SEARCH

SEARCH BY CITATION

Keywords:

  • chick;
  • PINCH-1;
  • LIM domain;
  • heart development;
  • cardiac neural crest;
  • cardiac outflow tract;
  • lung;
  • liver;
  • mesonephros;
  • vertebrae;
  • muscle

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The invasion of the cardiac neural crest (CNC) into the outflow tract (OFT) and subsequent OFT septation are critical events during vertebrate heart development. We previously had performed four modified differential display (DD) screens in the chick embryo to identify genes that may be involved in CNC and heart development. Full-length sequence of one of the DD clones has been obtained and identified as chick PINCH-1. This particularly interesting new cysteine-histidine–rich protein contains five protein-binding LIM domains (five double zinc fingers), a nuclear localization signal, and a nuclear export signal, allowing it to participate in integrin and growth factor signaling and possibly act as a transcription factor. We show here for the first time that chick PINCH-1 is expressed in neural crest cells, both in the neural fold and cardiac OFT, and is also expressed in mesoderm derived-structures, including the myocardium, during avian embryogenesis. The normal expression pattern and overexpression in neural crest cell explants suggest that PINCH-1 may be a regulator of neural crest cell adhesion and migration. Developmental Dynamics 235:152–162, 2006. © 2005 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The cardiac neural crest (CNC) is an extracardiac population of cells that arise from the neural tube in the region of the first three somites up to the mid-otic placode level, which corresponds to rhombomeres 6, 7, and 8 (Kirby, 2002). These cells migrate into the pharyngeal arches and then to the heart where they participate in outflow tract (OFT) septation and cardiac innervation (Kirby et al., 1983; Kirby and Stewart, 1983; Kirby, 1988, 1989). Little is known about how the behavior of CNC cells is determined or regulated. We recently completed modified differential display screens of the heart and neural crest to rapidly and inexpensively identify genes involved in CNC and heart development (Martinsen et al., 2003). We have identified differential display clone 25.26 as PINCH-1 and present here the full-length sequence and expression pattern during avian embryonic development, with an emphasis on its distribution in the neural crest and developing heart.

Signals from the extracellular matrix (ECM) and growth factors are known to regulate a variety of cellular processes, including shape changes, migration, proliferation, differentiation, and survival. Cellular and ECM contact is mediated by transmembrane cell adhesion receptors, including integrins. Integrin-linked kinase (ILK) and PINCH-1 (particularly interesting new cysteine-histidine–rich protein) form an ILK-PINCH-1 complex present at focal adhesions during cell adhesion and growth factor signal transduction (Tu et al., 1999; Wu, 1999). PINCH-1, originally identified by Rearden (1994), contains five LIM domains and is the largest member of the LIM family (Wang-Rodriguez et al., 2002). The LIM domain is a protein-binding motif consisting of a cysteine-rich consensus sequence of approximately 50 residues that form two separate zinc fingers (Dawid et al., 1998; Yao et al., 1999). The LIM family is so named because it was described originally in the Lin-11, Isl-1, and Mec-3 proteins (Wang-Rodriguez et al., 2002). A mouse Isl-1 mutation results in embryonic hearts lacking the OFT, right ventricle, and much of the atria (Cai et al., 2003). A recently identified novel LIM protein, Cal, has been shown to bind the cardiac transcription factor NKX2.5 and coexpression of Cal and NKX2.5 enhances activation of the atrial natriuretic peptide promoter (Akazawa et al., 2004). This finding provides evidence that members of the LIM family may be important for normal cardiovascular development.

PINCH-1 protein structure and function is conserved across many species, including chick, human, mouse, zebrafish, Drosophila, and Caenorhabditis elegans. This finding suggests a crucial role for PINCH-1 in fundamental cellular processes. The C. elegans PINCH homologue (unc-97) is required for muscle attachment, assembly, and proprioceptive neuronal function (Hobert et al., 1999; Wu, 1999). Homozygous mutations of unc-97 result in embryonic death (Hobert et al, 1999). Homozygous nonfunctional mutations in the Drosophila PINCH homologue, steamer duck (stck), result in 85% embryonic mortality, and all of the hatched embryos die within 24 hr (Clark et al., 2003). PINCH-1 is expressed in early mouse embryos and a homozygous null mutation of the PINCH-1 gene is embryonic lethal (Liang et al., 2005). Despite a putative role in cardiomyocyte survival (Bock-Marquette et al., 2004), targeted deletion of PINCH-1 in cardiomyocytes did not result in detectable cardiac anomalies (Liang et al., 2005). This finding does not rule out a role for PINCH-1 in regulating the contribution of noncardiomyocyte cell populations, including neural crest, to normal heart development.

