SEARCH

SEARCH BY CITATION

Keywords:

  • pleiomorphic adenoma genes (Plag);
  • Plag1;
  • Plag-l2;
  • Zac1;
  • zinc finger transcription factors;
  • nervous system;
  • development;
  • tumor suppressor;
  • proto-oncogene

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

In the developing nervous system, cell fate specification and proliferation are tightly coupled events, ensuring the coordinated generation of the appropriate numbers and correct types of neuronal and glial cells. While it has become clear that tumor suppressor genes and oncogenes are key regulators of cell division in tumor cells, their role in normal cellular and developmental processes is less well understood. Here we present a comparative analysis of the expression profiles of the three members of the pleiomorphic adenoma gene (Plag) family, which encode zinc finger transcription factors previously characterized as tumor suppressors (Zac1) or oncogenes (Plag1, Plag-l2). We focused our analysis on the developing nervous system of mouse where we found that the Plag genes were expressed in both unique and overlapping patterns in the central and peripheral nervous systems, and in olfactory and neuroendocrine lineages. Based on their patterns of expression, we suggest that members of the Plag gene family might control cell fate and proliferation decisions in the developing nervous system and propose that deciphering these functions will help to explain why their inappropriate inactivation/activation leads to tumor formation. Developmental Dynamics 234:772–782, 2005. © 2005 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The pleiomorphic adenoma gene (Plag) gene family includes Plag1, Plag-l2, and Zac1[zinc finger protein that regulates apoptosis, and cell cycle arrest (Spengler et al., 1997); also known as lost-on-transformation (Lot1) (Abdollahi et al., 1997), Plag-l1 (Kas et al., 1998)], all of which encode transcriptional regulators containing C2H2 zinc finger domains. Zac1 is a maternally imprinted gene, a characteristic of several genes implicated in growth control, and suggestive of dosage-dependent gene function (Piras et al., 2000; Smith et al., 2002). Indeed, a link between Zac1 and growth control has been firmly established, with Zac1 identified as a tumor suppressor based on its localization to a chromosomal region (6q24-25) linked to growth inhibition and its ability to induce cell cycle arrest and apoptosis when misexpressed in epithelial cell lines (Spengler et al., 1997; Bilanges et al., 2001). Moreover, germline mutations in Zac1 predispose humans to breast (Bilanges et al., 2001), pituitary (Pagotto et al., 2000), head and neck (Koy et al., 2004), and ovarian carcinomas (Abdollahi et al., 1997, 2003). Consistent with a role for Zac1 in development, overexpression of Zac1 in humans resulting from a loss of maternal imprinting or duplication of the active paternal allele is associated with intrauterine growth restriction and transient neonatal diabetes mellitus (Gardner et al., 2000; Kamiya et al., 2000).

In contrast to Zac1, Plag1 was identified as a target of recurrent chromosomal translocations and is upregulated in pleiomorphic adenomas of the salivary gland (Kas et al., 1997) and lipoblastomas (Hibbard et al., 2000). Consistent with Plag1 acting as a proto-oncogene, misexpression in fibroblast cell lines leads to serum- and anchorage-independent growth, loss of contact inhibition, and tumor formation in nude mice (i.e., Plag1 transforms cell lines) (Hensen et al., 2002). Plag-l2, the third member of this family, has oncogenic properties similar to Plag1 when misexpressed in fibroblasts, and both Plag1 and Plag-l2 positively regulate the insulin growth factor II gene, suggesting that they could act as proto-oncogenes by activating the same mitogenic pathway (Hensen et al., 2002). Consistent with Plag1 functioning to promote cell proliferation, null mice are growth retarded; however, a potential role for Plag1 in nervous system development remains to be assessed (Hensen et al., 2004)

We cloned Zac1 in a subtractive hybridization screen that was designed to isolate genes involved in neuronal fate specification (Mattar et al., 2004). To begin to determine whether Zac1 and the related family members Plag1 and Plag-l2 could indeed function in the developing nervous system, we conducted a detailed analysis of their expression patterns during embryogenesis and early postnatal development. While the spatial distribution of Plag1 and Plag-l2 transcripts has not been previously reported, Northern blot analysis suggested that these genes are expressed during embryogenesis and in some adult tissues (Kas et al., 1997, 1998; Furukawa et al., 2001). In contrast, several groups have conducted a spatiotemporal analysis of Zac1 expression during development, demonstrating that this gene is expressed in a regionalized manner in the embryonic neural tube and in numerous other non-neural sites (Valente and Auladell, 2001; Ciani et al., 2003; Tsuda et al., 2004; Valente et al., 2005). Here we extend these studies by presenting a comparative analysis of the spatial distribution of Zac1, Plag1, and Plag-l2 transcripts during neural lineage progression, focusing on several central nervous system (CNS; i.e., neocortex, cerebellum, spinal cord, and retina), peripheral nervous system (PNS; i.e., cranial ganglia), sensory (olfactory epithelium), and neuroendocrine (pancreas) lineages. Our results indicate that while the three members of the Plag gene family are co-expressed in some lineages, they also display unique and sometimes complementary patterns of expression in other tissues. Specifically, Plag genes are expressed in progenitor populations as well as in postmitotic neurons, suggesting that they could have both early roles in neural development, controlling cell fate or proliferation decisions, and could also participate later in the differentiation process.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Plag Genes Are Expressed in a Distinct Fashion at Early Stages of Embryonic Development

To gain an overall assessment of Plag gene expression at early stages of neural lineage development, we first performed wholemount RNA in situ hybridization at embryonic days (E) 9.5 and 10.5. At both stages, Zac1 transcripts were detected in a regionalized pattern throughout the neural tube, with higher levels observed dorsally in the telencephalon, diencephalon, midbrain, and caudal spinal cord and ventrally in the hindbrain (Figs. 1A,D,G, 2A,D,G,J). At E10.5, Zac1 transcripts were also evident in the optic cup and the vicinity of the olfactory pit. Notably, Zac1 was also expressed in non-neural regions of the embryo, including the neural crest-derived branchial arches, which contribute extensively to the face, nasal cavities, mouth, larynx, pharynx, and neck (Figs. 1A, 2A,D). Developing heart structures, including the walls of the outflow tract, atria and ventricles expressed Zac1 at E9.5 and, at E10.5, expression was also detected in the bulbis cordis (Figs. 1A, 2A,J,M). Zac1 transcripts were detected in intersomitic regions at E9.5 (Fig. 1A,G) and at high levels in the rostral compartments of E10.5 somites (Fig. 2A,J; and data not shown). Finally, Zac1 transcripts were detected in the lining of the developing gut and stomach and in the center of the forelimb bud at E9.5 and E10.5 (Figs. 1A,G, 2A,J,M; data not shown).

