Characterization of two new zebrafish members of the hedgehog family: Atypical expression of a zebrafish indian hedgehog gene in skeletal elements of both endochondral and dermal origins

Authors


Abstract

We have characterized two new members of the Hedgehog (Hh) family in zebrafish, ihha and dhh, encoding for orthologues of the tetrapod Indian Hedgehog (Ihh) and Desert Hedgehog (Dhh) genes, respectively. Comparison of ihha and Type X collagen (col10a1) expression during skeletal development show that ihha transcripts are located in hypertrophic chondrocytes of cartilaginous elements of the craniofacial and fin endoskeleton. Surprisingly, col10a1 expression was also detected in cells forming intramembranous bones of the head and in flat cells surrounding cartilaginous structures. The expression of col10a1 in both endochondral and intramembranous bones reflects an atypical composition of the extracellular matrix of the zebrafish craniofacial skeleton. In addition, during fin ray regeneration, both ihha and col10a1 are detected in scleroblasts, osteoblast-like cells secreting the matrix of the dermal bone fin ray. The presence of cartilage markers suggests that the dermal fin ray possesses an intermediate phenotype between cartilage and bone. Developmental Dynamics 235:478–489, 2006. © 2005 Wiley-Liss, Inc.

INTRODUCTION

Zebrafish hedgehog (Hh) genes are involved in many developmental processes with a relatively high conserved function compared to tetrapods (for review, see Ingham and McMahon,2001). To date, however, no zebrafish Hh family member with a similar function to Indian hedgehog in mammals has yet been identified and fully characterized. In mammals, Indian hedgehog plays a role in the development of the gut tube (Ramalho-Santos et al.,2000; Hebrok,2003), and the formation of hematopoietic progenitors (Dyer et al.,2001; Baron,2001), blood vessels, and chondrocytes in developing bones (Vortkamp,1997; St-Jacques et al.,1999; Long et al.,2004; Colnot et al.,2005). This latter role of Ihh has been particularly well studied, as this Hh protein has been shown to be required for proper endochondral bone formation in higher vertebrate species (Bitgood and McMahon,1995; Vortkamp et al.,1996; St-Jacques et al.,1999; Chung et al.,2001). Skeleton formation occurs via two distinct mechanisms: endochondral ossification and intramembranous ossification (Hall,1978; Fang and Hall,1997; Olsen et al.,2000; Buxton et al.,2003; Eames et al.,2004). Intramembranous ossification involves the direct mineralization of a bone matrix secreted by specialized cells, the osteoblasts (Hall and Miyake,1992; Fang and Hall,1997; Chung et al.,2004). This type of ossification largely takes place in the cranial skeleton, the clavicle (Hall and Miyake,1992; Hall,2001), scales, and fin rays of teleost fish, the latter constituting the fins dermal skeleton (Haas,1962; Géraudie and Landis,1982; Sire and Akimenko,2004). Endochondral ossification gives rise to most of the axial and appendicular skeletal elements, and is initiated by the formation of a cartilage precursor that is used as a model for subsequent ossification (Hall and Miyake,2000; Olsen et al.,2000). During maturation of cartilage, chondrocytes first stop proliferating and progressively differentiate into hypertrophic chondrocytes (St-Jacques et al.,1999; Karp et al.,2000; Eames et al.,2003). This transition is characterized by the expression of Ihh (Bitgood and McMahon,1995; Vortkamp et al.,1996), a significant increase in cell size, and the expression of new extracellular matrix components, including Collagen type X (Col10a1) in hypertrophic chondrocytes (Pathi et al.,2001; Tchetina et al.,2003; Yan et al.,2005). In mice, Ihh is expressed in pre-hypertrophic and early hypertrophic cartilage of the long bones, and in the zone between the proliferating and the hypertrophic chondrocytes (Bitgood and McMahon1995; Vortkamp1997; Iwasaki et al.,1997). Overexpression of Ihh causes the formation of shorter and thicker bone due to an inhibition of chondrocyte differentiation (Vortkamp et al.,1996) whereas mouse null mutants present a reduced chondrocyte proliferation and absence of differentiated osteoblasts (St-Jacques et al.,1999). Ihh function partially relies on the expression of the parathyroid hormone related peptide (PTHrP) (St-Jacques et al.,1999; Lanske et al.,1996). PTHrP knock-out mice exhibit skeletal defects induced by an early maturation of chondrocytes leading to premature ossification (Lanske et al.,1996). These opposite effects of Ihh and PTHrP knock-out suggest that they are involved in a negative feedback loop regulation that controls the maturation and differentiation of chondrocytes of long bones (St-Jacques et al.,1999; DeLise et al.,2000). In addition to this role in the control of chondrocyte maturation, Ihh has been shown to positively regulate cell proliferation in a PTHrP-independent fashion (Karp et al.,2000). Ihh secreted protein also signals to the outer layer of cartilage, the perichondrium, and is required for osteoblast differentiation in endochondral bones, as no bone collar forms in Ihh−/− mice embryos (St-Jacques et al.,1999; Long et al.,2004). Thus, Ihh is likely a key component of endochondral bone development, controlling the maturation of the chondrocyte towards hypertrophy and maintaining a pool of proliferating non-hypertrophic cells to allow bone development (Karp et al.,2000).