In addition to its function in cell–cell and cell–matrix interactions, PINCH-1 may also regulate transcription. Confocal microscopy of primary and transformed rat Schwann cells localized PINCH-1 to cytoplasmic, perinuclear, and nuclear areas (Campana et al., 2003). PINCH-1 sequence does contain a putative leucine-rich nuclear export signal (NES) and an overlapping basic nuclear localization signal (NLS), allowing PINCH-1 to act as an abundant shuttling/signaling protein (Campana et al., 2003). Movement of PINCH-1 between the nucleus and the cytoplasmic membrane suggests that PINCH-1 may participate in the control of gene transcription and/or initiate new protein–protein interactions required for activation of cell-specific processes (Campana et al., 2003).

The data presented in this manuscript show for the first time that chick CNC and CNC-derived cells in the developing cardiac OFT express PINCH-1, supporting a role for PINCH-1 in cardiovascular development. We also found that chick PINCH-1 is expressed in other mesoderm-derived structures, including myocardium, somites, smooth muscle cells of the lung buds, muscle cells of the limbs and lateral body wall, sclerotomal condensation of the forming vertebral body, liver, and mesonephros. Based on these data, we expect that developing a mechanistic understanding of PINCH-1 and identifying its binding partners will help elucidate the mechanisms by which cellular-ECM adhesion complexes form and contribute to the regulation of cell behavior during organogenesis, including the CNC cell contribution to normal heart development.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Isolation and Structure of Chick PINCH-1

BLAST search with clone 25.26 sequence (Martinsen et al., 2003) resulted in mouse PINCH-1 sequence and subsequent BLAST analysis of chick expressed sequence tag databases (www.chick.umist.ac.uk and www.chickest.udel.edu) using mouse PINCH-1 sequence revealed three overlapping cDNA sequences (accession nos. AJ456621, BU490370, and BU476868), which cover the complete open reading frame (ORF) of chick PINCH-1. The complete ORF PINCH-1 cDNA was obtained by using reverse transcriptase-polymerase chain reaction (RT-PCR). Sequence analysis of several clones led to the identification of chick PINCH-1 gene (GenBank accession no. AY612853). The deduced amino acid sequence of the chick PINCH-1 protein is 326 residues long (Fig. 1). Phylogenetic analysis was performed and revealed the grouping of chick PINCH-1 with its human and mouse PINCH-1 counterparts, which is consistent with the sequence comparison (Figs. 1, 2A). The protein sequence of chick PINCH-1 has a 96% similarity to human PINCH-1 and 95.4% similarity to mouse PINCH-1, whereas the similarity to human PINCH-2 (83.7%) and mouse PINCH-2 (82.5%) is lower (Fig. 2B). In addition, a chick karyotype (by means of the Ensemble Chicken Genome Server at www.ensembl.org/Gallus_gallus) revealed that chick PINCH-1 is located on chromosome number 1.

thumbnail image

Figure 1. A: Amino acid sequence comparison of chick PINCH-1 (particularly interesting new cysteine-histidine–rich protein; GenBank accession no. AY612853) with human PINCH-1 (GenBank accession no. U09284.2), mouse PINCH-1 (GenBank accession no. AK082932.1), human PINCH-2 (GenBank accession no. AF484961.1), mouse PINCH-2 (GenBank accession no. NM144862.1), zebrafish PINCH (GenBank accession no. BC065908), Drosophila PINCH (GenBank accession no. AF078907.1), and Caenorhabditis elegans PINCH (GenBank accession no. NM076542.3). Alignment of the deduced amino acid sequences was completed using the MegAlign program (DNASTAR). Color bar above the sequence is a strength histogram that denotes the least conserved to most conserved amino acids (least - dark blue, light blue, green, orange, red - most). The different colored amino acids represent divergence in amino acid sequence. The LIM domains and nuclear export/localization signals are also shown. NES, nuclear export signal; NLS, nuclear localization signal.

Download figure to PowerPoint

thumbnail image

Figure 2. A: A Phylogenetic tree illustrating the relationship between chick PINCH-1 (particularly interesting new cysteine-histidine–rich protein) and other PINCH-1 proteins. Using the protein sequences listed in Figure 1A, a tree was prepared with the Clustal method with a PAM250 residue weight table (DNASTAR). The scale bar measures the distance between the sequences. Units indicate the number of substitution events. B: Sequence distances table comparing percentage divergence versus percentage similarity using sequences listed in Figure 1A.

Download figure to PowerPoint

The protein structure of chick PINCH-1 is consistent with PINCH-1 proteins in other species. Chick PINCH-1 contains five LIM domains (Fig. 1), each consisting of a cysteine-rich consensus sequence of approximately 50 residues that form the two separate zinc fingers (Dawid et al., 1998; Yao et al., 1999). Chick PINCH-1 sequence also contains a putative leucine-rich NES and an overlapping basic nuclear localization signal (NLS; Fig. 1; Campana et al., 2003). Movement of PINCH-1 between the nucleus and the cytoplasm suggests that PINCH-1 may participate in the control of gene transcription and/or initiate new protein–protein interactions required for activation of specific processes such as cell migration (Campana et al., 2003).