thumbnail image

Figure 1. Zac1, Plag-l2, and Plag1 are expressed in the neural tube and non-neural structures at E9.5. Wholemount RNA in situ hybridization of E9.5 embryos with Zac1 (A, D, G), Plag-l2 (B, E, H), and Plag1 (C, F, I) antisense probes. Intersomitic regions are marked with arrowheads in G. a, atrium; b, branchial arch; di, diencephalon; fg, foregut; fl, forelimb; g, gut; h, heart; hb, hindbrain; hd, hindgut diverticulum; hg, hindgut; is, intersomitic; m, midbrain; nt, neural tube; o, otic vesicle; of, outflow tract of heart; ol, olfactory placode; op, optic vesicle; so, somite; t, telencephalon.

Download figure to PowerPoint

thumbnail image

Figure 2. Zac1, Plag-l2, and Plag1 are expressed in the neural tube and non-neural structures at E10.5. Wholemount RNA in situ hybridization of E10.5 embryos with Zac1 (A, G, J), Plag-l2 (B, H, K), and Plag1 (C, I, L) antisense probes. Somites are marked with arrowheads in J. Section RNA in situ of E10.5 sagittal sections with Zac1 (D, M), Plag-l2 (E, N), and Plag1 (F, O) antisense probes. a, atrium; b, branchial arch; bc, bulbis cordis; di, diencephalon; fl, forelimb; h, heart; hb, hindbrain; hl, hindlimb; hp, hepatic primordium; m, midbrain; nt, neural tube; o, otic vesicle; ol, olfactory pit; oc, optic cup; so, somite; s, stomach; t, telencephalon; v, ventricle of heart.

Download figure to PowerPoint

Plag-l2 was more uniformly expressed in the E9.5 and E10.5 neural tube, with transcripts detected both dorsally and ventrally in the telencephalon, diencephalon, midbrain, hindbrain, and spinal cord (Figs. 1B,E, 2B,E,H). Plag-l2 was also expressed in other neural tissues at E9.5 and E10.5, including the olfactory placode/pit and optic vesicles (Figs. 1B,E, 2B,H). In non-neural tissues, Plag-l2 transcripts were detected in Rathke's pouch, an ectodermal outpocketing that gives rise to the pituitary gland, the developing branchial arches, posterior somites, and fore- and hind-limb buds (Figs. 1B,H, 2B,E,K). Finally, Plag-l2 transcripts were detected in the epithelial lining of the otic vesicle, lung, stomach, and gut, and in the hepatic primordium (Figs. 1B, 2B,N; and data not shown).

Plag1 was expressed at the lowest levels of the three Plag family members and displayed a regionalized pattern of expression in the E9.5 and E10.5 neural tube, albeit to a lesser extent than Zac1. Plag1 transcripts were detected at the highest levels in the dorsal telencephalon, diencephalon, and midbrain and at lower levels in the hindbrain and ventral regions of the neural tube (Figs. 1C,F, 2C,F,I). Low Plag1 expression was also observed in the caudal spinal cord (Figs. 1C,I, 2C,). In non-neural tissues, Plag1 transcripts were detected in the developing branchial arches, caudal somites, Rathke's pouch, limb buds, and intersomital regions (Figs. 1C,I, 2C,F,L; data not shown).

As a first step towards understanding how Plag genes might function in the developing nervous system, we performed a detailed spatiotemporal comparison of their expression patterns during neural lineage progression, focusing on regions where expression of one or more of the Plag genes was observed at E9.5 and E10.5 (Figs. 1, 2). Specifically, we examined several regions of the CNS (telencephalon, cerebellum, spinal cord, retina), as well as sensory (olfactory system), enteric, and neuroendocrine (pancreas) lineages.

Zac1 and Plag-1 Are Regionalized While Plag-l2 Is More Uniformly Expressed in the Developing Telencephalon

The telencephalon can be subdivided into distinct dorsal and ventral regions that give rise to the neocortex/hippocampus and striatum/globus pallidus, respectively. We were particularly interested in studying Plag gene expression in telencephalic domains given that we isolated Zac1 in a subtractive hybridization screen that was designed to identify genes involved in neural fate specification in the dorsal telencephalon (Mattar et al., 2004). Moreover, from our wholemount analysis, Zac1 was expressed in a regionalized manner in the telencephalon, with higher transcript levels detected in dorsal, cortical domains at E9.5 and E10.5 (Figs. 1A,D, 2A,D,G). Consistent with a potential role in cortical development, several genes that are expressed in a regionalized manner in the developing neocortex, including Pax6 and Ngn2, have been implicated in the specification of cortical neuronal fates (Fode et al., 2000; Tarabykin et al., 2001; Schuurmans et al., 2004).

In mouse, neocortical neurons are born over a series of 11 cell divisions between E10 and E17 (Caviness, 1982; Caviness et al., 1995; Takahashi et al., 1999). In the first wave of neurogenesis, differentiating neurons migrate towards the pial surface, forming a superficial neuronal layer known as the preplate by E12.5. At E12.5, the ventral telencephalon is comprised of a medial ganglionic eminence (MGE) and lateral ganglionic eminence (LGE), morphologically distinct structures that give rise to the globus pallidus and striatum, respectively (Smart, 1976). In E12.5 coronal sections, Zac1 transcripts (Fig. 3A) and protein (Fig. 3D) were detected at high levels in dividing cortical progenitors in the ventricular zone (VZ) and a few scattered neurons in the preplate but were excluded from the cortical hem (asterisks, Fig. 3A,D), an important signaling center for telencephalic growth and differentiation (Grove et al., 1998; Monuki et al., 2001; Shimogori et al., 2004). The ventral limit of the Zac1 expression domain extended past the corticostriatal angle into the dorsal part of the LGE but was excluded from the MGE. Plag-l2, by comparison, was not regionalized in the telencephalon, and transcripts were detected throughout the dorsal and ventral VZ but were excluded from postmitotic neurons in the cortical preplate and ventral mantle zone (Fig. 3B). Finally, Plag1 displayed a regionalized pattern in the E12.5 telencephalon, with transcripts detected at the highest levels in dorsal cortical progenitors, at much reduced levels in the VZ of the LGE and MGE, and excluded from postmitotic neuronal populations (Fig. 3C). Notably, both Plag-l2 (Fig. 3B) and Plag1 (Fig. 3C) were expressed in the cortical hem, in contrast to Zac1.

thumbnail image

Figure 3. Zac1 is regionalized while Plag1 and Plag-l2 are more uniformly expressed in telencephalic progenitors. Analysis of the distribution of Zac1 (A, J, M), Plag-l2 (B, K, N), and Plag1 (C, L, O) transcripts in E12.5, E15.5, and P0 frontal sections through the telencephalon. DF: Double labeling with anti-Zac1 (green, D) and anti-Pax6 (red, E) and merged image (F) at E12.5. At E12.5, the sharp ventral limit of Zac1 expression in the lateral LGE (arrowhead, A, D) was more ventral than the border of high Pax6 expression (closed arrowhead, E), but matched the low expression border of Pax6 (open arrowhead, E). Zac1 was excluded from the cortical hem (asterisk, A, D). Zac1 (A, inset in D) and Pax6 (inset in E) were also expressed in a stream of neurons migrating to the amygdaloid complex in the ventral telencephalon. G–I: Double labeling with anti-Zac1 (green, G) and anti-TUJ1 (red, H), and merged image (I) at E12.5. Zac1 was co-expressed with TUJ1 in the developing preplate. cx, cortex; IZ, intermediate zone; lge, lateral ganglionic eminence; mge, medial ganglionic eminence; PP, preplate; str, striatum; SVZ, subventricular zone; VZ, ventricular zone.

Download figure to PowerPoint

By performing double labeling experiments with antisera specific for Zac1 (Spengler et al., 1997) and other cell type-specific markers, we were able to better identify Zac1-expressing cells. Notably, Zac1 was co-expressed with Pax6 in most cortical progenitors from E12.5 to postnatal day (P) 0 (Fig. 3D–F, data not shown). In the LGE, the ventral limit of Zac1 expression correlated well with the ventral border for low (open arrowhead, Fig. 3E) but not high (closed arrowhead, Fig. 3E) expression of Pax6. Notably, progenitors in the lateral part of the LGE give rise to neurons that populate the amygdala, and indeed, both Zac1 and Pax6 were expressed in a migratory stream in the basolateral telencephalon (arrows, Fig. 3A,D,E). However, in merged images, the Zac1 and Pax6 expressing streams did not overlap (inset in Fig. 3F), suggesting that progenitors expressing these two transcription factors give rise to distinct nuclei in the amygdaloid complex (Tole et al., 2005). Finally, we confirmed that Zac1 was expressed in a small number of postmitotic neurons by performing double-labeling with neuronal-specific β-tubulin (TUJ1) and identifying co-labeled cells in the cortical preplate at E12.5 (Fig. 3G–I; arrowheads; inset in Fig. 3I) and in deep-layers of the cortex at E15.5 and P0 (data not shown).

We next examined Plag gene expression at E15.5, a stage when cortical plate neurons that will occupy deep layers IV–VI have begun differentiating, and at P0, when neurogenesis is complete but neurons are still migrating to their final locations in the cortical plate. At E15.5 and P0, Zac1 transcripts (Fig. 3J,M) and protein (data not shown) were detected at high levels in progenitor cells in the cortical VZ, at much reduced levels in the SVZ, and at intermediate levels in a band of cells in the developing cortical plate (arrowheads, Fig. 3J,M). In contrast, both Plag-l2 (Fig. 3K,N) and Plag1 (Fig. 3L,O) were uniformly expressed in the VZ of the dorsal and ventral telencephalon at E15.5 and P0, albeit at much reduced levels at P0, particularly for Plag1 (Fig. 3O). All three Plag genes are thus expressed at the time when neuronal fate decisions are made in the neocortex and could, therefore, influence cell fate choices made by cortical progenitors. However, Plag1 likely functions in a more restricted manner than Zac1 and Plag-l2, in particular given that expression of Plag1 is strongly diminished by P0, corresponding to a stage when neurogenesis has ceased and gliogenesis is beginning in the cortex.

Expression of Plag Genes in the Developing Cerebellum

The cerebellum is derived from the first rhombomere of the hindbrain, which lies adjacent to the fourth ventricle at E9.5 of development (Chizhikov and Millen, 2003). We noted that, at E9.5 and E10.5, Zac1, Plag-l2, and Plag1 transcripts were detected in the cerebellar anlage next to the rhombic lip (Figs. 1, 2), prompting us to examine expression of these genes at later stages of cerebellar development. In sagittal sections through the developing cerebellum at P0 (Fig. 4A) and P7 (Fig. 4E), Zac1 transcripts were detected in the external granular layer (EGL) and, in posterior lobes, expression was also evident in the internal granular cell layer (IGL). Plag-l2 and Plag1 were also expressed at high levels in the EGL and lower levels throughout the IGL at both P0 (Fig. 4B,C) and P7 (Fig. 4F,G). By way of comparison, Reelin, a known marker of cerebellar granular neurons, was also expressed in the EGL and IGL at P0 (Fig. 4D) and P7 (Fig. 4H). At P21, when cell migration in the cerebellum is complete, Zac1 (Fig. 4I), Plag-l2 (Fig. 4J), Plag1 (Fig. 4K), and Reelin (Fig. 4L) were all specifically expressed in IGL neurons, with Zac1 also detected in a subset of Purkinje cells in posterior lobes (Fig. 4I). Notably, the Zac1 transcript distribution we observed correlates well with the analysis of Zac1 protein distribution in the rat cerebellum (Ciani et al., 2003). Thus, Plag family genes are expressed in progenitor cells of the cerebellar lineage and in specific subsets of postmitotic cerebellar neurons, suggesting a possible role for these genes in the development of this structure.

thumbnail image

Figure 4. Zac1, Plag-l2, and Plag1 are expressed in a distinct set of postmitotic neuronal populations in the cerebellum. Sagittal sections through the cerebellum at P0 (AD), P7 (EH), and P21 (IL). Sections were hybridized with Zac1 (A, A', E, E', I), Plag-l2 (B, B', F, F', J), Plag1 (C, C', G, G', K), and Reelin (D, D', H, H', L) probes. Arrowheads in I point to Purkinje cells expressing Zac1 in posterior lobes of the cerebellum. E, external granular layer; I, internal granular layer; M, molecular layer; P, Purkinje cell layer.

Download figure to PowerPoint

Zac1 Expression Is Regionalized in Spinal Cord Progenitor Domains While Plag1 and Plag-l2 Are More Uniformly Expressed

In the developing spinal cord, neuronal diversity is generated by patterning the neural tube along the dorsoventral axis into discrete progenitor cell domains, each of which have distinct regional identities and give rise to different populations of neurons (Tanabe and Jessell, 1996). As a consequence, regionalized expression of a gene in a particular progenitor cell compartment(s) often reflects a role in the specification and/or differentiation of a particular neuronal phenotype. In transverse sections at E10.5, we noted that Zac1 was expressed in a regionalized manner in the spinal cord, with transcripts detected at high levels in a broad band of VZ progenitors in the dorsal half of the neural tube and in a much smaller band in the ventral-most region, including the floor plate (Fig. 5A). At E12.5, Zac1 transcripts were still evident in the dorsal VZ but were excluded from postmitotic neurons in the mantle zone (Fig. 5F). Zac1 expression overlapped with the bHLH transcription factor Mash1 in dorsal but not ventral domains of the spinal cord (Fig. 5D,I) and was complementary to the pattern of Ngn2 (Fig. 5E). On the contrary, Plag-l2 expression was not regionalized and transcripts were detected at uniform levels throughout the germinal zone of the E10.5 and E12.5 spinal cord (Fig. 5B,G). Plag1 transcripts were also detected in spinal cord progenitors, albeit at much lower levels than observed for the other Plag family members, with expression extending along the dorsoventral axis (Fig. 5C,H). Of note, Plag-l2 and Plag1 were also not expressed in differentiated neurons in the mantle zone. Based on these patterns of expression, we suggest that, while Zac1 might participate in the genesis of a particular class of spinal interneurons, Plag-l2 and Plag1 could play a more general role in regulating progenitor cell behaviour in the spinal cord.

thumbnail image

Figure 5. Zac1 expression is regionalized while Plag1 and Plag-l2 are more uniformly expressed in spinal cord progenitors. RNA in situ hybridization with Zac1 (A), Plag-l2 (B), Plag1 (C), Mash1 (D), and Ngn2 (E) probes on transverse sections of the spinal cord at E10.5. RNA in situ hybridization with Zac1 (F), Plag-l2 (G), Plag1 (H), Mash1 (I), and SCG10 (J) probes on transverse sections of the spinal cord at E12.5. Mash1 (I) and SCG10 (J) were expressed in the sympathetic ganglia (ganglia labeled with arrows, F–J) on either side of the dorsal aorta and only SCG10 (J) was expressed in the dorsal root ganglia (ganglia marked with arrowheads, F–J). ag, adrenal gland; da, dorsal aorta; drg, dorsal root ganglion; l, lung; s, somite; sg, sympathetic ganglia.

Download figure to PowerPoint

Plag Genes Are Expressed in Dividing Retinal Progenitors and Distinct Populations of Postmitotic Retinal Cells

The retina is a sensory structure that is considered part of the CNS as it is generated from a bilateral evagination of the anterior forebrain, which results in the formation of the optic vesicle at approximately E8.5 in mouse (Wawersik and Maas, 2000). While the distal optic vesicle gives rise to the retina, the neural layer of the eye that is crucial for photoreception, the proximal vesicle becomes the retinal pigmented epithelium (RPE). At approximately E10 in mouse, the optic vesicle invaginates to form a bilayered optic cup, with the neural retina forming a layer next to the developing lens, and the presumptive RPE forming an outer layer. All three members of the Plag gene family were expressed in the optic cup at E10.5 (Fig. 2A–C), with Zac1 transcripts appearing in the optic vesicle as early as E9.5 (Fig. 1A), prompting us to examine their expression in the developing eye in more detail. From E12.5 through to P0, Zac1 (Fig. 6A,D,G), Plag-l2 (Fig. 6B,E,H), and Plag1 (Fig. 6C,F,I) transcripts were detected in dividing progenitor cells in the outer neuroblast layer of the retina and were either excluded from (Zac1) or expressed at much lower levels (Plag1, Plag-l2) in postmitotic precursors and differentiated cells in the inner neuroblast layer. Plag-l2 (Fig. 6B,E,H) and Plag1 (Fig. 6C,F,I) transcripts were also detected in the developing lens at E12.5 and E15.5, while only Plag-l2 expression persisted in the lens until P0.

thumbnail image

Figure 6. Zac1, Plag-l2, and Plag1 are expressed in dividing retinal progenitors and in distinct populations of postmitotic retinal cells. RNA in situ hybridization with Zac1 (A, D, G, J, M), Plag-l2 (B, E, H, K, N), and Plag1 (C, F, I, L, O) probes on frontal sections through the retina at E12.5 (A–C), E15.5 (D–F), P0 (G–I), P7 (J–L), and P21 (M–O). GCL, ganglion cell layer; inbl, inner neuroblast layer; INL, inner nuclear layer; le, lens; onbl, outer neuroblast layer; ONL, outer nuclear layer.

Download figure to PowerPoint

At early postnatal stages (i.e., P7) and extending to P21, when retinal cell differentiation is complete, transcripts for all three Plag genes were detected in distinct populations of differentiated retinal cells. Specifically, at postnatal stages, Zac1 transcripts were excluded from the outer nuclear layer (ONL; Fig. 6J,M), where rod and cone photoreceptors are located, while both Plag-l2 (Fig. 6K,N) and Plag1 (Fig. 6L,O) were expressed at high levels in differentiating photoreceptors in the ONL from P7 to P21. Zac1 (Fig. 6J,M), Plag-l2 (Fig. 6K,N), and Plag1 (Fig. 6L,O) transcripts were all detected in a subset of cells in the inner nuclear layer (INL), a layer that contains amacrine, horizontal and bipolar interneurons, and Müller glial cells. Finally, at P7 and P21, all three Plag genes were expressed in a subset of cells in the ganglion cell layer (GCL), which is comprised of retinal ganglion cells and displaced amacrine cells. Thus, while Plag-l2 and Plag1 have similar patterns of expression in the postnatal retina, Zac1 is expressed in a distinct manner, suggesting that these genes may participate in the genesis of distinct retinal cell populations.

Plag1 and Plag-l2 Are Expressed in Neural Lineages in the Olfactory Epithelium and Vomeronasal Organ

In addition to CNS structures, we also observed Plag gene expression in the developing olfactory system. The main component of this sensory system is the olfactory epithelium, which is required for chemoreception and contains a single population of olfactory receptor neurons (ORNs). During development, the olfactory epithelium is generated from the olfactory placodes, which develop as bilateral ectodermal thickenings generated ventral to the neural tube at approximately E9.5 of development (Cau et al., 1997). By E10.5, the olfactory placodes invaginate to form the olfactory pits. Notably, we detected high levels of Plag-l2 (Figs. 1B,E, 2B,E,H) and Zac1 (Figs. 1D, 2A,D,G) transcripts in the region of the olfactory placodes at E9.5 and olfactory pits at E10.5, while lower levels of Plag1 (Figs. 1F, 2C,F, I) transcripts were detected. However, section analysis at E9.5 and E10.5 indicated that, while Plag-l2 and Plag1 were expressed in the olfactory pit/placode (Fig. 2E,F), Zac1 expression was restricted to the non-neural mesenchyme surrounding these structures (Fig. 2D).

By E12.5, the olfactory pits have undergone a morphological transformation, giving rise to a series of intricate folds and initiating the formation of a layered olfactory epithelium. At E12.5, the olfactory epithelium is comprised of differentiated ORNS, which occupy a more central position and can be labeled with the panneuronal marker SCG10 (Fig. 7E), and progenitor cells, which express Mash1 (Fig. 7D) and are preferentially located to the basal compartment of the epithelium. At E12.5, transcripts for both Plag-l2 (Fig. 7B) and Plag1 (Fig. 7C) were detected throughout the olfactory epithelium, suggesting that they are expressed in both progenitors and ORNs. By contrast, Zac1 transcripts were excluded from the olfactory epithelium but were detected in the underlying lamina propria, which is a non-neural tissue responsible for the secretion of mucus into the olfactory epithelium (Fig. 7A). Notably, at E12.5, Plag-l2 (Fig. 7B) and Plag1 (Fig. 7C) transcripts were also detected in the vomeronasal organ, an accessory olfactory system that also contains ORNs and is highly developed in rodents as it is responsible for the detection of pheromones.

thumbnail image

Figure 7. Plag-l2 and Plag1 are expressed in neural progenitors of the olfactory epithelium. A–E: In situ hybridization on E12.5 frontal sections through the olfactory system with RNA antisense probes for Zac1 (A), Plag-l2 (B), Plag1 (C), Mash1 (D), and SCG10 (E). F–H: RNA in situ hybridization on frontal sections through the E15.5 nasal cavity using Zac1 (F), Plag-l2 (G), and Plag1 (H) antisense probes. lp, lamina propria; oe, olfactory epithelium; re, respiratory epithelium; vno, vomeronasal organ.

Download figure to PowerPoint

By E15.5, the olfactory epithelium has further diversified and contains three cell types: the ORNS located in an intermediate position, the basal cells, which are the ORN progenitors, and a population of sustentacular or supporting cells that are non-neural. At E15.5, Zac1 was expressed in the surrounding lamina propria (Fig. 7F) while Plag-l2 (Fig. 7G) and, to a much lesser extent, Plag1 (Fig. 7H) transcripts were detected throughout the olfactory epithelium, with a notable concentration of transcripts in apical domains. Taken together, these data suggest that Plag1 and Plag-l2 might participate in the genesis of ORNs, with Plag1 likely playing a more important role at early stages of development, while Zac1 function is likely limited to a supporting role in the olfactory system.

Plag-l2 and Zac1 Are Expressed in Neuroendocrine and Exocrine Lineages, Respectively, in the Pancreas

The pancreas is comprised of both exocrine and endocrine cell lineages, which function to produce pancreatic digestive enzymes and endocrine hormones, respectively. Notably, several transcription factors that function in the specification of neuronal cell fates have been shown to also participate in the specification of cell fates in the pancreas [e.g., Pax6, Nkx2.2, Nkx6.1, Ngn3, NeuroD; (Cerf et al., 2005)]. We noted that Zac1 (Fig. 8A,J) and Plag-l2 (Fig. 8B,K) were expressed in the pancreas at E12.5, while Plag1 transcripts were not detected (Fig. 8C,L). Notably, Zac1 and Plag-l2 were expressed in a complementary manner, with Zac1 expressed in the exocrine pancreas, which accounts for 90% of the organ mass (Fig. 8A,J). In contrast, Plag-l2 transcripts were detected in the endocrine tissue of the Islets of Langerhans (Fig. 8B, K), which also expressed Ngn3 (Fig. 8E,M) (Gradwohl et al., 2000). It is particularly interesting that Zac1 was expressed in exocrine lineages in the pancreas, given that overexpression of Zac1 in humans due to a loss of maternal imprinting or duplication of the active paternal allele has been linked to transient neonatal diabetes mellitus, an endocrine disorder, suggesting a non-cell-autonomous role for Zac1 in the etiology of this disease (Gardner et al., 2000; Kamiya et al., 2000).

thumbnail image

Figure 8. Plag gene expression in the gut and pancreas. A–E: Expression of Zac1 (A), Plag-l2 (B), Plag1(C), Mash1 (D), and Ngn3 (E) in transverse sections through E12.5 embryos at the level of the midgut. F–I: Higher magnification images through the intestinal epithelium hybridized with Zac1 (F), Plag-l2 (G), Plag1 (H) and Mash1 (I) probes. Pancreas labeled with arrow in A. Arrowheads mark gaps in Zac1 expression in the presumptive myenteric plexus (arrowheads, F) that were matched by patches of Mash1 expression in enteric neuronal precursors (arrowheads, I). J–M: Higher magnification images through the pancreas hybridized with Zac1 (J), Plag-l2 (K), Plag1 (L), and Ngn3 (M) probes. Endocrine regions of the pancreas are marked with arrowheads in K and M. ag, adrenal gland; en, endocrine pancreas; ex, exocrine pancreas; g, gut; m, mucosa; my, myenteric plexus; p, pancreas; s, stomach.

Download figure to PowerPoint

Plag Genes Are Expressed in a Limited Number of PNS Lineages

Plag gene expression was not detected in most regions of the PNS that we surveyed. For instance, Plag transcripts were not detected in the sympathetic chain ganglia located on either side of the dorsal aorta (Fig. 5F–H), which were labeled by Mash1 and the panneuronal marker SCG10 in E12.5 transverse sections through the trunk (Fig. 5I,J). The dorsal root ganglia, which are comprised of sensory neurons, were clearly labeled by SCG10 in transverse sections through the E12.5 trunk (Fig. 5J), but did not express Zac1, Plag-l2, or Plag1 (Fig. 5F–H). Indeed, even in transverse sections through the E12.5 midgut, where Zac1 expression was detected at high levels in the outer mesenchyme of the intestinal epithelium where enteric neurons lie (Fig. 8A,F), there was an apparent exclusion of Zac1 transcripts from the presumptive myenteric plexus where SCG10-labeled neurons (data not shown) and their precursors, labeled by Mash1 (Fig. 8I), were located. Similarly, while Plag-l2 was expressed at high levels in the gut, it was restricted to the non-neural intestinal epithelium (Fig. 8B,G), and Plag1 transcripts were not detected above background levels in the intestinal mucosa or myenteric plexus (Fig. 8C,H). Finally, we examined whether Plag genes were expressed in the developing cranial sensory ganglia. Plag gene expression was not evident in the epibranchial placodes at E9.5, ectodermal thickenings that give rise to the distal VIIth, IXth, and Xth ganglia (Fig. 1A–C; data not shown). In E10.5 transverse sections, Plag-l2 transcripts were detected at low levels in the Vth, VII/VIIIth, IXth, and Xth cranial ganglia (data not shown), whereas Zac1 and Plag1 were not expressed in these structures, with the exception of a few scattered Zac1-expressing cells in the trigeminal (Vth) ganglion (data not shown). Plag family genes are thus expressed in a limited number of PNS lineages.

In summary, we describe here that Zac1, Plag-l2 and Plag1 are expressed in both overlapping and unique patterns in numerous regions of the CNS, as well as in a limited number of PNS, sensory, and neuroendocrine lineages. In addition to identifying regions of the developing nervous system where Plag genes might function, this study was also informative in other ways. First, Zac1 (e.g., telencephalon, spinal cord) and to a lesser extent Plag1 (e.g., telencephalon), displayed regionalized expression in the neural tube, a characteristic of several genes involved in the specification of distinct neuronal fates, providing an important clue as to how these genes might function. Second, in neural lineages where the Plag genes were expressed in postmitotic neurons, including the cerebellum and retina, Plag1 and Plag-l2 displayed similar expression profiles but were distinct from Zac1, consistent with a role for these genes in the specification and/or differentiation of distinct neuronal populations. Finally, in lineages such as the neocortex and olfactory epithelium, temporal differences in the cessation of gene expression were observed, with Plag1 displaying a tendency towards higher transcript levels at early versus late developmental stages, suggesting an earlier role for Plag1 in these lineages. Taken together, this study provides an important prelude to functional analyses of Plag gene function in the developing nervous system.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Animals and Tissue Preparation

Timed pregnant matings of CD-1 mice were set up, and embryos were staged using the day of the vaginal plug as embryonic day (E) 0.5. Embryos were fixed overnight in 4% paraformaldehyde (PFA)/1 × phosphate-buffered saline (PBS) at 4°C. For section RNA in situ hybridization, embryos were rinsed in PBS and transferred to 20% sucrose/1×PBS overnight at 4°C. Embryos were then embedded in OCT and 10-μm cryosections were cut. For wholemount RNA in situ hybridization, fixed embryos were transferred through an ascending methanol series (25, 50, 75, 100%) and then stored at −20°C.

Cloning of Plag1, Plag-l2, and Zac1

We cloned a partial fragment of Zac1 in a subtractive hybridization screen (Mattar et al., 2004). To clone the full coding sequence of Zac1, Plag1 and Plag-l2, cDNAs were amplified by PCR using an E13.5 mouse embryonic cDNA library (ResGen) as a template and using the following primers: Zac15″: AATCTAGACATGGCTCCATTCCG CTGTCA; Zac13″ primer: AATCTAGAATCTCCCACAAGAGAAGCACC. Plag1L: AATCTAGAGATGGCCACTGTCATTCCTGG; Plag1R: AATCTAGAGGCTACACA AGCACCTCGGGT; Plag-l2L: AATCTAGACATGACCACATTTTTCACCAG; Plag-l2R: AATCTAGACTGAGTTGGGGGACCTTCAT. Zac1 cDNA was cloned into the XbaI site of a pCS2-MT expression vector and Plag1 and Plag-l2 cDNA were cloned into the XbaI site of pBluescriptII-SK (Clontech, Palo Alto, CA).

Section RNA In Situ Hybridization

Digoxygenin (dig)-labeled RNA probes were generated using T3, T7, or SP6 RNA polymerases and a dig-RNA labeling mix (Roche). Riboprobes were generated using the cDNAs described above and, for Plag1 and Plag-l2, IMAGE clones (IMAGE ID 6328180 and 6405960, respectively) containing 3″UTRs were also used as templates. Zac1 antisense probe was generated with XhoI and T7 polymerase and sense probe with Sph1/SP6. Plag1 cDNA-template antisense probe was generated with ClaI and T3 polymerase and sense probe with Not1/T7, while IMAGE clone-template antisense probe was generated using EcoRV/T7 polymerase. Plag1 expression patterns were identical for both antisense probes. Plag-l2 cDNA ntisense probe was generated with Not1/T7 polymerase and sense probe with SmaI/T3, while IMAGE clone-template antisense probe was generated using SalI/T3 polymerase or EcoRI/T3 polymerase. Plag-l2 expression patterns were identical for all three antisense probes. Mash1 (Cau et al., 2000), Ngn2 (Gradwohl et al., 1996), Ngn3 (Gradwohl et al., 2000), Reelin (Ikeda and Terashima, 1997), and SCG10 (Stein et al., 1988) probes were previously described. RNA in situ hybridization was carried out on 10-μm cryostat sections and collected on Superfrost-plus glass slides (Fisher Scientific). Briefly, tissue sections were hybridized with 1 μl of dig-probe in 200 μl hybridization buffer [50% formamide, 10% dextran sulphate, 1 mg/ml yeast t-RNA, 1× Denhardt's, 1× salt (0.2M NaCl, 10 mM Tris-HCl, pH 7.5, 6.5 mM NaH2PO4.2H20, 5 mM Na2HPO4, 5 mM EDTA)] in a humidified chamber (50% formamide/1× salt) at 65°C overnight. Slides were then washed twice (1× SSC/50% formamide/0.1% tween 20) for 30 min at 65°C, followed by 2 room temperature washes in MABT (100 mM maleic acid, 150 mM NaCl, 0.1% tween 20; pH 7.5). Slides were then incubated in blocking solution (2% blocking reagent [Roche]; 20% normal goat serum; 1× MABT) for 1 hr at room temperature, and incubated with anti-dig alkaline phosphatase (AP)-conjugated antibody (Roche) diluted 1:2,500 in blocking solution overnight at room temperature. Slides were then washed 5 × 20 minutes in 1× MABT and 2 times in NTMT (100 mM NaCl, 50 mM MgCl2, 100 mM Tris-HCl, pH 9.5, 5 mM levamisole). Sections were stained in 0.33 mg/ml NBT (Roche) and 0.26 mg/ml BCIP (Roche) substrates in NTMT. After allowing the color to develop a sufficient time (2 hr to 3 days), sections were rinsed in water, allowed to air dry thoroughly, and mounted in Permount SP15-100 Toluene Solution (Fisher Scientific).

Wholemount RNA In Situ Hybridization

We followed a previously described protocol (Cohen et al., 1997) with the following modifications. Embryos were preblocked in 1% Blocking Reagent (Roche) in TBSTL at room temperature for 1–1.5 hr with rocking. After hybridization and washes with solutions 1 and 2, we performed an RNase A treatment step (100 μg/ml in Solution 2 at 37°C for 1 hr). The anti-dig-AP antibody was diluted 1:2,500 in 1% Blocking Reagent (Roche) in TBSTL at 4°C. Post-antibody treatment, embryos were washed four times in TBSTL at room temperature for 1 hr with rocking and then placed at 4°C overnight with rocking for two days. Color development times ranged from 2.5–10.5 hr.

Immunohistochemistry

Cryostat sections (10 μm) were cut and washed three times in 1× PBS to remove OCT. Sections were then blocked in 10% normal NGS/0.1% triton X-100/1× PBS for 1 hr at room temperature, followed by incubation with primary antibody diluted in blocking solution. The primary antibodies used were rabbit Zac1 (1/500 dilution, Spengler et al., 1997, mouse Pax6 (1/4 dilution, mouse monoclonal, Developmental studies hybridoma bank), and mouse TuJ1 (1/1,000 dilution, Covance). Sections were washed three times in 1× PBS/0.1% triton X-100 (1× PBT) and then incubated for 1 hr at room temperature with secondary antibody diluted in 1× PBT. Secondary antibodies used were donkey anti mouse-Cy3 (1/500 dilution, Jackson Immunoresearch Laboratories, West Grove, PA) and goat anti rabbit-Alexa488 (1/500 dilution, Molecular Probes, Eugene, OR). Sections were washed three times in 1× PBT, counterstained with DAPI (1/10,000 dilution in 1× PBS) for 5 min, washed three times in 1× PBS, and mounted with Aqua Polymount (Polysciences, Inc., Warrington, PA).

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We thank Pierre Mattar for critical reading of the manuscript, Natalia Klenin for assistance with RNA in situ hybridization, Cairine Logan for advice on cranial ganglia, and Laurent Journot for kindly providing Zac1 antisera. C.S. is a Canadian Institutes of Health Research (CIHR) New Investigator and Alberta Heritage Foundation for Medical Research (AHFMR) Scholar. This work was supported by CIHR operating grant MOP-44094 to C.S. L.M. was supported by a CIHR training grant.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES
  • Abdollahi A, Godwin AK, Miller PD, Getts LA, Schultz DC, Taguchi T, Testa JR, Hamilton TC. 1997. Identification of a gene containing zinc-finger motifs based on lost expression in malignantly transformed rat ovarian surface epithelial cells. Cancer Res 57: 20292034.
  • Abdollahi A, Pisarcik D, Roberts D, Weinstein J, Cairns P, Hamilton TC. 2003. LOT1 (PLAGL1/ZAC1), the candidate tumor suppressor gene at chromosome 6q24–25, is epigenetically regulated in cancer. J Biol Chem 278: 60416049.
  • Bilanges B, Varrault A, Mazumdar A, Pantaloni C, Hoffmann A, Bockaert J, Spengler D, Journot L. 2001. Alternative splicing of the imprinted candidate tumor suppressor gene ZAC regulates its antiproliferative and DNA binding activities. Oncogene 20: 12461253.
  • Cau E, Gradwohl G, Fode C, Guillemot F. 1997. Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors. Development 124: 16111621.
  • Cau E, Gradwohl G, Casarosa S, Kageyama R, Guillemot F. 2000. Hes genes regulate sequential stages of neurogenesis in the olfactory epithelium. Development 127: 23232332.
  • Caviness VS Jr. 1982. Neocortical histogenesis in normal and reeler mice: a developmental study based upon [3H]thymidine autoradiography. Brain Res 256: 293302.
  • Caviness VS Jr, Takahashi T, Nowakowski RS. 1995. Numbers, time and neocortical neuronogenesis: a general developmental and evolutionary model. Trends Neurosci 18: 379383.
  • Cerf ME, Muller CJ, Du Toit DF, Louw J, Wolfe-Coote SA. 2005. Transcription factors, pancreatic development, and beta-cell maintenance. Biochem Biophys Res Commun 326: 699702.
  • Chizhikov V, Millen KJ. 2003. Development and malformations of the cerebellum in mice. Mol Genet Metab 80: 5465.
  • Ciani E, Frenquelli M, Contestabile A. 2003. Developmental expression of the cell cycle and apoptosis controlling gene, Lot1, in the rat cerebellum and in cultures of cerebellar granule cells. Brain Res Dev Brain Res 142: 193202.
  • Cohen B, Bashirullah A, Dagnino L, Campbell C, Fisher WW, Leow CC, Whiting E, Ryan D, Zinyk D, Boulianne G, Hui CC, Gallie B, Phillips RA, Lipshitz HD, Egan SE. 1997. Fringe boundaries coincide with Notch-dependent patterning centres in mammals and alter Notch-dependent development in Drosophila. Nat Genet 16: 283288.
  • Fode C, Ma Q, Casarosa S, Ang SL, Anderson DJ, Guillemot F. 2000. A role for neural determination genes in specifying the dorsoventral identity of telencephalic neurons. Genes Dev 14: 6780.
  • Furukawa T, Adachi Y, Fujisawa J, Kambe T, Yamaguchi-Iwai Y, Sasaki R, Kuwahara J, Ikehara S, Tokunaga R, Taketani S. 2001. Involvement of PLAGL2 in activation of iron deficient- and hypoxia-induced gene expression in mouse cell lines. Oncogene 20: 47184727.
  • Gardner RJ, Mackay DJ, Mungall AJ, Polychronakos C, Siebert R, Shield JP, Temple IK, Robinson DO. 2000. An imprinted locus associated with transient neonatal diabetes mellitus. Hum Mol Genet 9: 589596.
  • Gradwohl G, Fode C, Guillemot F. 1996. Restricted expression of a novel murine atonal-related bHLH protein in undifferentiated neural precursors. Dev Biol 180: 227241.
  • Gradwohl G, Dierich A, LeMeur M, Guillemot F. 2000. neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97: 16071611.
  • Grove EA, Tole S, Limon J, Yip L, Ragsdale CW. 1998. The hem of the embryonic cerebral cortex is defined by the expression of multiple Wnt genes and is compromised in Gli3-deficient mice. Development 125: 23152325.
  • Hensen K, Van Valckenborgh IC, Kas K, Van de Ven WJ, Voz ML. 2002. The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities. Cancer Res 62: 15101517.
  • Hensen K, Braem C, Declercq J, Van Dyck F, Dewerchin M, Fiette L, Denef C, Van de Ven WJ. 2004. Targeted disruption of the murine Plag1 proto-oncogene causes growth retardation and reduced fertility. Dev Growth Differ 46: 459470.
  • Hibbard MK, Kozakewich HP, Dal Cin P, Sciot R, Tan X, Xiao S, Fletcher JA. 2000. PLAG1 fusion oncogenes in lipoblastoma. Cancer Res 60: 48694872.
  • Ikeda Y, Terashima T. 1997. Expression of reelin, the gene responsible for the reeler mutation, in embryonic development and adulthood in the mouse. Dev Dyn 210: 157172.
  • Kamiya M, Judson H, Okazaki Y, Kusakabe M, Muramatsu M, Takada S, Takagi N, Arima T, Wake N, Kamimura K, Satomura K, Hermann R, Bonthron DT, Hayashizaki Y. 2000. The cell cycle control gene ZAC/PLAGL1 is imprinted: a strong candidate gene for transient neonatal diabetes. Hum Mol Genet 9: 453460.
  • Kas K, Voz ML, Roijer E, Astrom AK, Meyen E, Stenman G, Van de Ven WJ. 1997. Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Nat Genet 15: 170174.
  • Kas K, Voz ML, Hensen K, Meyen E, Van de Ven WJ. 1998. Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J Biol Chem 273: 2302623032.
  • Koy S, Hauses M, Appelt H, Friedrich K, Schackert HK, Eckelt U. 2004. Loss of expression of ZAC/LOT1 in squamous cell carcinomas of head and neck. Head Neck 26: 338344.
  • Mattar P, Britz O, Johannes C, Nieto M, Ma L, Rebeyka A, Klenin N, Polleux F, Guillemot F, Schuurmans C. 2004. A screen for downstream effectors of Neurogenin2 in the embryonic neocortex. Dev Biol 273: 373389.
  • Monuki ES, Porter FD, Walsh CA. 2001. Patterning of the dorsal telencephalon and cerebral cortex by a roof plate-Lhx2 pathway. Neuron 32: 591604.
  • Pagotto U, Arzberger T, Theodoropoulou M, Grubler Y, Pantaloni C, Saeger W, Losa M, Journot L, Stalla GK, Spengler D. 2000. The expression of the antiproliferative gene ZAC is lost or highly reduced in nonfunctioning pituitary adenomas. Cancer Res 60: 67946799.
  • Piras G, El Kharroubi A, Kozlov S, Escalante-Alcalde D, Hernandez L, Copeland NG, Gilbert DJ, Jenkins NA, Stewart CL. 2000. Zac1 (Lot1), a potential tumor suppressor gene, and the gene for epsilon-sarcoglycan are maternally imprinted genes: identification by a subtractive screen of novel uniparental fibroblast lines. Mol Cell Biol 20: 33083315.
  • Schuurmans C, Armant O, Nieto M, Stenman JM, Britz O, Klenin N, Brown C, Langevin LM, Seibt J, Tang H, Cunningham JM, Dyck R, Walsh C, Campbell K, Polleux F, Guillemot F. 2004. Sequential phases of cortical specification involve Neurogenin-dependent and -independent pathways. Embo J 23: 28922902.
  • Shimogori T, Banuchi V, Ng HY, Strauss JB, Grove EA. 2004. Embryonic signaling centers expressing BMP, WNT and FGF proteins interact to pattern the cerebral cortex. Development 131: 56395647.
  • Smart IH. 1976. A pilot study of cell production by the ganglionic eminences of the developing mouse brain. J Anat 121: 7184.
  • Smith RJ, Arnaud P, Konfortova G, Dean WL, Beechey CV, Kelsey G. 2002. The mouse Zac1 locus: basis for imprinting and comparison with human ZAC. Gene 292: 101112.
  • Spengler D, Villalba M, Hoffmann A, Pantaloni C, Houssami S, Bockaert J, Journot L. 1997. Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. Embo J 16: 28142825.
  • Stein R, Orit S, Anderson DJ. 1988. The induction of a neural-specific gene, SCG10, by nerve growth factor in PC12 cells is transcriptional, protein synthesis dependent, and glucocorticoid inhibitable. Dev Biol 127: 316325.
  • Takahashi T, Goto T, Miyama S, Nowakowski RS, Caviness VS, Jr. 1999. Sequence of neuron origin and neocortical laminar fate: relation to cell cycle of origin in the developing murine cerebral wall. J Neurosci 19: 1035710371.
  • Tanabe Y, Jessell TM. 1996. Diversity and pattern in the developing spinal cord. Science 274: 11151123.
  • Tarabykin V, Stoykova A, Usman N, Gruss P. 2001. Cortical upper layer neurons derive from the subventricular zone as indicated by Svet1 gene expression. Development 128: 19831993.
  • Tole S, Remedios R, Saha B, Stoykova A. 2005. Selective requirement of Pax6, but not Emx2, in the specification and development of several nuclei of the amygdaloid complex. J Neurosci 25: 27532760.
  • Tsuda T, Markova D, Wang H, Evangelisti L, Pan TC, Chu ML. 2004. Zinc finger protein Zac1 is expressed in chondrogenic sites of the mouse. Dev Dyn 229: 340348.
  • Valente T, Auladell C. 2001. Expression pattern of Zac1 mouse gene, a new zinc-finger protein that regulates apoptosis and cellular cycle arrest, in both adult brain and along development. Mech Dev 108: 207211.
  • Valente T, Junyent F, Auladell C. 2005. Zac1 is expressed in progenitor/stem cells of the neuroectoderm and mesoderm during embryogenesis: differential phenotype of the Zac1-expressing cells during development. Dev Dyn 233: 667679.
  • Wawersik S, Maas RL. 2000. Vertebrate eye development as modeled in Drosophila. Hum Mol Genet 9: 917925.