Our previous work on the shh signaling pathway in zebrafish led us to undertake the characterization of new members of the Hh family that could be involved in bony fin ray formation and regeneration. This report presents the identification of two new zebrafish genes encoding orthologues of the mammalian desert hedgehog (dhh) and Indian hedgehog (ihha), and the expression analysis of ihha in skeletal elements during larval development and fin ray regeneration. Our results show that ihha is expressed in mature cartilage cells of the head and fin endoskeleton of zebrafish. We also detected a faint expression of the second ihh-type gene of zebrafish ihhb [previously named echidna hedgehog, ehh (Currie and Ingham,1996); see Note Added in Proof] in a subset of the ihha expressing cartilage cells. In addition, we found that zebrafish bone formation presents interesting specificities: while ihh has been described as a major factor regulating hypertrophy in tetrapods, we detected ihha transcripts in osteoblast-like cells of the fin (scleroblasts) that are responsible for the secretion of fin ray bone matrix and developing scales. Similarly, we detected col10a1 expression in hypertrophic chondrocytes, cranial intramembranous bones during larval development, and in both scleroblasts and the basal epithelial cell layer adjacent to the bone matrix of the ray during fin regeneration. As these two cells layers also express Hh genes (shh/ihh), they are likely to contribute to the regulation of cell division and differentiation.

RESULTS AND DISCUSSION

Characterization of the Zebrafish ihha and dhh

To date, three hedgehog genes have been fully characterized in zebrafish. Two of these genes belong to the sonic-class: sonic hedgehog [shh (Krauss et al.,1993)] and tiggy-winkle hedgehog [twhh (Ekker et al.,1995)], whereas the third one belongs to the Indian-class genes: echidna hedgehog [ihhb (Currie and Ingham,1996)]. However, Krauss et al. (1993) and Ekker et al. (1995) previously reported the characterization of PCR fragments, hh[a] (192 bp), zf-[C] (144 bp) and zf-[D] (177 bp), whose sequences show a high similarity to conserved regions of Hh genes and potentially encode two as yet uncharacterized members of the hh gene family. We undertook the characterization of the full-length cDNA sequences corresponding to these PCR fragments using a RT-PCR strategy. Primers were designed based on zf-[C] and zf-[D] sequences and used in 5′ and 3′ Rapid Amplification of cDNA Ends (RACE) reactions on RNA preparations of 20 days post-fertilization (dpf) zebrafish larvae and 4 days post-amputation (dpa) regenerates of zebrafish caudal fin. We isolated two full-length cDNAs, dhh (1,970 bp) and ihha (1,327 bp) encoding two putative proteins of 447 and 413 amino acids, respectively (Fig. 1A). The sequence between amino acid positions 100 to 163 of the ihha protein is 97% identical to the hh[a] peptide sequence published by Krauss et al. (1993). The structure of the encoded proteins is identical to the other zebrafish and vertebrate Hh proteins (Fig 1B). It consists of three putative regions: a short signal peptide (23/27 residues for ihha/dhh, respectively) followed by the highly conserved “N-terminus” peptide (174 residues) responsible for the signaling activity of the Hh proteins and the C-terminus responsible for the preprotein autocatalytic cleavage (216/246 residues for ihha/dhh, respectively, Fig. 1B).

Figure 1.

Sequence analysis of ihha and dhh N-terminal peptides. A: Alignment of the human and mouse Hh active peptides with the five zebrafish Hh sequences [including ihha (Dre ihh) and dhh (Dre dhh)]. The active peptide sequences (see text for details) and consensus sequences at both ends of the N-ter peptide (frames) present a very good conservation. dhh contains a substitution at the first position of the N-ter (C→R). This position is still identified as a cleavage site for the signal peptide using the prediction software signalP 3.0 (Bendtsen et al.2004). The boundary between the active peptide and the C-terminus presents the consensus sequence (GG↑CF) necessary for the autocleavage of the protein (Porter et al.,1995). B: Schematic representation of Hh proteins. ihha and dhh putative proteins share a common organization with the Hh proteins of tetrapods. They are composed of a short signal peptide, followed by the N-ter peptide, which is the active signaling molecule and the non conserved C-terminal peptide responsible for the auto-cleavage of the pre-protein. Genomic organization of the ihha and dhh genes is also conserved; arrows indicate the common position of the two introns. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Active Peptide Sequence and Phylogenetic Analysis

Protein sequence alignment of the N-terminal peptide with vertebrate Hh proteins using Clustal W software revealed a very good conservation of ihha with 93% similarity and 90% of identical amino-acid positions (93/90% similarity/identity) and dhh (76/72%) with mouse Ihh and Dhh, respectively. Zebrafish ihha and dhh showed an even higher conservation with the four Hh proteins of Fugu rubripes identified so far (Gellner and Brenner,1999): ihha/Fru-hha 94/93%, dhh/Fru-hhd 89/86%, z-shh/Fru-hhc 99/98%, z-ihhb/Fru-hhb 94/92%. We also performed a phylogenetic analysis including vertebrate and Drosophila Hh active peptides (Fig. 2). This analysis showed that ihha is paralogous to ihhb and both peptides can be grouped with the other tetrapod indian-class peptides. In contrast, the zebrafish dhh N-terminal peptide appears more divergent from all other desert-class proteins (Fig. 2), with the exception of the Fugu hedgehog protein Fru-hhd [AAC34384 (Gellner and Brenner,1999)]. The cleavage site between the N-ter peptide and the C-ter peptide possesses the consensus residues G-CF required for the proper auto-processing of the active peptide (Porter et al.,1995). The two coding sequences have been mapped on the zebrafish genome using the LN54 radiation hybrid panel (Hukriede et al.,1999) and assigned to chromosome 23 for dhh and chromosome 9 for ihha. Conservation of the global synteny between human chromosome 12, mouse chromosome 15, and zebrafish chromosome 23 supports the idea that the zebrafish dhh actually encodes an orthologue of the mammalian Dhh gene. Taken together, these results show that ihha and dhh represent zebrafish orthologues of mammalian Ihh and Dhh, respectively.

Figure 2.

Phylogenetic analysis of the Hh active peptides. The sequences of vertebrate Hh Active peptides were aligned using Clustal W, and the tree was constructed using the Neighbor-Joining method. Drosophila Hh was used as an outgroup. Bootstrap values are indicated above the branches. Dre: Danio rerio, Fru: Fugu rubripes, Hsa: Homo sapiens, Dme: Drosophila melanogaster, Xle: Xenopus leavis. Accession numbers: Dre ihhb: NP_571163; Dre shh: NP_571138; Dre twhh: NP_571274; Hsa shh: NP_000184, Hsa ihh: NP_002172, Hsa Dhh: AAH33507, Mmu Shh: NP_033196, Mmu Ihh: NP_034674, Mmu Dhh: NP_031883, Xle shh: Q92000, Xle Bhh: Q91612, Xle chh: Q91611, Fru hha: SINFRUP00000128766*, Fru hhb: SINFRUP00000163676*, Fru hhc: CAD45244, Fru hhd: AAC34384. ihha can clearly be grouped with the tetrapod indian-class peptides and is the paralogous peptide of Dre ihhb. dhh is divergent from all the Hh tetrapod proteins with the exception of the Fugu Hh peptide hhd. These two peptides likely represent divergent members of the Desert-class in teleosts. Brackets indicate teleosts peptides of the three Hh classes Indian, Sonic, and Desert. *These peptides were predicted by the Ensembl analysis pipeline from either a GeneWise or Genscan prediction followed by confirmation of the exons by comparison to protein, cDNA, and EST databases. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

1-A06 Encodes a Potential Orthologue to Human Collagen Type 10 Alpha 1 Chain

In a previous study, Padhi et al. isolated an EST clone (1-A06) from a 4dpa regeneration subtraction library, which presents similarities with the mammalian collagen type X alpha 1 chain [col10a1 (Padhi et al.,2004)]. We further analyzed this sequence, and comparison of 1-A06 with the zebrafish EST database (http://zfish.wustl.edu/) allowed us to place this sequence inside of a longer EST assembly (wz4645.3) whose sequence presents a strong homology with mammalian col10a1 protein (62/57% similarity/identity with human col10a1). Based on the sequence of the Fugu col10a1 gene (Woods et al.,2004), we were able to extend the wz4645.3 sequence to a putative full-length coding sequence (CDS) of 1,968 bp/655 amino acid using the zebrafish genome assembly (www.ensembl.org/Danio_rerio/). This putative col10a1 coding protein presents 75/72% homology with Fugu col10a1 protein. Moreover, the position of the unique intron located inside of the CDS appears to be conserved. Finally, we detected a strong conservation between the promoter region and the 5′UTR of the Fugu and zebrafish genes. Taken together, these data strongly suggest that 1-A06 is a cDNA fragment of a zebrafish orthologue of col10a1. We will refer to 1-A06 as col10a1 in the subsequent results.

Expression Analysis

We analyzed the expression of ihha during skeletal development and fin regeneration and compared the expression pattern with that of other markers of interest (col10a1, ihhb, shh, ptc1, and 2) by in situ hybridization of antisense RNA probes on sections of zebrafish embryos, larvae, and fin regenerates. We did not detect dhh expression signal at any time points and tissues examined, and thus expression of dhh will not be discussed further.

Zebrafish larval skeleton.

In zebrafish, early skeletal elements appear as condensed cartilage cells by 72 hpf in the pectoral fin bud and the cranial skeleton (Schilling and Kimmel,1994; Grandel and Schulte-Merker,1998). The majority of the zebrafish cranial skeleton forms through endochondral or perichondrial ossification such that by 6 dpf a larval cartilaginous skeleton has already been formed. It consists of the dorsal neurocranium, which supports the brain and the sensory organs, and ventrally the pharyngeal skeleton, which supports the feeding and breathing systems (Kimmel et al.,2001). The neurocranium originates from both paraxial mesoderm and neural crest cells (NCC) whereas the pharyngeal skeleton composed of the pharyngeal and branchial arches only derive from NCC (Le Douarin,1982; Couly et al.,1993; Schilling and Kimmel,1994; Piotrowski et al.,1996). A few elements of the larval skeleton also form by intramembranous ossification such as the cleithrum and the operculum (Grandel and Schulte-Merker,1998; Kimmel et al.,2001). Additional intramembranous bones eventually form in the head skeleton (Cubbage and Mabee,1996; Kang et al.,2004), the vertebrae centrae (Morin-Kensicki et al.,2002; Fleming et al.,2004) and the fin rays (Laforest et al.,1998).

The earliest ihha transcripts were detected in 2–3 cells located bilateral to the rostral end of the notochord in the parachordal cartilage (pc) of 4-day-old larvae (Fig. 3A). These cells are relatively large and also express col10a1 (Fig, 3B) suggesting that they correspond to prehypertrophic or early hypertrophic chondrocytes. This finding is consistent with previous studies describing ihh expression in the same type of cells in the long bones of mouse embryos (Vortkamp et al.,1996; Iwasaki et al.,1997; St-Jacques et al.,1999). At this stage, col10a1, but not ihha, is also expressed in the pharyngeal skeleton at the level of the Meckel's and palatoquadrate cartilages (not shown). Surprisingly, col10a1 expression was also found in the forming parasphenoid, ectopterygoid, and operculum (Fig. 3C–E) that are intramembranous bones, devoid of cartilage precursor. Padhi et al. (2004) have also reported the expression of zebrafish col10a1 in the cleithrum, another bone of intramembranous origin, between 2 and 3dpf (Padhi et al.,2004), and consistent with their observations, we observed col10a1 expression in the cleithrum at 4dpf (Fig. 3F). This expression of col10a1 in intramembranous bones is unexpected as this type of collagen has been described as specific to cartilage in chick and mouse (Drissi et al.,2003; Zheng et al.,2003; Shen,2005).

Figure 3.

ihha and col10a1 expression in rostro-caudal transverse sections of the head regions of 4dpf zebrafish larvae. AF: In situ hybridization with an anti sense RNA probe corresponding to ihha (A) and col10a1 (B–F). A: Earliest expression of ihha detected in the skeleton is located in chondrocytes of the parachordal cartilage (pc), which also express col10a1 (B). The latter is more widely expressed, and transcripts were detected in forming dermal bones (C–F). Parasphenoid (ps), ectopterygoid (ecp), opercle (op), cleithrum (cl), and two bilateral clusters of cells, which are part of the pectoral girdle (arrows on F). ect, ectopterygoid; hb, hindbrain; n, notochord; opv, optic vesicle; ov, otic vesicle; pc, parachordal cartilage; ph, pharynx; ps, parasphenoid.

By 6dpf, a larval cartilaginous skeleton has formed and ihha expression was detected in several cartilage elements (Fig. 4): ihha is faintly expressed in the rostral region of the head in Meckel's cartilage (Fig. 4A,C) and the branchial arches (Fig. 4B,C). A stronger expression was observed in the ceratohyal (Fig. 4B,D,F) and the hyosymplectic (Fig. 4G,I) cartilages, which are part of the second (hyoid) pharyngeal arch. col10a1 is coexpressed with ihha in chondrocytes of hyoid arch, but only col10a1 transcripts were found in forming bones of intramembranous origin (parasphenoid, ectopterygoid, and opercle, Fig. 4E,H). Moreover, col10a1-positive cells were detected in a cell layer surrounding the cartilage (Fig. 4E,H, black arrowheads). These very flat cells present the same morphology as the cells of the developing intramembranous bones that also express col10a1. In the hyosymplectic cartilage, only the most ventral chondrocytes expressed ihha and col10a1. The ihha/col10a1-negative cells located more dorsally (white arrowheads in Fig. 4G and H) potentially represent more mature cells as previous studies showed that ossification of the hyosymplectic cartilage begins dorsally (Cubbage and Mabee,1996). These observations are consistent with the expression of ihha and col10a1 in early and mature hypertrophic chondrocytes described in mouse (Vortkamp et al.,1996; St-Jacques et al.,1999) and chick embryos (Iwamoto et al.,2003) and their exclusion from the areas of proliferation. ihha and col10a1 are also expressed in the neurocranium, in chondrocytes of the parachordal cartilage (pc, Fig. 4B,J–O). No expression, however, was observed in the anterior (prechordal) neurocranium (see also Fig. 4B). The posterior neurocranium (including the pc) constitutes the part of the head skeleton that originates from axial mesoderm, in contrast to the rest, which largely derives from neural crest cells (Kimmel et al.,2001; Nakashima and de Crombrugghe,2003). It is unclear whether the restriction of the ihha and col10a1 expression domain reflects these distinct origins of the neurocranium cells. More posteriorly, at the level of the otic vesicle, the pc forms a dorsal process. ihha and col10a1 are strongly expressed in the hypertrophic chondrocytes (Fig. 4M,N), which are located a few cell diameters away from the notochord. As observed previously in the hyoid arch, col10a1-positive cells were also observed in the cell layer adjacent to the chondrocytes (Fig. 4N, black arrowheads). The cells closer to the notochord do not express ihha or col10a1, and, therefore, may correspond to immature chondrocytes, since they are smaller and faintly stained with Alcian blue (Fig. 4O). No expression of ihh was detected posteriorly to the skull in the axial skeleton, including vertebrae, whose centrae have been shown to form in zebrafish by intramembranous ossification, without cartilage formation (Fleming et al.,2004).

Figure 4.

ihha and col10a1 expression in the head skeleton of 6dpf larvae. In situ hybridizations using ihha (A, B, D, G, J, M) and col10a1 (E, H, K, N) probes and Alcian blue staining of cartilage cells (C, F, I, L, O) performed on 12-μm longitudinal (A–C) or transverse (D–O) cryosections of 6dpf larvae. A–C: Longitudinal sections. ihha is expressed in chondrocytes of several cartilaginous elements, such as the Meckel's (me, in A), ceratohyal (ch in B), and parachordal (pc, in B) cartilages. D–O: Cross-sections comparing ihha (left column), col10a1 (middle column) expression, and Alcian blue staining (right column) at different rostro-caudal levels (sections progress caudally). ihha and col10a1 are expressed in chondrocytes (black arrows) of the ceratohyal (ch), hyosymplectic (hs), and parachordal (pc) cartilages. Comparison with Alcian blue staining (right) positively identifies these cells as chondrocytes. In addition to cartilage cells, col10a1 is also expressed in flat cells surrounding the cartilage and several forming dermal bones (black arrowheads). White arrowheads on G, H, M, and N show chondrocytes expressing neither ihha nor col10a1, suggesting that they are less differentiated. See text for details. at, atrium; ba, branchial arches; bp, basal plate; bs, basibranchial; ch, ceratohyal; ep, ethmoid plate; ect, ectopterygoid; fb, forebrain; g, gut; hb, hindbrain; hs, hyosymplectic; me, Meckel's cartilage; n, notochord; op, opercle; opv, optic vesicle; ov, otic vesicle; pc, parachordal cartilage; ph, pharynx; ps, parasphenoid; pq, palatoquadrate; tc, trabecula.

As a conclusion, we observed that ihha-expressing cells possess the typical morphology of hypertrophic chondrocytes, since they are much larger than the neighboring cells and are surrounded by a thick acellular material consistent with active extracellular matrix secretion. We did not detect expression of ihha in forming intramembranous bones of the craniofacial region, which is consistent with previous studies that showed that intramembranous bones do form in ihh−/− mouse, although their growth is impaired by the mutation (St-Jacques et al.,1999).

Contrarily to the cell-type restricted expression of ihha, col10a1-expressing cells seem to belong to distinct populations: First, col10a1 is expressed in hypertrophic chondrocytes, as described in previous studies of cartilage development (Eames et al.,2003; Tchetina et al.,2003; Chung et al.,2004; Shen,2005). Second, col10a1 is expressed in flat cells at two different locations: First, we observed col10a1 in flat cells that may correspond to osteoblasts of the forming cranial intramembranous bones (operculum, parasphenoid, and ectopterygoid) and pectoral fin girdle (cleithrum). These cells are the earliest cells expressing col10a1 in the craniofacial region, and expression at this level can be observed for many days during intramembranous bone growth and development. Second, we found col10a1 transcripts in cells located at the immediate periphery of cartilaginous structures (ceratohyal, hyosymplectic, and parachordal chondrocytes). These cells could represent perichondrium/periosteum cells, which have been shown to play a role in the ossification process of many skeletal structures of endochondral/perichondrial origin (Fang and Hall,1997; Javidan and Schilling,2004). These observations are, however, contradictory to previous studies that showed that col10a1 expression is excluded from the perichondrium of developing mouse long bones (Fang and Hall,1997; Javidan and Schilling,2004). and that signals originating from the perichondrium negatively regulate chondrocyte maturation, and should therefore negatively regulate col10a1 expression (Long and Linsenmayer,1998; Alvarez et al.,2001). The expression of col10a1 in osteoblast-like cells could reflect secondary chondrogenesis that occurs at the level of the articular surface of several craniofacial bones (Fang and Hall,1997; Buxton et al.2003). However, cells that undergo secondary chondrogenesis clearly present a hypertrophic phenotype, which is not the case of col10a1-positive cells of the periosteum or the skull intramembranous bones (see Figs. 3 and 4). This morphological observation does not favor the hypothesis that the col10a1 expressing osteoblasts are due to secondary chondrogenesis.

Although it is surprising to find col10a1, usually described as a mature cartilage marker, in intramembranous bone and periosteal osteoblast-like cells, it has been shown that ColII and ColX, two cartilage markers, are expressed in cultured cells of dissociated chick calvaria periosteum (Berry and Shuttleworth,1989) and ColII transcripts were observed in the calvaria of chick embryos (McDonald and Tuan,1989) and in the rat alveolar bone (Ting et al.,1993). Our data show that a similar mechanism may occur in vivo in zebrafish intramembranous bones and the periosteum of cartilage-derived bones. It is also possible that cells of the membranous bone may correspond to cells of chondroid-like bone, which present features of both bone and cartilage (Hall,1978; Fang and Hall,1997). Chondroid bones have been described in teleosts and in the chick embryonic skull and their presence has been associated with sites of rapid bone growth (Huysseune and Verraes,1990; Fang and Hall,1997). In addition to chondroid bones, teleost fish possess a large variety of skeletal tissues, especially in the head, with characteristics that make them difficult to classify as cartilage or bone (Smith and Hall,1990; Huysseune and Sire,1990; Benjamin et al.,1992; Witten and Hall,2002). Thus, the differences between the expression of col10a1 in zebrafish and tetrapods could reflect a specific ECM composition of particular types of bones in zebrafish, and possibly in other teleosts.

In order to complete our study on the expression of the hedgehog genes during cranial skeleton development, we performed in situ hybridization with a probe corresponding to the second indian hedgehog-like gene in zebrafish, ihhb (Currie and Ingham,1996), as well as the two hedgehog receptors, ptc1 and ptc2 (Fig. 5). We detected a faint expression of ihhb in chondrocytes of several structures of the cranial skeleton, including the ceratohyal (Fig. 5A) and parachordal cartilages (Fig. 5B), and the branchial arches (Fig. 5C). ptc1 and ptc2 expression was detected in cells located dorsally to the visceral arches cartilages, between the cartilage cells and the epithelium of the oral cavity (Fig. 5D), and in both chondrocytes (Fig. 5F, black arrows) and surrounding cells (Fig. 5E,F, red arrows) of the parachordal cartilage. The expression in the chondrocytes is surprising, as it has been shown in mouse long bones that ihh and ptc expression domains do not overlap. Rather, ptc expression is restricted to proliferating chondrocytes and perichondrium/periosteum (Nakase et al.,2001; Nakashima and de Crombrugghe,2003) whereas ihh is expressed in hypertrophic chondrocytes.

Figure 5.

ihhb, ptc1, and ptc2 expression in 6dpf larvae. AG: In situ hybridizations conducted on transverse sections of 6dpf zebrafish larvae submitted to ISH using a ihhb (A–C), ptc2 (D), or ptc1 (E,F) probes. A–C: ihhb expression is detected in ceratohyal (ch in A), parachordal (pc in B), and branchial arches (1ba in C) chondrocytes, and is similar to ihha. D,F: The pan-hedgehog receptors ptc1 and ptc2 (red arrows) are expressed in the periphery of chondrocytes of several cartilaginous structures, which express ihha or ihhb. In the parachordal cartilage (pc in F), ptc1 expressing cells co-localize with hypertrophic chondrocytes, which also express ihha (Fig. 4M), col10a1 (Fig 4N), and ihhb (B). 1ba, First branchial arch; bs, basibranchial; ch, ceratohyal; hb, hindbrain; g, gut; n, notochord; pc, parachordal cartilage; pq, palatoquadrate.

Gene expression analysis of ihha and col10a1 at later stages (up to 20dpf) did not reveal significant changes in the expression patterns. ihha and col10a1 were still expressed in cranial and parachordal chondrocytes (data not shown).

Fin Endoskeleton and Expression in Older Larvae

No expression of ihha was detected in the fin endoskeleton at 6dpf. This is surprising, as these bones form through endochondral ossification of a cartilage precursor. Although we did not detect ihha expression in the paired fin, we cannot rule out the possibility that ihha may be expressed in chondrocytes of the paired fin endoskeleton at a stage that we have not analyzed. Alternatively, our failure to detect ihha expression in the developing skeleton of the paired fins may be due to a low level of expression or a restricted number of ihha-positive cells on our sections.

We decided to perform ISH on older larvae (8.5 to 10 mm SL, approx. 20 to 25dpf) to determine whether ihha is expressed in these structures during the growth phase of fin endoskeleton development. Expression of ihha was observed in several elements of the fin endoskeleton in all the median (or unpaired) fins (Fig. 6). The median fins endoskeleton largely consists of repeated elements: the radials in the dorsal and anal fins (segmented into proximal and distal elements), and the hypurals in the caudal fin (Bird and Mabee,2003; Crotwell et al.,2004). These rod-like elements support the dermal rays and progressively undergo endochondral ossification. ihha-positive cells clearly showed the same morphology as the chondrocytes expressing ihha in the cranial skeleton at earlier stages. ihha-expressing cells (Fig. 6A,B, black arrows) in the hypurals of the caudal fin were located between two different populations of cells: small flat cells that are located at the distal tip (Fig. 6B, white arrows) and probably correspond to less differentiated or proliferating chondrocytes, and at the other (proximal) end, large round cells that are likely progressing towards ossification or already ossified. In support of this idea, it has been shown that once larvae are longer than 6 mm, cartilage only remains in the growing distal region of the hypurals whereas the proximal part is already ossified (Bird and Mabee,2003). This expression of ihha in fin endoskeleton is reminiscent of the expression of Ihh in the growth plate of mouse long bones (Iwasaki et al.,1997; St-Jacques et al.,1999). More specifically, the mouse Ihh is expressed in the intermediate zone of the bones, between the more mature ossified tissue and the proliferating chondrocytes, where it controls the balance between proliferation and differentiation of chondrocytes. In the proximal radials of the dorsal fin, ihha expression is restricted to the chondrocytes at the extremities but not in the middle portion of these bones, which is the earliest region to undergo ossification (Fig. 6C,D) (Bird and Mabee,2003).

Figure 6.

ihha expression in fin endoskeleton and scales. AF: In situ hybridization using a ihha probe on longitudinal sections of 10-mm larvae. A,B: Caudal fin endoskeleton. A: ihha expression in the hypural of the caudal fin. B: A closer view of A reveals that the distalmost chondrocytes of the hypurals (white arrows) present a different morphology, and do not express ihha. C,D: Dorsal fin endoskeleton. C: ihha is expressed in cells located at the extremities of the proximal radial (pr, black arrows), but not in central cells (white arrowhead). D: Closer view of the dorsal fin endoskeleton showing ihha expression in chondrocytes of the proximal radials (black arrows), but not in the distal radials (white arrows). E: ihha is expressed in growing scales (arrows). Higher magnification (F) shows that ihha expression is undetectable in the epidermis and appears to be restricted in the underlying mesenchyme (arrow on F). e, epidermis; dr, distal radials; hy, hypurals; m, mesenchyme; mu, muscle; pr, proximal radials; uro, urostyle. All sections are oriented anterior to the left and dorsal to the top.

Finally, ihha expression was observed in the forming scales, which are also elements of the dermal skeleton of the fish (Fig. 6E,F). ihha is specifically expressed in the mesenchymal compartment located underneath the epidermis, whereas it has been shown that the cells of the basal layer of the epidermis express shh during scale morphogenesis (Sire and Akimenko,2004).

Fin Ray Regeneration

Zebrafish has the ability to regenerate their fin rays after injury. The regeneration process triggers a complex program that will eventually replace the amputated part with a new structure identical to the original fin. Several studies during the last decade have shown that many developmental signaling pathways such as hedgehog (Laforest et al.,1998; Quint et al.,2002), fibroblast growth factor [fgf (Poss et al.,2000b)], bone morphogenetic protein [bmp (Quint et al.,2002)] and Wnt (Poss et al.,2000a) signaling pathways are reactivated during regeneration. To date, only shh expression has been described to be during regeneration in a subset of cells of the basal epidermal layer where it is thought to be involved in the maintenance of the blastema and the proper patterning of the bone matrix-secreting cells, the scleroblasts (Laforest et al.,1998). Our analysis of ihha expression during zebrafish fin regeneration (dpa) revealed that ihha is also expressed during this process (Fig. 7). At 2dpa, the earliest ihha transcripts are found in two small domains located just distal to the amputation level in mesenchymal cells of the regenerate and are likely differentiating bone-secreting cells (scleroblasts, Fig. 7A, arrows). At 4dpa, ihha is more widely expressed in the scleroblasts at the level of the patterning zone of the regenerate (Fig. 7B–D). The expression of ihha in the scleroblasts is unexpected since the formation of fin rays does not involve cartilage formation, but rather direct mineralization of the bone matrix secreted by scleroblasts. Previous studies showed that the Hh pathway may be involved in the formation of ray bifurcation, as shh expression domain splits into two discrete domains before the actual bifurcation can be morphologically detected (Laforest et al.,1998). Consistent with this observation, ihha expression domain in the scleroblasts of each hemiray splits into two discrete domains before the morphological formation of a bifurcation (Fig. 7C). The ihha expression domain in the scleroblasts is adjacent to shh-expressing cells in the basal layer of the epidermis (Fig. 7E). This finding is suggestive of interactions between shh and ihh signals at the epithelial-mesenchymal interface, also supported by the expression of the common Hh receptor ptc1 in both the epidermis and the blastema cells (Laforest et al.,1998). Moreover, this expression correlates with our observations of ihha expression during scale development (Fig. 6E,F). Therefore, it appears that the shh/ihha spatial relationships are similar during scale development and fin regeneration.

Figure 7.

Expression of ihha and col10a1 during fin ray regeneration. In situ hybridization with probes corresponding to ihha (AD), both ihha and shh (E) and col10a1 (F) on section of zebrafish caudal fin regenerates at 2- and 4-days post amputation (dpa). A,B, D–F: Longitudinal sections; C: transverse section. A: ihha expression is first detected in two faint domains in the blastema compartment (b) at the tip of each amputated hemiray (L), which may correspond to differentiating bone matrix-secreting cells, or scleroblasts. B–D: At 4dpa, during the regenerative outgrowth, ihha-expressing cells are found in two rows of cells adjacent to the basal layer of the epidermis (bel, in D). C: Transverse section of the regenerate at the level of the arrowhead indicated on B. Each hemiray region (L) contains two discrete ihha expression domains (arrows), which signal an imminent bifurcation event and labels the presumptive sister rays (*). Closer view of the epidermis-mesenchyme interface (D) confirms that ihha-expressing cells correspond to scleroblasts (arrow). E: Double in situ with shh and ihha shows that the shh domain (red arrow), which is restricted to the basal epidermal layer, is facing ihha-positive cells (black arrow). F: col10a1 is strongly expressed in both epithelial cells (red arrow) and scleroblasts, from the patterning zone to the proximal part of the regenerate. All longitudinal sections are oriented distal part to the top. bel, basal epidermal layer; e, epidermis; ec, epidermal cap; l, lepidotrichia; m, blastema mesenchyme; pz, patterning zone; *, presumptive sister rays.

No ihhb transcripts were detected during fin regeneration, but we observed a very strong expression of col10a1 in scleroblasts and in cells of the basal epidermal layer adjacent to the scleroblasts in 4dpa regenerate (Fig. 7C). This expression of col10a1 in regenerating fins is atypical but is reminiscent of the expression that we observed during skeletal development in intramembranous bones of the head. It is also unexpected to detect col10a1 in the basal layer of the epidermis (BLE), as col10a1 has been mostly described as a cartilage marker. However, the expression of another cartilage-specific collagen type (col2a1) has previously been reported in the BLE of the zebrafish regenerating fin rays (Johnson and Weston,1995). The significance of the expression of these collagen genes in the basal epithelial cells adjacent to the scleroblasts secreting the bone matrix is unclear but suggests the potential role of these cells in the production of the ECM composing the dermal bone.

It has been noted that chondrogenic features appear in intramembranous bones that necessitate a rapid growth such as secondary cartilage, chondroid bone, and fracture healing (Fang and Hall,1997). Fang and Hall (1997) proposed that cartilage formation in these cases would “be an adaptive response of membrane bone to local microenvironmental stimulation.” One characteristic of fin regeneration is its rapidity; complete regeneration of the caudal fin in zebrafish occurs within the three weeks following injury. It is possible that the presence of cartilage markers (ihha, col10a1, col2a1) in this dermal bone may reflect the need of rapid formation of this bone tissue. In any case, these markers would position the fin ray characteristics as intermediate between cartilage and bone.

Finally, the presence of ihha in the scleroblasts also suggests that this gene may play a more direct role in bone matrix secretion than shh, the latter being involved to a greater extent in patterning of the ray. Moreover, since bone formation in the fin regenerate has been shown to be mediated through bmp signaling in the blastema, it is possible that ihha may act as a relay between shh and the bmp pathway in the process of bone formation during fin regeneration.

EXPERIMENTAL PROCEDURES

Cloning of ihha and dhh

Full-length ihha and dhh cDNAs were obtained by rapid amplification of cDNA ends (RACE) of the 5′ and 3′ regions of zf-[C] and zf-[D] fragments (Ekker et al.,1995), respectively. The 5′ and 3′ RACE products were then sequenced and cDNA clones encompassing the full coding sequence were obtained by RT-PCR from 20dpf using the following specific primers: dhh forward: 5′ CAATGAC GTTGGCTCCTT 3′, dhh reverse: 5′ CCTGAGCATATTCAGTGTCT 3′; ihha forward 5′: ATGCGTCTCCCCGTGGTGTT 3′ and ihha reverse: 5′ TCATCTATCATTGTCCATCATGC. cDNA and putative protein sequences have been submitted to GenBank and can be retrieved with the following accession numbers: DQ066428 (ihha) and DQ066429 (dhh).

Sample Preparation for In Situ Hybridization

Zebrafish larvae and fin regenerates were fixed in 4% Paraformaldehyde (PFA)/PBS 0.1% Tween (PBT) overnight at 4°C, rinsed twice in PBT, then dehydrated in methanol and stored at −20°C until processing. SL (standard size) of larva corresponds to the distance separating the rostral tip of the larva to the base of the caudal fin.

In Situ Hybridization

The ihha digoxigenin-labeled antisense RNA probe corresponds to 890-bp of the 3′ half of the cDNA. col10a1/1-A06 (see Results section) probe (713 bp) is located at the 3′ end of a putative zebrafish type X collagen a1 gene (Padhi et al.,2004). In situ hybridization was conducted as described in Quint et al. (2002). The ptc1 and ptc2 (Lewis et al.,1999), ihhb (Currie and Ingham,1996), and shh (Roelink et al.,1994) RNA probes were prepared as previously described.

Alcian Blue Staining

After fixation in 4% PFA in PBT, embryos were placed in a solution containing 0.1% W/V alcian blue in 70% ethanol and 1% V/V 12N HCl for 2 hr, then destained in 70% alcohol containing 5% 12N HCl. Samples were then rehydrated and stored in PBS with 10 mM EDTA until sectioning.

Acknowledgements

The authors thank Steven Ekker for providing the Zf-[C] and Zf-[D] plasmids, Lucille Joly, Amanda Smith, and Luc Poitras for technical assistance and discussion, and Marc Ekker for a critical reading of the manuscript. We also thank anonymous reviewers for their insightful comments on the manuscript. This work was supported by Grant MOP-57896 from the Canadian Institutes of Health Research to M.A.A.

NOTE ADDED IN PROOF

After consulting the zebrafish nomenclature committee, it has been decided to name the zebrafish ihh orthologs according to the approved standard nomenclature guidelines. The new ihh ortholog, ihha, is named based on its synteny with the hoxda complex on chromosome 9. The gene previously named echidna hedgehog, ehh, has been renamed ihhb.

Ancillary