Each PINCH-1 LIM domain has very specific protein–protein binding properties. For example, only the second zinc finger of the first LIM domain of PINCH-1 (Fig. 1) is required for interaction with the N-terminal ANK-repeat domain of ILK (Li et al., 1999). Of interest, none of the other PINCH-1 LIM domains (LIM2, LIM3, LIM4, or LIM5) or LIM domains from other proteins, including paxillin and zyxin, recognize the ILK ANK repeats (Tu et al., 1998). The other PINCH-1 LIM domains could potentially mediate independent protein–protein interactions and, thus, additional PINCH-binding proteins may exist (Wu, 1999). To date only one other protein, Nck-2, is known to bind to PINCH-1, and it specifically binds the PINCH-1 LIM4 domain (Tu et al., 1998; Velyvis et al., 2003). Our amino acid sequence analysis indicates that the LIM4 domain is the most conserved among the five different LIM domains (Fig. 1, colored bar strength histogram). Nck-2 contains three N-terminal SH3 domains and one C-terminal SH2 domain, and it is the third SH3 region that binds to PINCH-1. Nck-2 interacts with the epidermal growth factor receptor, the platelet-derived growth factor receptor, IRS-1 (insulin receptor substrate), and P21 (cdc42/rac)-activated kinase and Sos, which are crucial in growth factor and small GTPase signaling (Tu et al., 1998). Thus, PINCH-1 could mediate the formation of complexes between ILK and Nck-2 (Tu et al., 1999) and provide a physical connection between the integrin/ILK signaling pathway and growth factor or small GTPase-signaling pathways. PINCH-1 has been identified recently as a binding partner of thymosin β4 in a PINCH-1/ILK/thymosin β4 complex (Bock-Marquette et al., 2004). Addition of thymosin β4 to myocardial cell culture increased ILK expression and promoted cell survival, whereas inhibition of ILK reduced cell migration. This finding adds to the evidence that suggests that PINCH-1 may act as a modulator of ECM and intracellular signaling interactions, thereby regulating cell behavior during development.

Expression of PINCH-1 During Early Embryogenesis

The developmental expression pattern of PINCH-1 was evaluated in chick embryos ranging from Hamburger and Hamilton (HH) stage 8 (4–6 somites) to HH stage 35 (8–9 days). PINCH-1 is expressed in the neural folds of a five-somite embryo (Fig. 3A,B). However, by the eight-somite stage, expression is absent in regions where the neural folds are fusing and neural crest cell emigration has commenced (Fig. 3C,D). PINCH-1 is also absent in the region of migrating neural crest cells (Fig. 3D). PINCH-1 is then re-expressed in the neural folds at approximately the time neural crest cells have stopped emigrating from the neural tube (Fig. 3D,E; staging of CNC migration reviewed by Martinsen, 2005). In addition, there is expression of PINCH-1 in the branchial arches as CNC cells begin to populate this region at HH stage 17–18 (Fig. 3F,G) and at HH stage 21 (Fig. 3H,K; Waldo et al., 1996, 1999; Martinsen, 2005). CNC cells reach the OFT by 3.5 to 4 days (HH stage 21–23; Waldo et al., 1998; Farrell et al., 1999; Kirby, 2002). PINCH-1 expression in the cardiac OFT at this time has a two-pronged appearance suggestive of expression in streams of CNC during OFT septation (Fig. 3J). A sagittal section through the OFT at HH stage 20–21 reveals expression of PINCH-1 in the dorsal wall (splanchnic mesoderm) of the pericardial cavity and the caudal limb of dorsal mesocardium, which has continuous expression in the myocardium of the OFT (Fig. 3I). This region is considered the “secondary heart field” during accretion of myocardium onto the OFT (Waldo et al., 2001, 2005; Martinsen, 2005). By embryonic day 6.5, PINCH-1 is highly expressed in the septating OFT and the undifferentiated vascular walls of the aorta and pulmonary vessels (Fig. 3L,M), as well as the lateral body wall (Fig. 3L). At day 8 and 9, there is strong expression of PINCH-1 in the myocardium, both in the compact layer and myocardial trabeculations (Fig. 3N,O). This finding is consistent with the myocardial expression of thymosin β4, a newly identified PINCH-1/ILK binding partner that has been implicated in cardiac cell survival (Bock-Marquette et al., 2004). Of interest, we also see a shift of PINCH-1 expression in the OFT region at HH stage 22 (Fig. 3L,M) to the right ventricular conus by day 8–9 (Fig. 3N). Most of the CNC undergoes cell death in the OFT and condenses into a wedge at the level of the right ventricular conus. The continued expression in these cells may also provide evidence that PINCH-1 also acts to promote cell survival as described above (Bock-Marquette et al., 2004).

thumbnail image

Figure 3. PINCH-1 gene expression during neural crest and heart development. A: Dorsal view of a five-somite (5s) stage embryo showing expression of PINCH-1 (particularly interesting new cysteine-histidine–rich protein; purple) in the neural folds. B: The sagittal section through the neural folds of the embryo shown in A reveals high expression of PINCH-1 in the dorsal neural folds and ectoderm. C–E: Dorsal views of 8s (C), 9–10s (D), and 16s (E) stage embryos. Yellow arrows denote down-regulation of PINCH-1 in regions of the neural tube as neural crest cells begin to emigrate from the neural tube. Blue arrows denote the subsequent up-regulation of PINCH-1 once neural crest cell emigration is complete. Yellow arrowheads denote the region of migrating neural crest cells that are not expressing PINCH-1. F: Right lateral view of a Hamburger and Hamilton (HH) stage 17–18 embryo showing expression of PINCH-1 in the branchial arches (BA and red arrow). G: The sagittal section through the embryo shown in F indicates that PINCH-1 is expressed in the neural crest-derived mesenchyme of the branchial arches (red arrow). H: Right lateral view of a HH stage 21 embryo, showing more restricted expression of PINCH-1 in the branchial arches (red arrow). I: The sagittal section through the heart of an HH stage 20–21 embryo reveals expression of PINCH-1 in the splanchnic mesoderm (SM) of the secondary heart field with continued expression in the caudal limb of the dorsal mesocardium (DM) and myocardium (M) of the outflow tract. J: High-power view of the expression of PINCH-1 in the developing outflow tract at HH stage 22–23 (OFT, red arrow). K: High-power ventral view of the developing branchial arches (BA) with strong expression of PINCH-1 at their leading edges. L: This day 6.5 embryo shows strong expression of PINCH-1 in the lateral body wall (red arrowheads), as well as in the developing outflow tract (OFT, red arrow). Also, PINCH-1 expression is starting to increase in the atria and atrioventricular groove (black arrow heads). M: Sagittal section of the day 6.5 embryo shown in L. Expression of PINCH-1 can be seen in the developing pulmonary artery (P, red arrow) and aorta (Ao). Early expression can be seen in the atrioventricular groove and atria (black arrowheads). N,O: High-power view of a day 8–9 heart (N) and a cross-section of the ventricle (O) of the heart shown in N reveals strong expression of PINCH-1 within the compact myocardium (CM) and trabeculating (T) myocardium (red arrow). L–N: Also note the shift of PINCH-1 expression in the outflow tract region at HH stage 22 (L,M) to the right ventricular conus by day 8–9 (N, red arrowhead). A, atria; Ao, aorta; E, eye; ep, epicardium; H, heart; IFT, inflow tract; O, otic vesicle; P, pulmonary vessel; PC, pericardium; Sub-ep, subepicardium; T, trabeculating myocardium; V, ventricle. Black and white scale bars = 200 μm.

Download figure to PowerPoint

CNC-Derived Cells in the Developing OFT Express Chick PINCH-1

Expression of PINCH-1 in the branchial arches and cardiac OFT suggests the possibility that PINCH-1 expression in these structures is related to cells derived from the CNC. Unilateral quail–chick CNC chimeras were used to determine whether PINCH-1 is expressed in CNC cells of the developing OFT. Figure 4 shows PINCH-1 gene expression in CNC cells at three different sagittal levels of a day 6.5 quail–chick CNC chimeric heart. These results show for the first time that chick PINCH-1 is expressed in CNC-derived cells in the developing OFT.

thumbnail image

Figure 4. Cardiac neural crest (CNC) -derived cells in the septating outflow tract express chick PINCH-1 (particularly interesting new cysteine-histidine–rich protein). QCPN (quail nuclei marker) and chick PINCH-1 gene expression are shown on the same sections through three different sagittal levels of a chick host heart collected at day 6.5 (A–L). A,B,E,F,I,J: PINCH-1 (blue) is expressed in the aortic (Ao) and pulmonary (P) vessel walls and the CNC cells of the forming aorticopulmonary septum (APS) of the outflow tract (OFT, red arrows). C,K: QCPN (red) marks quail CNC grafted cells in the aortic and pulmonary (P) vessel walls and the CNC cells of the forming APS of the septating outflow tract (OFT, white arrows). D,G,H,L: Merged images of PINCH-1 (blue) and QCPN (red) immunostaining of the same section show overlapping expression (white arrows and arrowheads). H: A higher power view of the pulmonary vessel wall (denoted by a small white dashed box in D) shows individual quail (red) CNC cells expressing PINCH-1 (white arrowheads). Black dashed box in A, region of higher power view shown in B, C, and D; white dashed box in D, region of higher power view shown in H; Black dashed box in E, region of higher power view shown in F and G; black dashed box in I, region of higher power view shown in J, K, and L; OFT, outflow tract; PC, pericardium; A, atrium; V, ventricle; P, pulmonary vessel; APS, aorticopulmonary septum; CNC, cardiac neural crest cells; PINCH-1, PINCH-1 gene expression; QCPN, quail nuclei marker; QCPN/PINCH-1 merged fluorescent and brightfield. Black and white scale bars = 200 μm. Red scale bar = 20 μm.

Download figure to PowerPoint

PINCH-1 is strongly expressed in both the aortic (Ao) and pulmonary (P) vessel walls of the septating OFT (Fig. 4A,B,I,J) and the CNC cells of the forming aorticopulmonary septum (APS; Fig. 4E,F). QCPN marks the perinuclear membrane of quail CNC grafted cells that have migrated and are now located in the aortic and pulmonary vessels (Fig. 4C,K), as well as in the APS (Fig. 4G). It is possible that some host (chick) neural crest cells also populate these regions and are unmarked. Merged images of PINCH-1 gene expression and QCPN immunofluorescent staining of the same section show expression of PINCH-1 in the cytoplasm of QCPN-labeled CNC cells (Fig. 4D,G,H,L). A higher power view of the pulmonary vessel wall shows individual quail CNC cells expressing chick PINCH-1 (Fig. 4H), indicating that at least a subset of PINCH-1 expressing cells in OFT are CNC derived.

Expression of PINCH-1 in CNC cells suggests a possible role for PINCH-1 in neural crest cell migration and/or their survival in the cardiovascular system. It is known that alteration of PINCH-1 binding activity by mutagenesis results in improper localization of ILK to focal adhesions and subsequent inhibition of cell spreading and motility (Li et al., 1999). PINCH-1 may also regulate nuclear translocation of β-catenin and subsequent gene expression by means of its binding with ILK. It has been shown that overexpression of ILK promotes translocation of β-catenin to the nucleus and formation of β-catenin-LEF-1 complexes (Novak et al., 1998), which influence the expression of LEF-1/β-catenin–responsive genes, which may effect neural crest cell migration (Novak et al., 1998). PINCH-1 and ILK are also required for activating phosphorylation of protein kinase B (PKB/Akt), an important signaling intermediate of the survival pathway. Depletion of PINCH-1 or ILK results in a dramatic increase in apoptosis, whereas increased levels enhance myocardial cell survival in culture (Bock-Marquette et al., 2004) or result in oncogenic transformation (Fukuda et al., 2003). Thus, normal expression of PINCH-1 may protect cells from apoptosis. Currently, very little is known about the molecular regulation of apoptosis in the developing cardiovascular system, and more work is needed to determine whether specific cardiac cells have a genetically determined susceptibility to apoptosis that is regulated by pro- and antiapoptotic factors (Fisher et al., 2000). It is conceivable that PINCH-1 may help to regulate the timing of CNC cell apoptosis within the developing cardiovascular system.

Overexpression of PINCH-1 Blocks Neural Crest Cell Migration

The PINCH/ILK complex has been implicated in cell migration (Bock-Marquette et al., 2004). To determine the effect of PINCH-1 overexpression on neural crest cell migration, we electroporated neural fold explants containing premigratory neural crest cells with a bicistronic construct containing chick PINCH-1 and enhanced green fluorescent protein (EGFP) behind a chick beta-actin promoter with a CMV enhancer (Swartz et al., 2001; Chen et al., 2004). Neural fold explants have been used previously to study migration of normal and treated neural crest cells (Boot et al., 2003a, b). Neural crest cells electroporated with the PINCH-1 overexpression construct at stage 9 are EGFP-positive and fail to migrate away from the explant after 48 hr (Fig. 5A,C). The PINCH-1–overexpressing cells also failed to express HNK-1, a marker of migratory neural crest cells (Martinsen and Bronner-Fraser, 1998; Fig. 5B,C). In neural crest cell explants electroporated at stage 10 (Fig. 5D–F), the vast majority of cells show a similar pattern to the neural crest cells explanted earlier; however, a subset of PINCH-1–expressing cells on the left side of the explant shown in Figure 5D–F (white arrow head) migrate a short distance, likely before significant levels of PINCH-1 protein have accumulated in the cell. These cells express PINCH-1/EGFP and fail to express HNK-1 (Fig. 5E,F) at 48 hr, suggesting they are no longer migratory. In contrast, non–PINCH-1/EGFP-expressing cells on the right side of the explant have migrated away from the explant and continue to express HNK-1 (Fig. 5E,F,H,I). There are a small number of cells at the center of the explant electroporated at stage 10 (Fig. 5F, white asterisk) that express both PINCH-1/EGFP and HNK-1. These cells may be neural crest cells that have not yet down-regulated HNK-1 or, alternatively, other nonmigratory cell types that express HNK-1 (i.e., neuronal cells) that may have been electroporated with the overexpression construct. Further analysis will be required to determine the exact nature of these cells; however, they are few in number and do not occur in explants electroporated at premigratory stages. In summary, the vast majority of PINCH-1/EGFP overexpressing neural crest cells fail to migrate. Cells electroporated with the control vector containing EGFP only migrate away from the explant normally and express HNK-1 (Fig. 5J–L). These data suggest that overexpression of PINCH-1 protein inhibits neural crest cell migration, at least in this in vitro system.

thumbnail image

Figure 5. PINCH-1 (particularly interesting new cysteine-histidine–rich protein) overexpression in the cardiac neural folds blocks neural crest cell migration. A–L: A 48-hr in vitro culture of cardiac neural crest explants in which the neural folds had been electroporated 48 hr prior at Hamburger and Hamiltom (HH) stage 9 (A–C) and at HH stage 10 (D–I) with PINCH-1 PMES-EGFP (n = 12) or CONTROL PMES-EGFP (n = 12; J–L) and then subsequently stained with HNK-1. White arrows denote PINCH-1–expressing cells that fail to migrate. White arrowheads denote PINCH-1–expressing cells that initially migrated but stopped migrating, resulting in no HNK-1 expression. Yellow arrows denote migrating neural crest cells (HNK-1 positive, red) not transfected with PINCH-1. White dashed box in F, region of higher power view shown in G,H,I; white dashed box in the low power inlay of the control explant in J and K, region of higher power view shown in J, K, and L; EGFP, enhanced green fluorescent protein; HNK-1 (red), marker of migrating neural crest cells; EGFP/HNK-1, merged. F: The white asterisk denotes a small number of cells at the center of the explant that express both PINCH-1/EGFP and HNK-1. These cells may be neural crest cells that have not yet down-regulated HNK-1 or, alternatively, other nonmigratory cell types that express HNK-1 (i.e., neuronal cells) that may have been electroporated with the overexpression construct. White scale bars = 200 μm.

Download figure to PowerPoint

Expression of PINCH-1 in Mesoderm-Derived Structures During Avian Embryogenesis

In situ hybridization of sectioned chick embryos revealed areas of strong and specific expression of PINCH-1 outside of the developing cardiovascular system (Fig. 6). Chick PINCH-1 is expressed in the muscles of the lateral body wall (which are MF20 positive [Fig. 6A]), the dorsal body wall (Fig. 6B), and the dorsal and ventral muscle masses in the developing limb (Fig. 6C). In addition, chick PINCH-1 is highly expressed in the somite-derived condensations, which will form the vertebral bodies (Fig. 6E,F). Chick PINCH-1 is also expressed in the liver (Fig. 6D), which is derived from endoderm and splanchnopleuric mesoderm, the intermediate mesoderm-derived mesonephros (Fig. 6G), and the smooth muscle of the developing lung bud (Fig. 6H,I).

thumbnail image

Figure 6. Expression of PINCH-1 (particularly interesting new cysteine-histidine–rich protein) in mesoderm-derived structures in a day 6.5 chick embryo. In situ hybridization on sections revealed strong and specific expression of PINCH-1. A: Muscle cells of the lateral body wall show strong expression of chick PINCH-1 (red arrow), which are MF20 positive (solid white box inlay corresponding to the dashed black box, white arrowheads). B: A higher power view of the strong expression of PINCH-1 in lateral and dorsal body wall muscle fibers (red arrow). C: Sagittal section of a developing limb. The muscles of dorsal (DMM) and ventral (VMM) muscle masses show strong expression of PINCH-1. The solid back inlay shows a higher power view of the VMM outlined by the black dashed box. The red arrowheads denote strong expression of PINCH-1 in muscle cells. D: Chick PINCH-1 is highly expressed in the developing liver (red arrows), which is derived from endoderm and splanchnopleuric mesoderm. E: Chick PINCH-1 is highly expressed in the sclerotomal (derived from the somite) condensation for the vertebral body (red arrows). F: A higher power view of E as denoted by the black dashed box. G: PINCH-1 is also expressed in the developing mesonephros (red arrows), which is an intermediate mesoderm derived structure. H: Chick PINCH-1 is strongly expressed in the smooth muscle (sm) cells of the developing lung buds (red arrows). I: Higher power view of the developing lung buds showing strong expression of PINCH-1 in smooth muscle cells. sm, smooth muscle; B, bone; TPV, transverse process of the vertebrae; ScVB, sclerotomal condensation for the vertebral body. Black scale bars = 200 μm. Red scale bar = 20 μm.

Download figure to PowerPoint

The expression of chick PINCH-1 in the lateral body wall is similar to what is seen in C. elegans and Drosophila. The C. elegans PINCH (unc-97) gene is expressed in the hypodermis, body wall, and vulval muscles (Hobert et al., 1999). The phenotype from ablation of PINCH (unc-97) suggests that PINCH plays a pivotal role in the differentiation of muscles and mechanosensory neurons and the maintenance of the structural integrity of muscle attachment sites (Hobert et al., 1999). In addition, Drosophila PINCH transcripts are expressed in the developing muscles of Drosophila embryos, with prominent enrichment at the muscle-attachment sites (Hobert et al., 1999; Clark et al., 2003). Drosophila PINCH is also detected in other muscles, including the dorsal vessel (the heart equivalent in Drosophila), the visceral musculature surrounding the gut, and in the pharyngeal muscles (Hobert et al., 1999; Clark et al., 2003). Clark and colleagues (2003) also show that cells expressing PINCH-1 message also express PINCH-1 protein. Mutations in Drosophila PINCH illustrates that PINCH is essential for integrin-dependent cell adhesion events in embryos and adults and reveals that PINCH is required to stabilize membrane-cytoskeletal linkages at sites of cell–substratum anchorage in embryonic muscle (Clark et al., 2003). A majority of PINCH mutant embryos die, indicating a strong requirement for PINCH during embryonic development (Clark et al., 2003). Our expression pattern of PINCH-1 in chick suggests a similar role in vertebrate development.

Conclusions

The role of PINCH-1 in vertebrate embryogenesis is largely unknown; however, it appears to be critical for regulating muscle attachment, cell shape changes, cell migration, differentiation, and survival (Zhang et al., 2002; Campana et al., 2003). The structure of PINCH-1, with multiple protein binding domains, a nuclear localization, and a nuclear export signal allow PINCH-1 to function in large protein complexes, which regulate cellular interactions with the extracellular matrix, mediate cell signaling, and regulate transcription. There is also a growing body of evidence suggesting that PINCH-1 and its binding partners are involved in cancers and other pathological processes including diabetes and renal failure (Wu, 1999; Guo and Wu, 2002; Wu, 2004). We show here that chick PINCH-1 is expressed in nonmigratory neural crest cells, cardiomyocytes, and other mesodermal derived structures throughout development. Overexpression of PINCH-1 in neural crest explants halts neural crest cell migration, suggesting that PINCH-1 may be an important regulator of neural crest cell migration and their subsequent contribution to normal heart development.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Cloning of PINCH-1

Three overlapping cDNA sequences (accession nos. AJ456621, BU490370, and BU476868), which cover the complete ORF of chick PINCH-1, were used to design oligonucleotide primers (5′primer 1, 5′GGCAGCAACATGGCAAACGCACTC-3′; and 3′primer 2, 5′TCATAAGGAAAGGGGAGAGCA). The complete ORF PINCH-1 cDNA was obtained using RT-PCR on RNA isolated by means of previously described methods (Martinsen et al., 2003). Sequence analysis (by means of the University of Minnesota Advanced Genetic Analysis Center) of several clones led to the identification of chick PINCH-1 gene (GenBank accession no. AY612853).

Chick In Situ Hybridization

In situ hybridization on sections was completed by following methods previously described (Martinsen et al., 2003) and developed by (Etchevers et al., 2001). The protocol used for chick whole-mount in situ hybridization is a combination of protocols developed for chick embryos (Wilkinson and Nieto, 1993; Henrique et al., 1995). A linearized plasmid of chick PINCH-1 sequences either from full-length coding sequence (GenBank accession no. AY61285) or 3′-untranslated region (UTR) sequences derived from primers (primer 7, 5′-AAGGCGATGCTGTGT-CTGCTCTGA-3′; and primer 8, 5′-TGCCATGGCCACTTGTATCG-3′) designed from the three overlapping cDNA sequences mentioned above (accession nos. AJ456621, BU490370, and BU476868) were used as a template to generate digoxigenin-labeled antisense probes. The full-length coding sequence probe gave similar expression patterns as the 3′-UTR 7–8 probe, but with much higher background. Figure 3I is the only data shown derived from the full-length probe. Thus, all other in situ data presented is from the 3′-UTR 7–8 probe. Paraffin sections of chick embryos or whole chick embryos fixed in 4% paraformaldehyde, ranging in age from HH stage 10 to day 6.5, were hybridized overnight with the riboprobe and then washed and incubated with a blocking solution containing anti-digoxigenin alkaline phosphatase (AP) -conjugated antibody (Roche). A BM Purple AP substrate (Roche) enzymatic reaction was then completed to visualize the in situ hybridization signal. When the color had developed to the desired extent, the sections were washed and refixed.

Quail–Chick CNC Chimeras

Fertilized quail (Coturnix coturnix japonica) and chick (Gallus gallus domesticus, White Leghorn) eggs were obtained from commercial sources and incubated at 38°C in a humidified atmosphere to HH stage 9–10 (7–11 somites). A window was cut in the quail shell and a 1:25 mixture of India ink and Ringer's solution injected into the sub-blastodermal cavity to reveal the embryo. The vitelline membrane in the region of the surgery and the CNC (mid-otic placode level to the caudal limit of somite 3, unilateral or bilateral) were removed using a pulled glass needle for dissection. The chick embryo host was similarly prepared, and the CNC from the region of the graft site (mid-otic placode level to the caudal limit of somite 3, unilateral or bilateral) was removed immediately before transfer of the quail donor CNC. The window was sealed with tape, and the host egg was incubated to day 2.5 to 6.5. Embryos were then collected, fixed in 4% paraformaldehyde, and embedded in paraffin for PINCH-1 in situ hybridization on sections following the protocol described above. Sections through the heart were then analyzed for coexpression of PINCH-1 and QCPN.

Immunofluorescent Staining of Quail–Chick Chimera Sections and CNC Cultures

Chick PINCH-1 in situ hybridization on quail–chick CNC chimera sections was performed first as described above in the Chick In Situ Hybridization section and then subsequently used for immunohistochemistry of QCPN (quail nuclei marker) as previously described (Martinsen et al., 2004). In addition, the in vitro neural crest cultures were grown for 48 hr as described in the methods section and then subsequently stained with HNK-1, a marker of migrating neural crest cells (Martinsen and Bronner-Fraser, 1998).

For immunofluorescent staining, the quail–chick chimera slides or the neural crest explant culture chamber slides were washed in PBT at room temperature for 15 min with gentle rotation. Slides were blocked in PBT + 2% bovine serum albumin + 10% goat serum for 1–2 hr with gentle rotation. Slides were then incubated with either MF20 (an antibody to myosin heavy chain), QCPN, or HNK-1, diluted 1:1 in the blocking solution for 2.5 hr at room temperature. Sections were washed in PBT overnight at 4°C, then 3 × 15 min at room temperature on day 2. Sections were then incubated in secondary antibody for 3 hr at room temperature. The secondary antibody for QCPN and MF20 was Alexa Fluor 568 rabbit anti-mouse IgG (H+L; Molecular Probes) diluted 1:100 in blocking solution. The secondary antibody for HNK-1 was Alexa Fluor 568 goat anti-mouse IgM diluted 1:100 in blocking solution. Slides were rinsed 3 × 15 min in PBT at room temperature, cover-slipped, and then viewed under a fluorescent microscope and photographed. The MF20 monoclonal antibody developed by Donald A. Fischman, M.D., was obtained from the Developmental Studies Hybridoma Bank (DSHB) developed under the auspices of the National Institute of Child Health and Human Development and maintained by The University of Iowa, Department of Biological Sciences (Iowa City, IA). QCPN and HNK-1 supernatants were generated from hybridoma cells (also obtained from the DSHB, University of Iowa).

Electroporation and In Vitro Culture of CNC

The sequence encoding full-length chick PINCH-1 (GenBank AY612853) was cloned into the pMES construct where a chick beta actin promoter/CMV IE enhancer drives gene expression, followed by an internal ribosomal entry site–EGFP (Swartz et al., 2001; Chen et al., 2004). An empty pMES construct served as the control. Plasmid DNA was isolated by means of a Qiagen Plasmid Maxi Kit and concentrated to 2–4 μg/μl. HH stage 9–10 (8–10 somites) embryos were removed from the egg and placed in Hanks' balanced salt solution (HBSS; Gibco) within an electroporation chamber with electrodes fixed at 3 mm apart. Plasmid DNA was microinjected into the neural tube at the level of the CNC. Three 13- to 14-volt pulses of 50-msec duration were applied using a CUY-21 electroporator (BEX Co., LTD/Protech International). The embryos were then rinsed in HBSS, and the cardiac neural folds were excised using a tungsten needle and explanted into an in vitro culture system as previously described (Boot et al., 2003a, b). The cultures were grown in a Lab-Tek II Chamber Slide System (Nalge Nunc International) for 48 hr and then fixed for 30 min in 4% paraformaldehyde and subsequently stained with HNK-1 as described in the Immunofluorescent Staining of Quail–Chick Chimera Sections and CNC Cultures section.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

B.J.M. and J.L.L. were funded by Viking's Childrens Fund Grants, and J.L.L. received a gift from the Sit Investment Associates Foundation.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES