACTCTTCCTCCTCTGTGGTAGGTTCCCACGGAGGATACCCTAGATACAGAGAT
XL073g19GGGTCCTAGATGAACTTACCCTGGCAAGGTGCCAGAGCCCCCTTTATTTGAGGTCATCTC
XL092a09TTGTAGCCCAAACTCCACTGTGTTAAGCAAGATGGAACTTCTCCCAGTCACACACACTAG
XL003e20GAGACGTTACTGCTTGCCAACAGAATTCACTATGCCCTGACACCACTCCTGATTGTAAAT
XL019n09GGACCCTGCCATTGTACAGTCTTCATTAGGGTCAAAGAACTACCTGCAACAGCACCAAAC
XL052117ATGAGCACCAGTTGTCATTGAGAACGGTTACTGACATATACTGGTCCTGAACCCGATTTC
XL070a09GAGTTGCAACGGAGAAGATGCTCGATGATCCTGCCCGAGAAGACCAGGAATGACAGTGAA
XL057m04ATCCAGCAAACAGACGACTCTCTCATTCACCCCTGTGGTGCACTGTGACACTCTCTTAAA

In Situ Hybridization

The insert encoding each selected gene was PCR amplified using T3/T7 primers of the Bluescript vector that flanked the insert. Antisense digoxigenin (DIG)-labeled RNA probes were synthesized with T7 RNA polymerase (Invitrogen) and a DIG-labeled nucleotide mixture (Roche). Whole mount and section in situ hybridization were performed as previously described (Sugiura et al., 2004) using BM purple (Roche) for color detection.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

This work was supported by the “Research for the Future Program” of the Japanese Society for the Promotion of Science to N.U. and a Grant-in-Aid from the Ministry of Education, Science, Sports, and Culture, Japan, to M.M. We thank Dr. Orii, Takuji Sugiura, Yuka Taniguchi, and other members of our laboratory for helpful discussion and maintenance of animals.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. CONCLUSIONS
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES