Simple tandem repeat sequence is indicated immediately following the numeric notation for each simple tandem repeat marker. Marker allele sizes are indicated for C57BL/6J (B) and for C3HeB/FeJ (C) strains.
Research Article
Distant regulatory elements in a Sox10-βGEO BAC transgene are required for expression of Sox10 in the enteric nervous system and other neural crest-derived tissues
Article first published online: 3 APR 2006
DOI: 10.1002/dvdy.20769
Copyright © 2006 Wiley-Liss, Inc.
Issue

Developmental Dynamics
Special Issue: Craniofacial Development Special Issue
Volume 235, Issue 5, pages 1413–1432, May 2006
Additional Information
How to Cite
Deal, K. K., Cantrell, V. A., Chandler, R. L., Saunders, T. L., Mortlock, D. P. and Southard-Smith, E. M. (2006), Distant regulatory elements in a Sox10-βGEO BAC transgene are required for expression of Sox10 in the enteric nervous system and other neural crest-derived tissues. Dev. Dyn., 235: 1413–1432. doi: 10.1002/dvdy.20769
Publication History
- Issue published online: 19 APR 2006
- Article first published online: 3 APR 2006
- Manuscript Accepted: 20 FEB 2006
Funded by
- NIH. Grant Numbers: CA68485, DK20593, DK58404, HD15052, DK59637, EY08126
- US National Institutes of Health grant from NIDDK. Grant Number: DK64251
Keywords:
- Sox10;
- transgene;
- BAC modification;
- neural crest;
- enteric nervous system;
- cis-regulatory regions
Abstract
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
Sox10 is an essential transcription factor required for development of neural crest-derived melanocytes, peripheral glia, and enteric ganglia. Multiple transcriptional targets regulated by Sox10 have been identified; however, little is known regarding regulation of Sox10. High sequence conservation surrounding 5′ exons 1 through 3 suggests these regions might contain functional regulatory elements. However, we observed that these Sox10 genomic sequences do not confer appropriate cell-specific transcription in vitro when linked to a heterologous reporter. To identify elements required for expression of Sox10 in vivo, we modified bacterial artificial chromosomes (BACs) to generate a Sox10βGeoBAC transgene. Our approach leaves endogenous Sox10 loci unaltered, circumventing haploinsufficiency issues that arise from gene targeting. Sox10βGeoBAC expression closely approximates Sox10 expression in vivo, resulting in expression in anterior dorsal neural tube at embryonic day (E) 8.5 and in cranial ganglia, otic vesicle, and developing dorsal root ganglia at E10.5. Characterization of Sox10βGeoBAC expression confirms the presence of essential regulatory regions and additionally identifies previously unreported expression in thyroid parafollicular cells, thymus, salivary, adrenal, and lacrimal glands. Fortuitous deletions in independent Sox10βGeoBAC lines result in loss of transgene expression in peripheral nervous system lineages and coincide with evolutionarily conserved regions. Our analysis indicates that Sox10 expression requires the presence of distant cis-acting regulatory elements. The Sox10βGeoBAC transgene offers one avenue for specifically testing the role of individual conserved regions in regulation of Sox10 and makes possible analysis of Sox10+ derivatives in the context of normal neural crest development. Developmental Dynamics 235:1413–1432, 2006. © 2006 Wiley-Liss, Inc.
INTRODUCTION
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
Sox10 is a member of the Sry-like HMG-box transcription factor gene family whose members are defined by the presence of a 60 amino acid DNA binding domain with homology to the HMG box of SRY (reviewed by Wegner,1999; Bowles et al.,2000). Sox10 expression initiates as neural crest (NC) cells migrate from the dorsal aspect of the neural tube and is maintained by the glial and melanoblast lineages of neural crest (Britsch et al.,2001; Potterf et al.,2001). During development, expression of Sox10 has also been documented in cranial ganglia, sympathetic ganglia, dorsal root ganglia (DRG), and enteric ganglia (Herbarth et al.,1998; Southard-Smith et al.,1998; Britsch et al.,2001).
Phenotypes resulting from alterations of Sox10, both in man and mouse, are consistent with its expression in neural crest derivatives. A truncating mutation that removes the transcriptional activation domain of Sox10 (Sox10Dom) is the underlying gene defect in the spontaneous dominant megacolon mouse model of Hirschsprung disease (HSCR). Sox10Dom mutants are characterized by distal intestinal aganglionosis and coat spotting in heterozygotes (Lane and Liu,1984; Herbarth et al.,1998; Southard-Smith et al.,1998). In vitro, the Sox10Dom protein acts in a dominant-negative manner to inhibit transcriptional activity of wild-type Sox10 (Potterf et al.,2000; Inoue et al.,2004). Similar spotting and aganglionic megacolon have been reported for a targeted allele of Sox10LacZ that results in haploinsufficiency (Britsch et al.,2001). Human SOX10 mutations have been identified in multiple patients with Waardenberg syndrome type 4 (OMIM #277580; syndromic HSCR disease accompanied by pigment abnormalities, and deafness). A subset of children with SOX10 mutations exhibit very severe clinical features, including leukodystrophy, congenital hypomyelinateing neuropathy, seizures, cerebellar ataxia, and autonomic dysfunction (Inoue et al.,1999, 2002; Staiano et al.,1999; Touraine et al.,2000; Korsch et al.,2001). Because all SOX10 patients reported to date are heterozygotes, and the more severe phenotypes are observed in patients with alterations localized to the distal end of the protein that leave the DNA binding domain intact, it has been hypothesized that dominant-negative forms of the protein exert more severe effects on neural crest development (Inoue et al.,2004), although the effects of interacting modifiers may also be responsible for some of the variance in SOX10 phenotypes. Given SOX10 patient phenotypes and observed expression of Sox10 in developing peripheral ganglia, it is not surprising that the role of Sox10 in astrocytes and glia in the central and peripheral nervous systems has been studied extensively (for review, Wegner,2001; Mollaaghababa and Pavan,2003).
Efforts to identify downstream targets of Sox10 have revealed the role of this transcription factor in direct regulation of genes important in nervous system and melanocyte development, including Schwann cell myelin gene (P0), connexin 32, c-Ret, MITF, endothelin receptor b (Ednrb), Krox20, and the β4 and α3 subunit genes of the neuronal nicotinic acetylcholine receptor (Liu et al.,1999; Bondurand et al.,2000, 2001; Lang et al.,2000; Lee et al.,2000; Peirano et al.,2000; Potterf et al.,2000; Verastegui et al.,2000; Ghislain et al.,2003; Lang and Epstein,2003; Zhu et al.,2004). Although significant progress has been made in the identification of genes regulated by Sox10, the transcription factors, cis-regulatory elements and signaling paths that mediate direct regulation of Sox10 itself are unknown. Identification of signaling paths and factors that control Sox10 are of significant interest for multiple reasons. First, Sox10 is integral to a collective network of neural crest specifiers that regulate lineage decisions as neural crest phenotypes emerge (reviewed in Meulemans and Bronner-Fraser,2004). Studies in Xenopus indicate that Sox10 expression is dependent upon Wnt and FGF activity (Honore et al.,2003). Moreover, it appears that there is extensive cross-regulation of Sox10 among the network of neural crest specifiers as Sox10 expression is both required for and dependent on appropriate expression of other essential transcription factors, including Slug, AP-2α, FoxD3, and Twist. Whether these effects represent direct transcriptional regulation or remain one step removed remains to be seen. Second, Sox10 regulatory elements are potential regions where noncoding mutations might exist in some HSCR disease patients, as mutations in known genes account for less than 30% of affected patients (Chakravarti et al.,2004). Lastly, the consistent up-regulation of Sox10 in melanomas, melanoma cell lines (Khong and Rosenberg,2002), and highly metastatic melanoma cells (Tani et al.,1997), as well as its correlation with oligodendroglioma (Dong et al.,2004) and its expression in neuroectodermal tumors (Gershon et al.,2005) make this gene and the factors that control its regulation of interest to cancer geneticists.
Spatial and temporal control of tissue-specific gene expression can be mediated by promoter elements that are in close proximity to 5′ exons. However, recent studies have established that regulation of many genes is not strictly controlled by proximal promoter elements associated with the start site of transcription but by cis-elements at a great distance that incorporate enhancer and insulator activities and function over great distances. A common theme is emerging that genes that are elaborately regulated during development are often controlled by modular cis-acting elements at a great distance from the start site of transcription. Studies in transgenic mice have revealed a spectrum of regulatory strategies that may be in effect: distant and scattered over a large interval (Biben et al.,1996; Moore et al.,1998; Antes et al.,2001; Mortlock et al.,2003), far 3′ of the gene (DiLeone et al.,1998; Pape et al.,1999), intronic (Rowntree et al.,2001), or even embedded in neighboring genes (Carvajal et al.,2001; Sagai et al.,2005). Attempts to identify gene regulatory regions can be speeded significantly by use of bioinformatics tools to locate evolutionarily conserved noncoding sequences among species. With the completion of genomic sequence for multiple species sequence analysis tools now readily perform cross-species comparisons and, thus, identify conserved sequences that represent either structural gene elements or associated regulatory sequences (e.g., PIPMaker, VISTA, PhyloHMM; Mayor et al.,2000; Schwartz et al.,2000; Siepal and Haussler,2003; Siepel and Haussler,2004). Such comparative genomics tools have contributed to the successful identification of promoter and regulatory elements for multiple genes, including Mitf, Sox9, ABCA1, DMRT1, and Gdf6 (Potterf et al.,2000; Bagheri-Fam et al.,2001; Brunner et al.,2001; Qiu et al.,2001; Mortlock et al.,2003). Combinatorial approaches that utilize both comparative genomics and transgenic methods have proven exceptionally successful for identification of controlling elements in developmentally regulated genes that are subject to complex temporal and spatial regulation in the embryo (Mortlock et al.,2003; Nobrega et al.,2003; Ahituv et al.,2004; Sagai et al.,2005; Woolfe et al.,2005).
To identify essential regions that control expression of Sox10 and facilitate lineage analysis in the enteric nervous system (ENS), we have investigated the ability of Sox10 flanking regions carried in BAC clones to drive appropriate expression of a heterologous reporter cassette in transgenic mice. Initial experiments in vitro suggested that distant regulatory regions were needed for expression of Sox10. By evaluating the ability of a Sox10 BAC clone to complement neural crest defects in Sox10LacZKO/+ haploinsufficient mice, we have established that critical regulatory regions are within a 218-kb interval flanking the Sox10 locus. Incorporation of a LacZ/Neo reporter cassette (βGeo) into the Sox10 BAC generated a Sox10βGeoBAC transgene that allowed us to monitor tissue-specific and temporal expression from Sox10 regulatory regions. Expression of this Sox10βGeoBAC transgene closely approximates previously described transcription of Sox10 (Britsch et al.,2001) and identifies new anatomical sites of Sox10 expression both in tissues that are known to be of neural crest origin and sites in which neural crest contributions have not been recognized previously. In our analysis of Sox10βGeoBAC lines, we describe the usefulness of characterizing fortuitous deletions that occur during transgene integration. These transgene deletions both support our hypothesis that distant regions are needed for Sox10 expression and narrow the intervals that should be examined for the requisite regulatory elements. Phylogenetic alignments spanning the intervals lost from Sox10βGeoBAC deletion lines identify multiple evolutionarily conserved regions that are candidate elements that may be responsible for these effects. Moreover, these candidate elements are the locations of clustered binding sites for multiple neural crest associated transcription factors that may be regulating Sox10 expression. Our analysis and characterization of Sox10βGeoBAC expression opens avenues for continued investigation of the regulatory modules that coordinate the complex expression of Sox10 during development of multiple neural crest lineages.
RESULTS
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
Proximal 5′ Flanking Regions of Sox10 Do Not Confer Appropriate Cell Type-Specific Gene Expression In Vitro
Evaluation of sequence conservation at the immediate 5′ flank of Sox10 reveals extensive conservation among species as widely divergent as human, mouse, chick, and opossum, suggesting that these evolutionarily conserved sequences may be important for regulation of gene expression (Fig. 1A). To investigate the ability of conserved regions in close proximity with 5′ exons of Sox10 to confer cell type-specific expression, we linked sequences from exon 3 to −2.8 kb from the start site of transcription to a βGeo reporter cassette (Fig. 1B). This interval spans conserved islands, just upstream of exon 1, and highly conserved regions between exons 2 and 3. This −2.8Sox10βGeoShort transgene was transiently transfected into M-3 mouse melanoma cells and cultures of enteric glial cells (EGC) to evaluate the cell type-specific expression driven from these regions (Fig. 1C). Both M-3 and EGC cells express Sox10 at levels that are readily detectable by immunohistochemistry. However, after transfection of the −2.8Sox10βGeoShort construct into these cells, no βGal activity was detected in any of several rounds of transfection into EGC cells, although a few rare cells (∼1 cell /5,000) exhibited βGal staining in the M3 transfected cultures. We thoroughly documented that transfection assays were resulting in the successful uptake of our reporter constructs into both M-3 and EGC cells. Cotransfection of a CMV-dsRED reporter construct of similar size showed reasonable efficiencies of DNA uptake and expression of the reporter based on direct fluorescence imaging of cultured cells (Fig. 1C), yet subsequent processing of these cultures for βGal staining driven from the cotransfected −2.8Sox10βGeoShort construct showed rare low level expression in M-3 cells and no expression in EGC cells. Moreover, we confirmed that the βGal staining assay worked robustly in these cells types by performing parallel transfections of a CMV-βGal reporter construct. Both M-3 and EGC cells exhibited robust expression of dsRED and subsequent staining for βGal activity from the CMV-βGal reporter when cotranfected with these constructs. However, repeated analyses with the −2.8Sox10βGeoShort construct derived from independent reporter plasmid isolates consistently expressed infrequently in M-3 cells and not at all in EGC cells. These results suggest that cis-regulatory sequences needed to drive expression of Sox10 in a cell type-specific manner lie outside the proximal conserved regions associated with exons 1 to 3.

Figure 1. Evaluation of potential regulatory sequences in proximal 5′ flanking regions of Sox10. A: Genomic interval of the mouse Sox10 gene shows strong conservation across species in exons and proximal 5′ flanking sequences in multispecies phylogeny comparisons (black peaks in conservation track) viewed at the UCSC genome browser (http://www.genome.ucsc.edu/cgi-bin/hgGateway). B: Schematic diagram of the −2.8Sox10βGeoShort construct drawn beneath the phylogeny comparisons indicates the limited regions of flanking sequence incorporated into the reporter construct (black). C: Immunohistochemisty for Sox10 in mouse M-3 melanoma cells and cultured enteric glial cells (EGC) demonstrates readily detectable levels of endogenous Sox10 expression. M3 and EGC cells cotransfected with dsRed-Express-N1 and pCMVβGeo exhibit comparable expression levels of both constructs. M3 cells cotransfected with dsRed-Express-N1 and −2.8 kb Sox10βGeo exhibit red fluorescence but only rare, single β-galactosidase (βGal) -positive cells (arrow). EGC cotransfected with dsRed-Express-N1 and −2.8 kb Sox10βGeoShort readily express red fluorescence but no βGal activity.
Extensive Flanking Regions Present in an Unmodified Sox10 BAC Are Capable of Conferring Appropriate Tissue-Specific Expression In Vivo
Sox9 is regulated by elements at >350 kb from the start site of transcription (Wunderle et al.,1998). Lack of anticipated expression from the −2.8Sox10β GeoShort construct and the conservation of gene structure between these two gene family members led us to investigate whether Sox10 is also regulated by distant elements. As a first step in this process, we tested whether the 218-kb Sox10 BAC clone 28011, hereafter designated Sox10WT28011, contained all necessary elements for tissue-specific expression. Founder animals carrying the Sox10WT28011 transgene derived from C57BL6/J genomic DNA were generated and out-crossed to C3HeB/FeJ (C3Fe) mice to establish lines. Transgenic progeny were identified by genotyping for BAC-end polymerase chain reaction (PCR) products and an internal Sox10 3′ untranslated region (UTR) insertion/deletion variant (Sox10 3′ UTR marker) that identifies the B6 strain from which the Sox10WT28011 transgene derived. From six original founders, three transmitted the transgene to offspring and two of these lines were found to carry the complete transgene based on the presence of BAC-end PCR products and the Sox10 3′ UTR marker. Based on the identification of complete Sox10WT28011 transgene in third generation C3Fe backcross progeny, we concluded that the Sox10WT28011 BAC was stably integrated, intact, and could be used in crosses for complementation studies.
The Sox10LacZ-KO/+ strain is haploinsufficient for Sox10 and, consequently, exhibits deficits in neural crest-derived cell types, including melanocytes and enteric ganglia that manifest as spotting of the coat (white belly spot and white feet) and hypo- and/or aganglionosis of the distal intestine (Britsch et al.,2001). This line has been maintained by backcrosses to C3Fe and is congenic on this inbred background. To determine if the Sox10WT28011 transgene carried the necessary regulatory elements to convey appropriate neural crest gene expression, we mated C3Fe.Sox10LacZ-KO/+ mice with Sox10WT28011 transgenic animals and evaluated the progeny for complementation of neural crest phenotypes that normally accompany Sox10 haploinsufficiency. In 34 offspring evaluated, all 10 pups that were Sox10LacZ-KO/+ and negative for Sox10WT28011 transgene exhibited the characteristic white feet and belly spot (Fig. 2). Of the 24 mice that were positive for both Sox10LacZ-KO/+ knockin allele and the Sox10WT28011BAC transgene, all exhibited total complementation of coat spotting (i.e., no belly spot and no white feet, Fig. 2, inset table). Gastrointestinal tracts from each of these animals were harvested, subjected to acetylcholinesterase (AChE) enzyme histochemistry, and the lengths of any regions of hypoganglionosis or aganglionosis were quantified by routine methods (see Experimental Procedures section, also Cantrell et al.,2004). Staining and phenotyping of gastrointestinal tracts was performed in a blinded manner followed by genotyping to classify animals into genotype categories. The 10 mice positive for Sox10LacZ-KO/+ but negative for Sox10WT28011 manifested hypo- and aganglionosis involving on average 3.1% of the length of the intestine (“% Affect”). Aganglionosis alone (“% Agang”) was documented in a mean gut length of 0.74% in these same animals. In stark contrast, none of the 24 mice positive for both Sox10LacZ-KO/+ and WT28011 showed any hypo- or aganglionosis (Fig. 2, inset table).

Figure 2. Complementation of Sox10LacZ-KO/+ neural crest (NC) deficits by Sox10 expression driven from the Sox10WT28011 bacterial artificial chromosome (BAC). Schematic diagram of the cross between Sox10WT28011 transgenic mice and C3Fe.Sox10LacZ-KO/+ mutants. Sox10LacZ-KO/+ progeny that do not carry the transgene (WT28011 BAC− genotype) exhibit white feet and belly spotting characteristic of the Sox10LacZ-KO/+ phenotype. Sox10LacZ-KO/+ pups that carry the transgene (WT28011 BAC+ genotype) exhibit absence of ventral spotting and white feet. Inset table summarizes complementation results for both pigmentation and aganglionosis phenotypes observed in 11 litters. Percent aganglionosis was determined by acetylcholinesterase whole-mount staining to visualize the length of aganglionic gut relative to the total gut length from gastric sphincter to anus. Percentage affected gut length includes both hygo- and aganglionic gut length divided by the total gut length. The asterisk indicates that 8 of 10 animals with white feet also had belly spots.
Generation and Analysis of Sox10βGeoBAC Transgenic Mice
After documenting that Sox10WT28011BAC contained regulatory elements necessary to complement pigmentary and enteric deficits caused by Sox10 haploinsufficiency, we used in vitro homologous recombination methods in E. coli (Lee et al.,2001) to engineer a β-galactosidase (βGal)/neomycin fusion reporter cassette (βGeo) into the Sox10WT28011BAC backbone. The ATG of the βGeo cassette was fused in frame with the endogenous ATG start codon of Sox10 (Fig. 3A). This approach was designed and implemented to strictly insert the cassette and avoid deletion of any sequences from the Sox10 locus. The resultant Sox10βGeoBAC construct was injected into fertilized oocytes, and five founders were identified that carried sequences for an internal Sox10βGeoBAC marker from a total of 83 pups. Four of these founders passed the transgene to their offspring. Additional genotyping established that two of these founders also carried sequences for the BAC-end T7 and Sp6 markers, suggesting that the Sox10βGeoBAC was intact.

Figure 3. Sox10βGeoBAC transgene expression compared to endogenous Sox10 in wild-type embryos and Sox10LacZ-KO/+ knockin embryos. A: Schematic diagram of Sox10βGeoBAC targeting vector and homologous recombination into the wild-type Sox10WT28011 BAC depicts Sox10 exons (black rectangles), initiator ATG (green), and LacZ/Neo (βGeo) fusion reporter (blue/red). Sox10 homology arms (each approximately 500 bp) are shown on either side of the βGeo sequence. B: Whole-mount Sox10 in situ hybridization of wild-type embryos at embryonic day (E) 8.5 and E10.5 adjacent to panels of whole-mount β-galactosidase (βGal) staining of Sox10βGeoBAC transgenic embryos and Sox10LacZ-KO/+ haploinsufficient embryos at indicated stages. Lower panels compare transgenic Sox10βGeoBAC embryos at E13.5 to whole-mount βGal staining of Sox10LacZ-KO/+ mutant embryos. r, rhombencephalon; tg, trigeminal ganglion; ov, otic vesicle; V, vagus and glossopharyngeal nerves; drg, dorsal root ganglion; arrowhead, small and large intestine.
To establish that the Sox10βGeoBAC transgene conferred expression on the βGeo reporter analogous to that of endogenous Sox10 regulatory regions, we compared whole-mount Sox10 in situ hybridizations performed in nontransgenic embryos and βGal-stained Sox10βGeoBAC transgenic embryos at embryonic day (E) 8.5 and E10.5 (Fig. 3B). In addition, we compared Sox10βGeoBAC expression to C3Fe.Sox10LacZ-KO/+ knockin embryos. The Sox10LacZ-KO/+ line has been characterized extensively by others, and expression in this line appears analogous in many respects to endogenous Sox10 expression (Britsch et al.,2001; Maka et al.,2005). At E8.5 in wild-type embryos, Sox10 mRNA is detected in the anterior neural folds that give rise to the central nervous system (Fig. 3B, upper panel) and βGal staining is similarly observed in both the Sox10LacZ-KO/+ and Sox10βGeoBAC embryos. Comparison of embryos at E10.5 revealed multiple similarities of βGal-staining pattern and intensity between wild-type embryos and Sox10βGeoBAC embryos in the trigeminal ganglion, otic vesicle, vagus and glossopharyngeal nerves, as well as the developing spinal nerves (Fig. 3B, middle panels). βGal staining in Sox10LacZ-KO/+ mutant embryos was similar but not identical to that seen in wild-type and Sox10βGeoBAC embryos. Upon close inspection, deficiencies of cranial ganglia pattern and stain intensity were evident in the Sox10LacZ-KO/+ embryos, accompanied by diffuse staining throughout the brachial arches. Although histological sections through E10.5 Sox10β GeoBAC and Sox10LacZ-KO/+ mutant embryos reveal comparable βGal-localization in DRG (Supplementary Figure S1, which can be viewed at http://interscience.wiley.com/jpages/1058-8388/suppmat), intensity of βGal stain in DRG of whole-mount Sox10LacZ-KO/+ mutants appears subtly greater when compared to wild-type and Sox10β GeoBAC embryos at E10.5 and may be due to the altered migration/survival of neural crest cells in DRG development that has been described in Sox10LacZ mutants (Paratore et al.,2001; Sonnenberg-Riethmacher et al.,2001). Sox10βGeoBAC embryos at E13.5 show overall similar patterns of βGal staining throughout the developing peripheral nervous system, albeit at slightly lower levels compared to Sox10LacZ-KO/+ mutant embryos (Fig. 3B, bottom panel). Views of the ventral aspect of each of these embryos reveal darkly stained enteric neural crest within the intestine (arrowhead), which is still external to the body at this point in development. Whole-mount in situ hybridization of Sox10 mRNA at E13.5 is difficult to achieve due to probe penetration in tissues, but expression of Sox10 in enteric neural crest is clearly visible in embryonic gut at this age (data not shown).
Sox10βGeoBAC Is Appropriately Expressed in Enteric NC Precusors
Sox10 plays an essential role in ENS development and alteration of its expression gives rise to aganglionosis of the distal gut due to failure of enteric progenitors to complete the migratory process. We rigorously evaluated temporal and spatial βGal expression in subdissected, embryonic gastrointestinal tracts from Sox10βGeoBAC embryos. As shown in Figure 4, migration of βGal-stained cells in our Sox10βGeoBAC transgenic line is virtually identical to that of wild-type enteric NC cells visualized by immunohistochemical detection of Phox2b (Fig. 4, white arrowheads). By E11.5, Sox10+ ENS precursors have migrated through the proximal aspect of the gastrointestinal tract and have rounded the cecal bulge and are entering the colon. Normally, migration progresses into the large intestine by E12.5 and colonization of entire length of the intestine is nearly complete by E13.5. The βGal staining we observe for the Sox10βGeoBAC line is identical to the time course of normal ENS development that has been well documented by others in the field (Young et al.,1998, 2004; Young and Newgreen,2001; Anderson et al.,2006). In contrast, the Sox10LacZ-KO/+ haploinsufficient mutants exhibit a slight delay in migration as early as E11.5 when βGal-stained cells have just entered the proximal side of the cecum (Fig. 4, black arrowheads). This delay in migration becomes more pronounced at E13.5 as βGal-stained enteric progenitors in Sox10LacZ-KO/+ mutants are not yet halfway through the developing colon.

Figure 4. Sox10βGeoBAC enteric expression visualizes normal temporal migration of enteric nervous system (ENS) precursors in contrast to Sox10LacZ-KO/+ expression that is altered by haploinsufficiency. Subdissected, β-galactosidase (βGal) stained gastrointestinal tracts from Sox10LacZ-KO/+ and Sox10βGeoBAC embryos at embryonic day (E) 11.5 and E13.5. White arrowheads mark the distal-most point of βGal staining in Sox10βGeoBAC embryos that is equivalent to that seen by immunohistochemistry for Phox2b (right panel) at E11.5. Black arrowheads mark the distal-most point of βGal staining in Sox10LacZ-KO/+ embryos that is delayed behind normal migration. e, esophagus; c, cecum; a, anus.
Sox10βGeoBAC Reporter Expression in Melanocytes, Developing Peripheral Nervous System, and Other NC-Derived Tissues
Patients with alterations in SOX10 can exhibit a wide variety of neural crest deficiencies ranging from hypopigmentation to impaired autonomic control of cardiovascular function, blood pressure, pupillary light reflexes, and reduced tear production (Staiano et al.,1999; Korsch et al.,2001). Consequently, we performed gross and microscopic analyses of tissues outside the ENS to establish additional patterns of Sox10βGeoBAC expression that might further implicate endogenous Sox10 in these clinical phenotypes.
Sox10 function in NC-derived melanocytes has been extensively studied and reported by others (for review, see Mollaaghababa and Pavan,2003). Consistent with prior reports, we observed βGal staining from Sox10βGeoBAC in melanocytes within the epidermis and hair follicles of young adult transgenic mice (Fig. 5).

Figure 5. Sox10βGeoBAC transgene expression is present in the melanocyte lineage. Histologic sections through tail snips (top, ×100) of Sox10βGeoBAC post-natal mice show β-galactosidase (βGal) -stained nerve fibers and single melanocytes within the epidermis. Higher-magnification (bottom, ×400) view of hair follicles in the tail reveal βGal staining of melanocytes in the apex (arrowhead) of a hair follicle.
In organs subdissected from an E14.5 Sox10βGeoBAC embryo, βGal expression is apparent in cells that accompany sprouting nerve twigs as they migrate into the lung (Fig. 6A), over the posterior aspect of the heart (Fig. 6B), upward from the base of the bladder (Fig. 6C), through the pancreas (Fig. 6D), and over the surface of the testis (Fig. 6E). Colocalization of βGal immunoreactivity with the peripheral glial marker B-FABP (Kurtz et al.,1994) indicates that these cells are migrating glial cells (Supplementary Figure S2). Sox10βGeoBAC expression accompanies the radial and ulnar nerves of the forepaw, and closer inspection reveals mesenchymal condensations interposed between the developing phalanxes (Fig. 6F). These mesenchymal components are most clearly seen on the tissue section taken through the length of the forepaw (Fig. 6F′). In Figure 6G, the darkly stained adrenal gland rests atop the kidney; and as expected, Sox10βGeoBAC expression accompanies the peripheral nerve innervation along the vasculature of the developing kidney (arrowhead). Sox10βGeoBAC expression is observed in the parafollicular C-cells of the developing thyroid (Fig. 6H, arrowheads), as well as in the thymus (Fig. 6I). Both the thymus and the C-cells of the thyroid have been established as being of neural crest origin (Pearse and Polak,1971; Kuratani and Bockman,1990). Nerve fibers were visible migrating into the iris of the E14.5 eye, consistent with reduced pupillary responses of HSCR patients to light and literature reports of reduced nerve endings and altered melanosomes in heterochromia iridis in some individuals (Mullaney et al.,1998). No Sox10β GeoBAC expression was observed in embryonic liver or splenic tissue (data not shown).

Figure 6. Embryonic Sox10βGeoBAC transgene expression in the developing peripheral nervous system and in neural crest-derived tissues. A–E: Peripheral nerve innervation of developing lung (A), heart (B), bladder (C), pancreas (D), and testis (E) in an embryonic day (E) 14.5 Sox10βGeoBAC embryo. Arrowheads, glia cells along nerve sprouts migrating into developing organs; Eso, esophagus; V, vagal nerve; LA, left atrium; RA, right atrium; PG, pelvic ganglion; P, prostate; R, rectum; Epi, epididymis. F–I: Expression of Sox10βGeoBAC in E14.5 neural crest-derived tissues. F,F′: Left forepaw, palmar surface, whole-mount, and subsequent histologic section. Arrowhead, mesenchymal condensations between developing phalanges; Rad, radial nerve; Uln, ulnar nerve. G: Darkly stained adrenal gland atop kidney. Arrowhead, migrating nerve sprouts; Ure, ureter. H: Histologic section of thyroid, with neural crest-derived parafollicular C-cells (arrowheads) interspersed in close proximity to follicles, ×400 magnification. Ner, nerve. I: Thymus, ×400 magnification.
Sox10βGeoBAC Reporter Expression in Salivary and Lacrimal Glands
It has long been known that the mesenchymal tissue comprising the salivary glands is of neural crest origin (Jaskoll et al.,2002), and we readily observe strong Sox10βGeoBAC expression in the submaxillary glands of whole-mount E14.5 embryos (Fig. 7A,B). We subsequently generated histological sections of the submaxillary glands, anticipating Sox10βGeoBAC expression within the glandular mesenchyme. Quite surprisingly, Sox10βGeoBAC expression is observed within the ductular epithelium and acinar cells (Fig. 7C, arrowheads and arrows, respectively) and not in mesenchymal tissue. In situ hybridization with Sox10 antisense probe hybridized on paraffin sections of submandibular salivary gland reveals high levels of endogenous Sox10 expression in the acini (Fig. 7D). Sox10βGeoBAC expression is also seen in the lacrimal glands, located rostral and nasal to the eye (Fig. 7E). βGal staining is present in acinar cells of the parotid glands and the salivary glands surrounding the trachea; no mesenchymal staining was observed in these sites (data not shown).

Figure 7. Sox10βGeoBAC transgene expression in embryonic day (E) 14.5 salivary and lacrimal glands. A: Whole-mount β-galactosidase (βGal) staining of Sox10βGeoBAC embryos cut transversely through cervical vertebrae just below the level of mandible. View is into the base of the skull, with the snout at the top of the picture. Submaxillary salivary glands are indicated by arrowheads. B: Subdissected submaxillary gland from A shows grape-like clusters of βGal-stained acini. C: Histologic section through the submaxillary gland shows marked βGal staining within the acini (arrows) and ductal epithelium (arrowheads), ×400 magnification. D: In situ hybridization with Sox10 antisense riboprobe on paraffin sections reveals endogenous expression of Sox10 as dark brown stain in acini and not in mesenchymal cells (counterstained with nuclear fast red) similar to that seen by Sox10βGeoBAC transgene expression. E: βGal-stained lacrimal gland is indicated above and medial to the left eye (arrowhead). Nas and Ros, nasal and rostral aspects of the embryo, respectively. Nerve fibers innervating the iris are clearly visible.
Analysis and Mapping of Distant Regulatory Elements in Three Stable Internally Deleted Transgenic Lines Derived From Microinjection of the Sox10βGeoBAC Construct
As stated above, injection of the Sox10βGeoBAC yielded four founders that were positive for the Sox10β GeoBAC internal marker and passed the transgene to subsequent progeny. Two of the four also carry the BAC-end Sp6 and T7 markers, delineating the ends of the 28011 BAC. We βGal stained second- and third-generation offspring from each of the four transgenic lines to investigate the patterns of Sox10βGeoBAC expression. These lines are referred to hereafter as intact-Sox10βGeoBAC, Deletion line A, Deletion line B, and Deletion line C based on observed distinctions in expression and extent of transgene construct present (see below). Figure 8 shows embryos from each line harvested and βGal stained at E11.5 and E14.5. The intact-Sox10βGeoBAC embryos represent the complete line characterized in the above-described studies. Embryos from line A and line B were derived from the two founders that genotyped positive for the internal Sox10βGeoBAC marker but negative for the BAC ends (i.e., negative for Sp6 and T7). Markedly decreased transgene expression was observed in Deletion line A. Staining was primarily limited to the otic vesicle and to sparse peripheral nerves and melanocytes in adult tissues. This same pattern of staining was observed at other dissection time points (data not shown). The overall pattern of staining in line B at both E11.5 and E14.5 was lighter and more diffuse relative to Sox10βGeoBAC, although the disparity was most prominent at E11.5. The staining pattern of line C was quite similar to Sox10βGeoBAC at E11.5, although less intense at E14.5. In both lines B and C, expression of Sox10βGeoBAC in the peripheral aspects of the embryos (i.e., snout and limbs) was notably decreased. The inset table of Figure 8 summarizes each site of expression observed for the Deletion lines and their relative levels of βGal staining by comparison to the intact Sox10βGeoBAC.

Figure 8. Comparison of intact-Sox10βGeoBAC expression to Deletion transgene lines A, B, and C. A: Whole-mount β-galactosidase (βGal) staining of embryonic day (E) 11.5 and E14.5 embryos that either genotype positive for the intact-Sox10βGeoBAC (left-most panels) or genotype positive for limited regions of the transgene in each of the three Deletion BAC lines is shown. The apparent βGal staining in the midsection of the E11.5 line A embryo is staining of the adherent placental membranes and is not present in the gastrointestinal tract. B: Inset table summarizes sites of expression for each line that were observed in tissues at time points spanning from E11.5 to E14.5 and in postnatal pups. Large circles indicate highest expression levels observed in the intact-Sox10βGeoBAC. Smaller circles indicate relatively lower expression. Open circles indicate a temporal difference seen in expression of Deletion lines B and C in enteric NC (see text and Fig. 9).

Figure 9. Developmental time course and comparison of enteric neural crest (NC) migration in intact-Sox10βGeoBAC and the three Deletion lines A, B, and C. Subdissected, β-galactosidase (βGal) -stained gastrointestinal tracts from intact-Sox10βGeoBAC, Deletion A, Deletion B, and Deletion C embryos at embryonic day (E) 11.5, E13.5, and in gastrointestinal muscle strips from adult mice. Arrowheads mark the furthest point of βGal staining detected in each line at E11.5 and E13.5. Enteric nervous system (ENS) expression is missing in cecal regions of all three Deletion lines at E11.5. The furthest extent of βGal staining detected in Deletion lines B and C at both E11.5 and E13.5 (black arrowheads) is notably behind the wave front of migrating enteric NC labeled by βGal staining in the intact-Sox10βGeoBAC embryos (white arrowheads). βGal staining of myenteric plexi in gastrointestinal muscle strips harvested from young adult (6–8 weeks) mice transgenic for either the intact-Sox10βGeoBAC or each of the Deletion lines, A, B, and C is shown (bottom row).
We also documented expression of the intact-Sox10βGeoBAC line and Deletion lines A, B, and C in developing and mature ENS (Fig. 9). Of interest, we observed that, whereas Deletion Lines B and C differed notably from the intact-Sox10βGeoBAC expression at E11.5 and E13.5, evaluation of βGal staining in gut muscle strips from mature animals revealed normal staining patterns in the ENS. Deletion line A did not show expression at any time in the ENS. This finding is reminiscent of the complete lack of expression by the −2.8 kbSox10β Geo construct in transfected enteric glial cells. Both Deletion lines B and C produced βGal staining in developing ENS at E11.5 and E13.5. However, the pattern of βGal staining in these lines (Fig. 9, black arrowheads) was temporally delayed behind that of the intact-Sox10βGeoBAC line (Fig. 9, white arrowheads) at both stages, analogous to that seen in Sox10LacZ-KO/+ haploinsufficient mutants. Adult animals from Deletions lines B and C exhibited normal GI morphology; no pups were observed with megacolon, and no defects in ENS patterning were detected by acetylcholinesterase staining (data not shown).
Given the observed differences in βGal staining in lines A, B, and C, we hypothesized that cis-regulatory sequences might have been inadvertently deleted from the transgene due to fragmentation of the BAC construct during pronuclear injection. Because the 28011 BAC was derived from C57BL/6J (B6) genomic DNA, polymorphic markers could be used to determine whether portions of the transgene were in fact present based on presence/absence of B6 alleles. We developed simple tandem repeat (STR) markers throughout the interval spanned by the 28011 BAC to determine which regions were missing in the transgenic lines. Using custom software (STRFinder, J.R. Smith, unpublished), we identified all microsatellite repeats in the 28011 BAC interval and evaluated these repeats for differences in repeat length between B6 (28011 BAC strain of origin) and C3Fe strains. This approach resulted in a panel of 16 markers that are distributed across the length of the 218 kb 28011 BAC at an average intermarker distance of ∼9 kb (Table 1). Subsequently, we genotyped transgenic progeny from the intact-Sox10βGeoBAC line and Deletion lines A, B, and C, (Fig. 10). All 16 STR markers generated heterozygous genotypes in the intact Sox10βGeoBAC line, indicating that the genomic interval derived from the B6-origin transgene was complete. In contrast, for each of lines A, B, and C, a subset of markers detected only C3Fe alleles, indicating that regions of the transgene derived originally from B6 genomic DNA were missing (Fig. 10).
| Marker | Forward primer sequence (5′ to 3′) | Reverse primer sequence (5′ to 3′) | Allele sizes |
|---|---|---|---|
| |||
| 166942GA | CTTGTACTCCAGCCTGAAAC | GCAGTAAGACTTGGAACTCC | B<C, 182 bp |
| 160190GT | GTAGGTCAGTTTCCCCAAG | CCAATACCCTCTTCTGACC | B<C, 230 bp |
| 146885CA | CCAGGTTTGAAATGAGGTC | CAGTGTTGCTACAACCAGAC | B>C, 150 bp |
| 139830CA | CTGGTCAGTAAGCAAGCAC | CTGGTCAGTAAGCAAGCAC | B<C, 155 bp |
| 138245CA | CAACAGTGCTTAGTGAATGAC | GATGAATCAGACCTCCTGG | B<C, 210 bp |
| 129700GATT | TGTAGCAGAGGAAATGTAGGG | CTTAAGAAGCAGAGGCAAATG | B<C, 220 bp |
| 118810TG | GGCATGAGAACTGATTCCAG | ACAGGAATCTGTCAAGGGTCT | B>C, 200 bp |
| 114556CA | GACCCTTGACACTTGGAG | CACAGGTGAGTGCTGTTC | B = 110;C = 120 |
| 108448GA | CCTGGTTTATCTGGTTCC | CCAGCCAACTCACTTTC | B > C, 102 bp |
| 102564TG | TGTGTATGGTCCAATCTGATG | ATACATCCCCAAACACATGC | B < C, 190 bp |
| 91263GA | GTCAGGAACTCTTGGGATG | CCAAGGGTACTGTGACCAG | B > C, 212 bp |
| 89954bTC | GGTGTGTGGCAGTAACCTG | CAGAACAGCCAATGGTTACA | B < C, 200 bp |
| 81611TG | CCCTGTGAACAAGACATCAA | CAGCTGGGAGAGAAACAGAT | B < C, 200 bp |
| 60429TC | GGATGAAACCCATGGTC | GGTCAGATGACTAGAGCAGTC | B = 160, C = 130 |
| 50985CA | GGGACATGTCTATCAAGCC | GGTTTGATGAACGTGAGC | B > C, 105 bp |
| 27549GT | GCCATTTGATAAAGTGGTTC | CGTAGGATCTGATCTCAGG | B < C, 172 bp |

Figure 10. Markers used to map integrity of Sox10βGeoBAC transgenic lines. A: Schematic diagram of the B6-derived transgene that carries B6 alleles at polymorphic markers through the interval of the Sox10 locus relative to the C3Fe alleles at the endogenous locus in N3 backcross mice. Positions of bacterial artificial chromosome (BAC) -end markers (Sp6, T7), a polymorphic marker in the Sox10 3′ untranslated region and a typical simple tandem repeat (STR) marker in the interval (STR27549, asterisk) used to define the extent of Sox10βGeoBAC present in transgenic lines are shown. For clarity, the positions of only a single STR is indicated and only the exons of Sox10 are depicted on the line diagram of the BAC insert. B: Electrophoresis patterns of markers are shown for two individuals in each Sox10βGeoBAC line relative to BAC copy number controls diluted in genomic DNA. C: Genotypes of markers through the 28O11 interval for Sox10βGeoBAC transgenics are tabulated. When the transgene is present, STR markers carried by the BAC produce heterozygous genotypes composed of both B6 and C3Fe alleles (b/c). T7 and Sp6 BAC-end and βGal markers are only detected in animals carrying the BAC transgene. For clarity, only regions that carried B6 alleles identifying transgene sequences are indicated (C/C genotypes are not shown).
To evaluate the genomic interval around Sox10 for conserved noncoding sequences that might represent potential regulatory regions, we aligned the Sox10 interval STR markers to the genome assembly annotated on the UCSC genome browser. Noncoding sequences that have been conserved across multiple species (multi-species conserved, MCS) have been shown to function as long-range cis-regulatory elements for several developmentally regulated genes (Mortlock et al.,2003; Nobrega et al.,2003; Ahituv et al.,2004; Sagai et al.,2005; Woolfe et al.,2005). These alignments revealed that each of the Deletion lines was missing significant regions 5′ of Sox10 (Fig. 11). The intervals that were lost from each Deletion line are depicted in Figure 11 with respect to the exons of Sox10. Deletion line A was missing the greatest extent of the 28O11 BAC backbone. Deletion line B carries an additional 20–30 kb of sequence 5′ of the Sox10 transcription start site. Deletion line C lacks an internal segment of 25–35 kb 5′ of the Sox10 gene. In the interval 5′ of Sox10, there are multiple regions that show significant sequence identify across vertebrate species. Six of these regions are notably conserved with PhastCon LOD scores of greater than 100. Of interest, the regions lost in the Deletion lines coincide with these MCS elements that are conserved across multiple species ranging from human to chick. Deletion line A lacks all six MCS regions, whereas Deletion lines B and C both lack regions MCS-5 and MCS-6 and may also share loss of MCS-4. Due to the distribution of informative STR markers, the left boundary of Deletion C is ambiguous and will require identification of additional polymorphic markers to definitively establish whether MCS-4 is also present in Deletion line C.

Figure 11. Intervals lost from Sox10βGeoBAC Deletion lines coincide with multispecies conserved (MCS) elements within the Sox10 interval. Custom tract generated by the UCSC genome browser depicts a portion of the interval spanned by Sox10βGeoBAC (blue). Heavy black bars indicate the genomic interval over which a Deletion line genotyped positive for both B6 and C3Fe alleles with simple tandem repeat (STR) markers, indicating the presence of bacterial artificial chromosome (BAC) sequences at that particular position in the line. Empty gaps indicate intervals for which a marker only detected C3Fe alleles, indicating segments of the BAC transgene that had been lost during integration into the genome. Striped intervals indicate regions of ambiguity through which BAC sequences might be present but could not be evaluated because additional informative markers were not available. Note the common regions shared by deletion lines B and C that contain MCS elements highly conserved across species (black peaks in the conservation track). The vertical viewing range in the conservation track is set at 0.8–1 to accentuate MCS elements.
To investigate the possibility that the MCS regions lost from the Sox10βGeoBAC deletion lines, might contain functional cis-regulatory elements that participate in control of Sox10 expression, we evaluated the density of transcription factor binding sites in these regions. We interrogated MCS-1 through -6 using rVista alignments between human and mouse sequences to establish the presence of known transcription factor binding sites (TFBS). This process identified a high density of clustered TFBS within each MCS (Fig. 10B). A remarkable number of these transcription factors are associated with NC development based on literature searches in PubMed. The density of TFBS within these noncoding conserved regions suggests the presence of functional elements that may participate in control of Sox10 expression.
DISCUSSION
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
We present a compilation of molecular genetic and embryological analyses aimed at defining genomic regions that are required for expression of Sox10. Our analysis in vitro demonstrates that gene regions associated with 5′ exons are insufficient to drive cell type-specific expression of Sox10. To facilitate future studies of regulatory factors that control expression of this neural crest specifier and facilitate analysis of Sox10's role in autonomic dysfunction, we have derived an essential tool, the Sox10βGeoBAC. All together, our in vitro and in vivo studies indicate that Sox10 expression is controlled by distant cis-regulatory elements. Our analysis corroborates the value of BAC transgenesis for identification of long-range regulatory regions and introduces the novel approach of using polymorphic markers to map internal deletions in large insert transgenes for identification of conserved regulatory elements. The Sox10βGeoBAC transgenics described here enable one of the earliest opportunities for tracing enteric progenitors in the context of normal NC development. Furthermore, our characterization of Sox10 expression patterns suggests that this gene may have a functional role in tissues outside the confines of the central and peripheral nervous systems.
Few studies exist that shed light on the genes or regions of the genome that control Sox10 expression in vivo. As a means to begin investigating potential regulatory elements, our goal was to first create a Sox10βGeo reporter strain. Our results in transfection experiments indicated that immediate regions surrounding the first three exons of the gene were not sufficient to drive proper expression in cells in vitro. We believed the most likely explanation to be the absence of required, more distant regulatory elements. For this reason, we turned our efforts toward identification of large insert BAC clones that would be more likely to harbor essential cis-regulatory regions. We identified a large BAC clone, 28011 (218 kb), in the Ensembl database spanning the Sox10 locus that contains nine additional genes, but none known to be related to neural crest function or development. Before proceeding with modification of this BAC, we generated transgenic mice carrying the unmodified 28011 clone (Sox10WT28011 BAC) to evaluate the ability of present regions to drive Sox10 expression and complement Sox10 deficiency in other mutant lines. We confirmed the ability of the Sox10WT28011 BAC to complement the enteric and melanocyte deficiencies that result from Sox10 haploinsufficiency in Sox10LacZ-KO/+ mice. Full complementation of hypo- and aganglionosis in the ENS as well as normal pigmentation in Sox10LacZ-KO/+ mutants carrying the Sox10WT28011 BAC transgene demonstrates that the interval spanned by this BAC contains essential regulatory elements to drive expression of Sox10 in these neural crest lineages (Fig. 3). We did not observe unusual phenotypes in Sox10WT28011 BAC transgenic mice that might have been attributed to increased ploidy of other genes present on the 28011 BAC.
With ability of the Sox10WT28011 BAC to complement Sox10 deficiency confirmed, we utilized established BAC modification techniques to insert a LacZ/Neo cassette in-frame with the initiating ATG (Lee et al.,2001). Because previous reporter lines derived from targeting the Sox10 locus resulted in haploinsufficiency (Britsch et al.,2001; Ludwig et al.,2004), we believed a transgenic approach would be optimal to leave the endogenous Sox10 loci unaltered, thus avoiding potential complications of haploinsufficiency and facilitating future studies of normal neural crest development. Our strategy for modification relied on simple insertion of the reporter cassette, to avoid unintentional deletion of potential regulatory regions and leave all exonic and intronic sequences intact.
Rigorous comparison of Sox10βGeoBAC expression with whole-mount Sox10 in situ hybridizations of wild-type embryos (Fig. 3) was performed. Our results confirm that extensive flanking regions carried in the Sox10βGeoBAC confer expression of the βGeo reporter in patterns analogous to those previously reported for initiation of Sox10 expression in development of the peripheral nervous system. The overall patterns of βGal staining observed in whole-mount Sox10βGeoBAC transgenic embryos are remarkably similar to in situ hybridizations on wild-type embryos, particularly in cranial ganglia, DRG, and the sympathetic chain. Importantly for future studies of development and gene regulation in the ENS, the migration patterns and timing of βGal reporter expression in sub-dissected, gastrointestinal tracts from Sox10βGeoBAC transgenic embryos are identical to that described in the literature (Young et al.,1998; Young and Newgreen,2001).
Transgenic lines have been particularly informative for analysis of ENS development and pathogenesis. Regulatory regions of dopamine β-hydroxylase linked to βGal (Mercer et al.,1991) have been used to visualize enteric neuron progenitors in normal development (Kapur,2000; Stewart et al.,2003) and in mouse models of HSCR (Kapur et al.,1992; Kapur,1999). Similarly Hox11L1-βGal transgenics have enabled studies of ENS in mouse models of intestinal pseudo-obstruction (Parisi et al.,2003). Because Sox10 expression offers one of the earliest entry points into enteric NC development, the Sox10βGeoBAC transgenics described here and subsequent transgenics that incorporate Sox10 regulatory regions from the WT28O11 BAC will enable analyses of lineage and migration of NC during their entry into the developing gut, independent of immunological reagents.
Concurrent with our analysis of Sox10βGeoBAC transgene expression we compared Sox10βGeoBAC expression to LacZ patterns in Sox10LacZ-KO/+ mutant embryos. Comparison with the Sox10LacZ-KO/+ line was helpful, because probe penetration issues severely limit whole-mount in situ hybridization at and beyond E12.5. However the Sox10LacZ-KO/+ line is haploinsufficient for Sox10 and, thus, exhibits multiple deficiencies of neural crest migration and differentiation (Britsch et al.,2001; Sonnenberg-Riethmacher et al.,2001; Paratore et al.,2002). This finding is clearly evident in Sox10LacZ-KO/+ embryos where deficiencies of cranial ganglia (Fig. 3B) and abnormal migration of DRG precursors are apparent by comparison to the wild-type in situ and the Sox10βGeoBAC transgenic. Notably, migration of βGal-stained enteric NC in C3Fe.Sox10LacZ-KO/+ embryos was also significantly delayed by comparison (Fig. 4). These differences are consistent with prior reports describing aganglionic megacolon (Britsch et al.,2001) and delays in migration of NC precursors in Sox10LacZ-KO/+ mutants (Paratore et al.,2002). Thus, it is not surprising that Sox10LacZ-KO/+ βGal staining patterns are not entirely equivalent when compared to the transgenic Sox10βGeoBAC animals that have normal levels of Sox10 protein generated from the intact endogenous locus.
Expression in cranial ganglia, DRG, and sympathetic ganglia have been conferred by the regions carried in the Sox10βGeoBAC transgene. However, there are subtle differences in staining intensity of other structures including forelimbs, nasal process, and midbrain. There are several possibilities that could account for these differences in expression between the Sox10βGeoBAC transgenics and the Sox10LacZ-KO/+ line. Migration or proliferation of Sox10+ cells in these areas may be delayed in Sox10LacZ-KO/+ mutants resulting in aberrant NC development. Some of the subtle differences in expression between these lines might be due to loss of regulatory elements from the highly conserved regions within introns 3–4, which are absent in the Sox10LacZ-KO/+ line (Britsch et al.,2001). Although the strength of expression in the knock-in mutants argues that if such elements are absent, they are most likely repressor elements as at all stages the knockin Sox10LacZ-KO/+ mutants show more intense staining than the Sox10βGeoBAC transgenics. Alternatively, there may be additional elements at even greater distances than those included in our Sox10βGeoBAC that serve to boost overall transcription from the Sox10 locus. Although there is always the possibility with transgenics that position effects result in ectopic expression, we did not observe any expression in Sox10βGeoBAC transgenic embryos that was not also present in wild-type in situ hybridizations or sectioned tissues of Sox10LacZ-KO/+ mutants. The absence of ectopic expression in any of the Sox10βGeoBAC transgenic lines is consistent with accumulating analyses of BAC transgenics, which suggests that the extensive flanking regions incorporated in such constructs make BAC transgenics less susceptible to position effects and more likely to confer position independent transgene expression (Camper,2000; Giraldo and Montoliu,2001; Wells and Carter,2001).
Once we had established that regulatory regions carried by the Sox10βGeoBAC conferred Sox10 expression in the peripheral and enteric nervous systems, we began a systematic examination of individual embryonic tissues and organs. The Sox10βGeoBAC transgene produced anticipated expression of the βGal reporter in melanocytes (Fig. 5). A branching, twig-like pattern of βGal staining was observed in glial cells that accompanied the progression of peripheral nerves into and over various embryonic organs, including the lungs, heart, bladder, testis, pancreas, arteries, and intestinal tract. Our findings corroborate the recent report of Sox10 expression in the intrinsic ganglia in the lung (Burns and Delalande,2005) and autonomic nerves of embryonic chick heart (Montero et al.,2002). Visualization of Sox10βGeoBAC expression in cardiac innervation raises an interesting correlation with the autonomic dysfunction and heart rate variability issues observed in a subset of WS4 patients with a documented Sox10 mutation (Staiano et al.,1999). Sox10 expression has also been documented previously in the pancreas (Lioubinski et al.,2003). Recent studies report that both Ret and glial cell line-derived neurotrophic factor play central roles in spermatogenesis (Jain et al.,2004; Kubota et al.,2004; Naughton et al.,2006). This finding is interesting, as Ret-Sox10 interaction has been suggested based on in vitro transfection studies and Sox10βGeoBAC expression accompanies innervation of the testis (Lang and Epstein,2003).
Looking outside the peripheral nervous system, we observed Sox10βGeoBAC expression in other neural crest-derived tissues. Others previously have identified Sox10 expression in the mesenchymal condensation of the developing digits in chick and mouse (Britsch et al.,2001; Chimal-Monroy et al.,2003). Reporter expression in the adrenal gland correlates well with the marked adrenal hypoplasia observed in homozygous Sox10Dom mice (Kapur,1999). βGal staining of the thymus and parafollicular cells of the thyroid suggest a potential role for Sox10 in these neural crest derivatives.
An interesting observation and potential avenue for future investigation is Sox10βGeoBAC expression in embryonic salivary acini and ductal epithelium. While the mesenchyme of salivary glands is known to be of neural crest origin, the origin of salivary acinar and ductular cells has never been attributed to neural crest (Jaskoll et al.,2002). Our identification of Sox10βGeoBAC expression in salivary gland is confirmed here by in situ hybridization of endogenous Sox10 in nontransgenic embryos. A similarly interesting finding is our observation of staining in lacrimal glands. Neural crest has been implicated in the origin of lacrimals glands (Tripathi and Tripathi,1990; Tonks et al.,2003), and the staining we see in these glands suggests that the dry, sometimes ulcerated eyes of Sox10Dom/+ mice may be due to Sox10 deficiency (Southard-Smith, unpublished observations).
We have not conducted a thorough characterization of Sox10βGeoBAC expression in the embryonic central nervous system. Sox10 expression has been reported in the cranial nerves, ventricular zone of the brain, spinal cord, and pineal gland (Cheng et al.,2000). However, brain tissue does not penetrate well for βGal staining, and future analysis of frozen sections will be required to confirm the presence of Sox10βGeoBAC expression in these structures.
Our report illustrates the wisdom of analyzing stable transgenic lines for studies of long-range regulatory elements and judicious choice of mouse strains for BAC clones, maintenance of transgenic lines, or recipient eggs during microinjection. At 218 kb, the Sox10WT28011 BAC is quite large and, thus, more susceptible to shearing and fragmentation during pronuclear injections. Our experiments produced the intact-Sox10βGeoBAC line whose expression patterns we have characterized in detail above and three deletion lines with varying degrees of retained BAC insert around the Sox10 gene. We have used these deletion lines to our advantage to gain information about the regulatory architecture of the genomic interval surrounding the locus. Others have used internal BAC deletions in positional cloning approaches to map genes, as in the case of the Clock mutation, where fortuitous breaks in BAC transgenics helped narrow down the critical region (Antoch et al.,1997). Deliberate deletions in BAC transgenics have been generated to identify gene regulatory regions (Yu et al.,1999; Mortlock et al.,2003); however, ours is the first report to our knowledge that has realized the advantage of fortuitous deletions in BAC transgenics to aid in mapping regulatory elements.
The patterns and temporal expression of each deletion line suggest the locations of potential elements and possible mechanisms of Sox10 transcriptional regulation. Deletion line A, with the smallest extent of flanking sequence, exhibits drastically limited staining restricted primarily to the melanocyte cells that contribute to the otic vesicle, with concurrent loss of expression in the enteric nervous system and the majority of the peripheral nervous system. Extremely low levels of expression were seen for Deletion line A in superior cervical ganglia at E14.5. However, Deletion line A completely lacked expression in enteric cells at any stage. This finding is consistent with lack of expression from the −2.8 kbSox10βGeo construct in transfected enteric glia. Deletion line B shows notably decreased staining intensity at E11.5; however, in older embryos at E14.5, the disparity in staining distribution and intensity relative to the intact-Sox10βGeoBAC is not as marked and expression in cells of the ENS is present (Fig. 9). Deletion line C showed minimal differences in expression pattern relative to the intact-Sox10βGeoBAC in whole-mount embryos at E14.5. However, like line B, deletion line C did not show normal temporal regulation of Sox10 expression in the developing ENS. In normal ENS development, migratory neural crest cells expressing Sox10 are rounding the cecal bulge of the gut at E11.5 and have reached the distal extent of the gut by E13.5. Both Deletion lines B and C show no expression of βGal at these locations either at E11.5 or E13.5 (Fig. 9, see arrowheads in E13.5 panels). Certainly neural crest cells migrate normally in both these lines, because normal innervation of the gut is present in mature animals (data not shown) and both Deletion lines B and C show ENS βGal staining in adult gut muscle strips. The loss of normal temporal regulation of the Sox10βGeoBAC reporter shared by Deletion lines B and C suggests that genomic regions deleted in both lines are necessary for correct temporal regulation of Sox10 in migratory neural crest of the ENS.
Our transfection results with the −2.8Sox10βGeoShort construct and our composite analysis of expression between the intact-Sox10βGeoBAC and the Deletion lines indicates that distant cis-regulatory elements are required for appropriate expression of Sox10 in peripheral nervous system lineages. The studies we present rely on characterization of transmitted transgenes in N3 backcross progeny where it is possible to definitively demonstrate the extent of transgene present. Similar analyses in founder embryos are complicated by the potential for multiple integration sites that can confound interpretation of expression studies.
Our conclusion that Sox10 is regulated by distant elements is consistent with loss of appropriate regulation and subsequent neural crest phenotypes described in a recent report of a new Sox10 allele, Sox10Hry, that arose by transgene insertion mutation (Antonellis et al.,2006). In the Sox10Hry allele, a 15.9-kb deletion 5′ of Sox10 removes an interval including the MCS-6 region identified in our studies and appears to be responsible for loss of Sox10 expression in early NC progenitors. The findings by Antonellis et al. are consistent with the loss of expression in our Sox10βGeoBAC Deletion lines B and C. Of interest, the absence of βGal expression in early enteric progenitors in Sox10βGeoBAC Deletion lines B and C in the context of their later expression in mature ENS cell types suggests that Sox10 transcription is temporally regulated by distinct elements in early NC and mature glial cell types. Future studies with the Sox10βGeoBAC reporter will enable precise deletion of elements to elucidate the role played by each MCS in the complex regulation of Sox10.
We believe the Sox10βGeoBAC reporter strain is an excellent tool with which to study the extent of neural crest contribution to autonomic innervation and development in a variety of organs. In addition, with the preliminary information provided by the spontaneous BAC deletions, rational design of targeted deletions within the Sox10βGeoBAC transgene can now be made to definitively delineate regions that regulate Sox10 expression in vivo. It has already been demonstrated that regulatory regions of genes like Ret that participate in nervous system development can harbor functional variants that contribute to complex disease phenotypes (Emison et al.,2005; Grice et al.,2005). The types of approaches we present can be used to rapidly map variation in regulatory sequences carried by BAC transgenics (between mouse strains or between species, e.g., human BACs in transgenic mice) to provide essential insight into complex regulatory strategies of developmentally regulated genes.
EXPERIMENTAL PROCEDURES
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
The −2.8 kb Sox10βGeo Transgene Construction and Transfection
The −2.8 kb Sox10βGeo construct was made by inserting a 4.7-kb fragment from mouse BAC clone 43P19 (Southard-Smith et al.,1999) composed of 2.8 kb of 5′ flanking sequence upstream of Sox10 exons 1 through 3 with a LacZ/Neo (βGeo) reporter construct (Friedrich and Soriano,1991). The lengths of sequence from the Sox10 gene incorporated into this construct included Chr15: 79216528-79219401 as annotated on the March 2005 mouse assembly. The completed construct linked the reporter to Sox10 sequences within exon 3 and relied on inclusion of an IRES (Jang et al.,1989) and a RNA splice acceptor from the rat preproinsulin intron, and SV40 polyA elements to maximize expression in mammalian cells. The construct was transiently transfected into cultured M-3 mouse melanoma cells (Yasamura et al.,1966) and cultured enteric glial cells (EGC; Ruhl et al.,2001) in 24-well plates at ∼50% confluency using FuGene6 (Roche Diagnostics Corporation) according to the manufacturer's instructions. Transfection efficiency was monitored by cotransfection of an equal quantity of pDsRed-Express-N1 (Clontech). At 36 hr posttransfection, dsRed-positive cells were visualized and photographed by direct fluorescence microscopy. Transfected cells were then fixed in neutral buffered formalin containing 0.1% TX-100 on ice for 10 min, washed, and stained in situ for βGal activity at 37°C for 16 hr according to published protocols (Mortlock et al.,2003). After staining, images were captured by brightfield illumination to document βGal-expressing cells. Parallel cotransfections of pDsRed-Express-N1 with pCMVβGeo were performed to document that the βGal detection assay conditions were consistent and effective.
Immunohistochemistry
Sox10 expression in M-3 and Enteric glial cells was evaluated by immunohistochemistry using a monoclonal antibody to Sox10 (IgG1; Lo et al.,2002). Cells were grown in six-well dishes and fixed on ice in 4% paraformaldehyde with 0.1% Triton X-100 for 10 min. After fixation, cells were washed in phosphate-buffered saline (PBS), blocked in 5% normal donkey serum and 1% bovine serum albumin, then stained with Sox10 monoclonal antibody 2B07 (IgG1) diluted 1:10 in block for 2 hr at 37°C. Donkey anti-mouse Cy3 (Jackson ImmunoResearch) diluted 1:1,000 was used to detect the primary antibody. Images were captured by fluorescence microscopy on an Zeiss Axiovert 200M microscope using exposures of less than 600 msec.
Intact-Sox10βGeoBAC embryos were harvested at E14.5 and fixed in neutral buffered formalin overnight at 4°C. The tissue was then equilibrated in PBS containing 20% sucrose and cryopreserved. Tissue sections (12 μm thickness) were post-fixed briefly in ice-cold 70% methanol before incubation with rabbit anti-BFABP (1:5,000, generous gift of Dr. T. Muller) and fluorescein isothiocyanate-conjugated rabbit anti-βGal (1:500, Abcam, ab6641). A Cy3-labeled secondary antibody (1:1,000, Jackson ImmunoResearch, 711-165-152) was used to detect BFABP immunoreactivity.
Sox10βGeoBAC Targeting Construct
The 4.47-kb KpnI fragment of pGT1.8IresβGeoBAC (Mountford and Smith,1995) was subcloned into pCRII (Invitrogen) to yield βGeoBAC pCRII. Splice overlap extension PCR was used to generate the 1.33-kb 5′ UTR Sox10/βGeoBAC fusion product from two templates, Sox10WT28011 BAC (pBACe3.6 backbone with chloramphenicol resistance) and pGT1.8IresβGeoBAC. HindIII and AscI sites at the 5′ end and a ClaI site at the 3′ end were engineered to facilitate subcloning and linearization of the final target sequence. PCR primers used were as follows: 5′-AAGCTTGGCGCGCCGCGATGGGAGAGTCTGACACCCTG-3′; 5′-GCGGCGGCCGGGAGCGACATGGAAGATCCCGTCGTTTTA-3′; 5′-TAAAACGACGGGATCTTCCATGTCGCTCCCGGCCGCCGC-3′; and 5′-CACCACGCTCATCGATAATTTCACCGC-3′. The starting methionine shared by Sox10 and βGeoBAC is shown in bold, and engineered restriction sites are underlined. The HindIII/ClaI SOE-PCR fusion product was subcloned into HindIII/ClaI-cut βGeoBAC pCRII to generate 5′Sox10βGeoBAC pCRII.
In parallel, PCR was used to generate the 3′ homology arm of Sox10, using the Sox10 WT28011 BAC as template. This 437-bp arm initiated with the second codon of Sox10 to avoid the possible deletion of potential regulatory domains. A NotI site at the 5′ end and AscI and NotI sites at the 3′ end were introduced to facilitate subcloning and linearization of the final target sequence. PCR primers used were 5′-GCGGCCGCCGAGGAACAAGACCTATCAGAGGTG-3′ and 5′-GCGGCCGCGGCGCGCCTTGCCTAGTGTCTTGCTGAGCTCAGC-3′. The NotI PCR product was subcloned into pFRT-Tet129 to yield FRT-Tet-FRT 3′Sox10 pCRII. This construct was digested with KpnI and XhoI and the insert subcloned into KpnI/XhoI-cut 5′Sox10βGeoBAC pCRII to yield 5′Sox10βGeoBAC FRT-tet-FRT3′Sox10 pCRII. All PCR-generated fragments were synthesized utilizing Pfu Polymerase (Stratagene) and fully sequenced.
The 5′Sox10βGeoBAC FRT-tet-FRT 3′Sox10 targeting sequence was linearized with AscI sites outside the actual homology arms. The targeting sequence (150 ng) was electroporated into EL250 Escherichia coli (Lee et al.,2001) previously transformed with the Sox10 WT28011 BAC. Successful targeted homologous recombination resulting in the modified Sox10βGeoBAC BAC was first identified by screening for tetracycline resistance (7.5 μg/ml) and subsequently confirmed by PCR. Removal of the tetracycline cassette was achieved by L-arabinose induction of flp recombinase present in the EL250 E. coli strain (Lee et al.,2001). Restoration of tetracycline sensitivity was confirmed by replica plating.
Generation of Sox10 BAC Transgenic Lines
Sox10WT28011 and Sox10βGeoBAC BAC DNAs were prepared by CsCl banding and subsequent dialysis into microinjection buffer (10 mM Tris, pH 7.5; 0.1 mM ethylenediaminetetraacetic acid, 10 mM NaCl, 30 mM spermine, and 70 mM spermidine). Sox10WT28011 BAC DNA and Sox10βGeoBAC BAC DNA were injected into fertilized mouse eggs obtained from the mating of C57BL/6 females with (C57BL/6 X SJL)F1 males by the Transgenic Animal Model Core at the University of Michigan using standard protocols (Camper et al.,1995). Transgene copy numbers were determined in offspring using a semiquantitative PCR assay (data not shown) in comparison to dilution standards containing 1, 2, 4, and 8 copies of each BAC/genome equivalent. Transgene copy numbers for Sox10WT28011 and Sox10βGeoBAC lines ranged from 4–8 copies/genome.
Genotyping
Genomic DNA was isolated from tail snips using previously described methods. BAC transgenes were detected by PCR amplification of three independent sequences. For both the Sox10 WT28011 and Sox10βGeoBAC BACs, primers spanned from the vector backbone into the BAC insert at both the SP6 (5′-GGCACTTTCATGTTATCTGAGG-3′ and 5′-GTTTTTTGCGATCTGCCGTTTC-3′) and T7 (5′-TCGAGCTTGACATTGTAGGAC-3′ and 5′-AAGAGCAAGCCTTGGAACTG-3′) ends. Amplification of an insertion/deletion polymorphism in the 3′ UTR of Sox10 exon 5, Sox10 3′ UTR (5′-GCACTGAGGACAGCTTTGAAC-3′ and 5′-GGATTGCCTCTGACTCTTTCC-3′), and the unique Sox10βGeoBAC (5′-GGTTTTCCACTTCCTCAGGACGAG-3′ and 5′-TAGATGGGCGCATCGTAACCG-3′) sequences were the third component of transgene detection.
Complementation Studies of Sox10LacZ-KO/+ Phenotype
C3Fe.Sox10LacZ-KO/+ congenic mice were mated with C3Fe-N3.Sox10 WT28011 BAC+ mice. Offspring were genotyped, and the pigmentation of Sox10LacZ-KO/+, Sox10 WT28011 BAC− mice compared with that of Sox10LacZ-KO/+, Sox10 WT28011 BAC+ mice. Subsequently, the animals were euthanized by approved procedures for harvest of gastrointestinal tracts and analysis of ENS deficits. Whole-mount AChE enzyme histochemistry was performed, and measurements of hypo- and aganglionosis were obtained as previously described (Cantrell et al.,2004).
Whole-Mount βGal Detection and In Situ Hybridization
Timed matings were set up to obtain staged mouse embryos, designating the morning of plug formation as E0.5. For detection of βGal, embryos were fixed in 4% paraformaldehyde (PFA) in 1× PBS at 4°C for 20–45 min, depending on age. Embryos were then washed and stained at 4°C for 48 hr according to the published protocol (Mortlock et al.,2003). These conditions resulted in virtually no nonspecific staining in embryos up through stage E14.5. In some instances, organs were subdissected before fixation and staining. To analyze Sox10 mRNA expression, E8.5 through E10.5 embryos were dissected, fixed overnight at 4°C, and processed for whole-mount in situ hybridization (Baxter and Pavan,2003). Mouse Sox10 cDNA was used as a template to generate digoxigenin-labeled sense and antisense probes by established methods (Southard-Smith et al.,1998). BM Purple AP substrate (Roche) was used for color development.
Sox10 In Situ Hybridization on Paraffin Sections
Histologic sections (12 micron) were deparaffinized in Citrisolv (Fisher) and subsequently hydrated. In situ hybridization using Sox10 sense probe was performed essentially as described in Thut et al. (Thut et al.,2001), using nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) reagent (Roche). Tissue was lightly counterstained with Nuclear Fast Red (Vector Laboratories). The slides were immediately mounted using glass coverslips and Aqua Poly/Mount (Polysciences, Inc.).
Harvesting of Enteric Muscle Strips
The small intestine was dissected from young adult mice (6–8 weeks old). The inner and outer enteric muscle layers, together with the myenteric plexus, were stripped away intact from the submucosa of the ileum. The strips were flattened and fixed in 4% PFA in 1× PBS at 4°C for 20 min before proceeding with βGal staining.
Histological Examination
βGal-stained whole embryos and dissected tissues were sequentially dehydrated and embedded in paraffin. Sections were cut at 12-micron thickness and lightly counterstained with eosin. Light microscopy was with an Olympus BX41 for digital image capture on an Olympus MagnaFire SP.
Deletion Mapping of the Spontaneously Truncated Sox10βGeoBAC Stable BAC Transgenic Lines
WT28011, the BAC used to generate the wild-type Sox10 transgenic line and modified to create the Sox10βGeoBAC BAC, was derived from the RPCI-23 C57BL/6 genomic library generated by Dr. Pieter De Jong (http://bacpac.chori.org/libraries.php). To map the extent of the deletion intervals in transgenic lines, transgenic males were backcrossed a minimum of three generations to C3Fe females. Subsequent offspring were then genotyped with STR markers spanning the interval of the Sox10 WT28011 BAC that were polymorphic between B6 and C3Fe strains by established methods (Cantrell et al.,2004). Marker names and primer sequences are listed in Table 1.
Acknowledgements
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
The authors thank Dr. Michael Wegner for providing the Sox10LacZ-KO/+ strain, Drs. A. Smith and David Kingsley for the pGT1.8IresβGeo plasmid, Drs. David Anderson and Liching Lo for sharing the Sox10 monoclonal antibody, Dr. Thomas Muller for the B-FABP antisera, Drs. Alexandre Pattyn and Jean-Francois Brunet for Phox2b antisera, and Dr. Neil Copeland for the EL250 E. coli strain and BAC recombineering methods. We thank Drs. Al George, Chris Wright, and Scott Baldwin for valuable discussion of the manuscript. We also thank Kelly Chandler for valuable advice regarding in situ hybridization, Ms. Nadia Ehtesham for technical assistance in whole-mount in situ hybridizations, and Maggie Van Keuren for outstanding support in generation of BAC transgenics in the University of Michigan Transgenic Animal Model Core. We gratefully acknowledge and thank Dr. Sam Wells and the support staff of the Cell Imaging Shared Resource Core for advice and assistance in confocal imaging. The Cell Imaging Shared Resource Core is supported by NIH grants. E.M.S.-S. was funded by a US National Institutes of Health grant from NIDDK.
REFERENCES
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
- , , . 2004. Exploiting human—fish genome comparisons for deciphering gene regulation. Hum Mol Genet 13 Spec No 2: R261–R266.
- , , . 2006. Phenotypes of neural-crest-derived cells in vagal and sacral pathways. Cell Tissue Res 323: 11–25.
- , , , . 2001. Human apolipoprotein B gene intestinal control region. Biochemistry 40: 6720–6730.
- , , , , , , , , , . 1997. Functional identification of the mouse circadian Clock gene by transgenic BAC rescue. Cell 89: 655–667.
- , , , , , , , , , . 2006. Deletion of long-range sequences at Sox10 compromises developmental expression in a mouse model of Waardenburg-Shah (WS4) syndrome. Hum Mol Genet 15: 259–271.
- , , , , . 2001. Comparative genomics of the SOX9 region in human and Fugu rubripes: conservation of short regulatory sequence elements within large intergenic regions. Genomics 78: 73–82.
- , . 2003. Pmel17 expression is Mitf-dependent and reveals cranial melanoblast migration during murine development. Gene Expr Patterns 3: 703–707.
- , , , . 1996. Developmental and tissue-specific regulation of the murine cardiac actin gene in vivo depends on distinct skeletal and cardiac muscle-specific enhancer elements in addition to the proximal promoter. Dev Biol 173: 200–212.
- , , , , , , , . 2000. Interaction among SOX10, PAX3 and MITF, three genes altered in Waardenburg syndrome. Hum Mol Genet 9: 1907–1917.
- , , , , , . 2001. Human Connexin 32, a gap junction protein altered in the X-linked form of Charcot-Marie-Tooth disease, is directly regulated by the transcription factor SOX10. Hum Mol Genet 10: 2783–2795.
- , , . 2000. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev Biol 227: 239–255.
- , , , , , , , . 2001. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev 15: 66–78.
- , , , , , , , , , , , . 2001. Genomic organization and expression of the doublesex-related gene cluster in vertebrates and detection of putative regulatory regions for DMRT1. Genomics 77: 8–17.
- , . 2005. Neural crest cell origin for intrinsic ganglia of the developing chicken lung. Dev Biol 277: 63–79.
- , 2000. Transgenic rescue of mutant phenotypes using large DNA fragments. In: AcciliD, editor. Genetic manipulation of receptor expression and function. New York: John Wiley and Sons. p 1–22.
- , , , , , , , , , , et al. 1995. Implementing transgenic and embryonic stem cell technology to study gene expression, cell-cell interactions and gene function. Biol Reprod 52: 246–257.
- , , , , , , . 2004. Interactions between Sox10 and EdnrB modulate penetrance and severity of aganglionosis in the Sox10Dom mouse model of Hirschsprung disease. Hum Mol Genet 13: 2289–2301.
- , , , . 2001. A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development 128: 1857–1868.
- , , . 2004. Hirschsprung disease. Chap 251. In: The metabolic and molecular bases of inherited disease. New York: McGraw-Hill. p 1–47.
- , , , , . 2000. Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Res Dev Brain Res 121: 233–241.
- , , , , , , . 2003. Analysis of the molecular cascade responsible for mesodermal limb chondrogenesis: Sox genes and BMP signaling. Dev Biol 257: 292–301.
- , , . 1998. An extensive 3′ regulatory region controls expression of Bmp5 in specific anatomical structures of the mouse embryo. Genetics 148: 401–408.
- , , . 2004. Sox genes and cancer. Cytogenet Genome Res 105: 442–447.
- , , , , , , , , , . 2005. A common sex-dependent mutation in a RET enhancer underlies Hirschsprung disease risk. Nature 434: 857–863.
- , . 1991. Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev 5: 1513–1523.
- , , , . 2005. Temporally regulated neural crest transcription factors distinguish neuroectodermal tumors of varying malignancy and differentiation. Neoplasia 7: 575–584.
- , , , , . 2003. Neural crest patterning: autoregulatory and crest-specific elements co-operate for Krox20 transcriptional control. Development 130: 941–953.
- , . 2001. Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Res 10: 83–103.
- , , , , . 2005. Evaluation of the RET regulatory landscape reveals the biological relevance of a HSCR-implicated enhancer. Hum Mol Genet 14: 3837–3845.
- , , , , , , , , . 1998. Mutation of the Sry-related Sox10 gene in Dominant megacolon, a mouse model for human Hirschsprung disease. Proc Natl Acad Sci U S A 95: 5161–5165.
- , , . 2003. Sox10 is required for the early development of the prospective neural crest in Xenopus embryos. Dev Biol 260: 79–96.
- , , . 1999. Myelin deficiencies in both the central and the peripheral nervous systems associated with a SOX10 mutation. Ann Neurol 46: 313–318.Direct Link:
- , , , , , , . 2002. Congenital hypomyelinating neuropathy, central dysmyelination, and Waardenburg-Hirschsprung disease: phenotypes linked by SOX10 mutation. Ann Neurol 52: 836–842.Direct Link:
- , , , , , , , , , , . 2004. Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations. Nat Genet 36: 361–369.
- , , , , , , , , , , . 2004. Mice expressing a dominant-negative Ret mutation phenocopy human Hirschsprung disease and delineate a direct role of Ret in spermatogenesis. Development 131: 5503–5513.
- , , , . 1989. Initiation of protein synthesis by internal entry of ribosomes into the 5′ nontranslated region of encephalomyocarditis virus RNA in vivo. J Virol 63: 1651–1660.
- , , , , , , , , . 2002. Embryonic submandibular gland morphogenesis: stage-specific protein localization of FGFs, BMPs, Pax6 and Pax9 in normal mice and abnormal SMG phenotypes in FgfR2-IIIc(+/Delta), BMP7(−/−) and Pax6(−/−) mice. Cells Tissues Organs 170: 83–98.
- . 1999. Early death of neural crest cells is responsible for total enteric aganglionosis in Sox10(Dom)/Sox10(Dom) mouse embryos. Pediatr Dev Pathol 2: 559–569.
- . 2000. Colonization of the murine hindgut by sacral crest-derived neural precursors: experimental support for an evolutionarily conserved model. Dev Biol 227: 146–155.
- , , . 1992. A transgenic model for studying development of the enteric nervous system in normal and aganglionic mice. Development 116: 167–175.
- , . 2002. The Waardenburg syndrome type 4 gene, SOX10, is a novel tumor-associated antigen identified in a patient with a dramatic response to immunotherapy. Cancer Res 62: 3020–3023.
- , , , , . 2001. Impaired autonomic control of the heart by SOX10 mutation. Eur J Pediatr 160: 68–69.
- , , . 2004. Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 101: 16489–16494.
- , . 1990. The participation of neural crest derived mesenchymal cells in development of the epithelial primordium of the thymus. Arch Histol Cytol 53: 267–273.
- , , , , , . 1994. The expression pattern of a novel gene encoding brain-fatty acid binding protein correlates with neuronal and glial cell development. Development 120: 2637–2649.
- , . 1984. Association of megacolon with a new dominant spotting gene (Dom) in the mouse. J Hered 75: 435–439.
- , , , , , . 2000. Pax3 is required for enteric ganglia formation and functions with Sox10 to modulate expression of c-ret. J Clin Invest 106: 963–971.
- , . 2003. Sox10 and Pax3 physically interact to mediate activation of a conserved c-RET enhancer. Hum Mol Genet 12: 937–945.
- , , , , . 2000. Direct regulation of the Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated hypopigmentation and deafness to WS2. J Biol Chem 275: 37978–37983.
- , , , , , , , . 2001. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73: 56–65.
- , , , . 2003. Expression of Sox transcription factors in the developing mouse pancreas. Dev Dyn 227: 402–408.Direct Link:
- , , , . 1999. Cell type-specific activation of neuronal nicotinic acetylcholine receptor subunit genes by Sox10. J Neurosci 19: 9747–9755.
- , , , . 2002. Comparison of the generic neuronal differentiation and neuron subtype specification functions of mammalian achaete-scute and atonal homologs in cultured neural progenitor cells. Development 129: 1553–1567.
- , , , , . 2004. Sox10-rtTA mouse line for tetracycline-inducible expression of transgenes in neural crest cells and oligodendrocytes. Genesis 40: 171–175.Direct Link:
- , , . 2005. Identification of Sox8 as a modifier gene in a mouse model of Hirschsprung disease reveals underlying molecular defect. Dev Biol 277: 155–169.
- , , , , , , , . 2000. VISTA: visualizing global DNA sequence alignments of arbitrary length. Bioinformatics 16: 1046–1047.
- , , , , . 1991. The dopamine beta-hydroxylase gene promoter directs expression of E. coli lacZ to sympathetic and other neurons in adult transgenic mice. Neuron 7: 703–716.
- , . 2004. Gene-regulatory interactions in neural crest evolution and development. Dev Cell 7: 291–299.
- , . 2003. The importance of having your SOX on: role of SOX10 in the development of neural crest-derived melanocytes and glia. Oncogene 22: 3024–3034.
- , , , , , , , . 2002. Expression of Sox8, Sox9 and Sox10 in the developing valves and autonomic nerves of the embryonic heart. Mech Dev 118: 199–202.
- , , , , , . 1998. YAC transgenic analysis reveals Wilms' tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech Dev 79: 169–184.
- , , . 2003. A general approach for identifying distant regulatory elements applied to the Gdf6 gene. Genome Res 13: 2069–2081.
- , . 1995. Internal ribosome entry sites and dicistronic RNAs in mammalian transgenesis. Trends Genet 11: 179–184.
- , , , . 1998. Clinical and morphological features of Waardenburg syndrome type II. Eye 12(Pt 3a): 353–357.
- , , , , . 2006. Glial cell-line derived neurotrophic factor-mediated RET signaling regulates spermatogonial stem cell fate. Biol Reprod 74: 314–321.
- , , , . 2003. Scanning human gene deserts for long-range enhancers. Science 302: 413.
- , , , . 1999. Transgenics identify distal 5′ and 3′ sequences specifying gonadotropin-releasing hormone expression in adult mice. Mol Endocrinol 13: 2203–2211.
- , , , , . 2001. Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor Sox10 and extrinsic combinatorial signaling. Development 128: 3949–3961.
- , , , . 2002. Sox10 haploinsufficiency affects maintenance of progenitor cells in a mouse model of Hirschsprung disease. Hum Mol Genet 11: 3075–3085.
- , , , , , , . 2003. Genetic background modifies intestinal pseudo-obstruction and the expression of a reporter gene in Hox11L1−/− mice. Gastroenterology 125: 1428–1440.
- , . 1971. Cytochemical evidence for the neural crest origin of mammalian ultimobranchial C cells. Histochemie 27: 96–102.
- , , , . 2000. Protein zero gene expression is regulated by the glial transcription factor Sox10. Mol Cell Biol 20: 3198–3209.
- , , , , . 2000. Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3 [In Process Citation]. Hum Genet 107: 1–6.
- , , , , , , . 2001. Analysis of Sox10 function in neural crest-derived melanocyte development: Sox10-dependent transcriptional control of dopachrome tautomerase. Dev Biol 237: 245–257.
- , , , , , . 2001. Human and mouse ABCA1 comparative sequencing and transgenesis studies revealing novel regulatory sequences. Genomics 73: 66–76.
- , , , , , , , . 2001. An element in intron 1 of the CFTR gene augments intestinal expression in vivo. Hum Mol Genet 10: 1455–1464.
- , , . 2001. Isolation of enteric glia and establishment of transformed enteroglial cell lines from the myenteric plexus of adult rat. Neurogastroenterol Motil 13: 95–106.Direct Link:
- , , , , . 2005. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development 132: 797–803.
- , , , , , , , , . 2000. PipMaker—a web server for aligning two genomic DNA sequences. Genome Res 10: 577–586.
- , . 2003. Combining phylogenetic and hidden Markov models in biosequence analysis. In: Proceedings of the Seventh Annual International Conference on Computational Molecular Biology. Berlin, Germany. p 277–286.
- , . 2004. Combining phylogenetic and hidden Markov models in biosequence analysis. J Comput Biol 11: 413–428.
- , , , , , . 2001. Development and degeneration of dorsal root ganglia in the absence of the HMG-domain transcription factor Sox10. Mech Dev 109: 253–265.
- , , . 1998. Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat Genet 18: 60–64.
- , , , , , , , , . 1999. Comparative analyses of the Dominant megacolon-SOX10 genomic interval in mouse and human. Mamm Genome 10: 744–749.
- , , , , , , , , . 1999. Autonomic dysfunction in children with Hirschsprung's disease. Dig Dis Sci 44: 960–965.
- , , . 2003. Characterization of lacZ-expressing cells in the gut of embryonic and adult DbetaH-nlacZ mice. J Comp Neurol 464: 208–219.Direct Link:
- , , , , , , . 1997. Isolation of a novel Sry-related gene that is expressed in high-metastatic K-1735 murine melanoma cells. Genomics 39: 30–37.
- , , , . 2001. A large-scale in situ screen provides molecular evidence for the induction of eye anterior segment structures by the developing lens. Dev Biol 231: 63–76.
- , , , , , , . 2003. Tyrosinase-Cre mice for tissue-specific gene ablation in neural crest and neuroepithelial-derived tissues. Genesis 37: 131–138.Direct Link:
- , , , , , , , , , , , , , , , , . 2000. Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain. Am J Hum Genet 66: 1496–1503.
- , . 1990. Evidence for the neuroectodermal origin of the human lacrimal gland. Invest Ophthalmol Vis Sci 31: 393–395.
- , , , . 2000. Regulation of the microphthalmia-associated transcription factor gene by the Waardenburg syndrome type 4 gene, SOX10. J Biol Chem 275: 30757–30760.
- . 1999. From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res 27: 1409–1420.
- . 2001. Expression of transcription factors during oligodendroglial development. Microsc Res Tech 52: 746–752.Direct Link:
- , . 2001. Genetic engineering of neural function in transgenic rodents: towards a comprehensive strategy? J Neurosci Methods 108: 111–130.
- , , , , , , , , , , , , , , , . 2005. Highly conserved non-coding sequences are associated with vertebrate development. PLoS Biol 3: e7.
- , , , , . 1998. Deletion of long-range regulatory elements upstream of SOX9 causes campomelic dysplasia. Proc Natl Acad Sci U S A 95: 10649–10654.
- , , . 1966. Establishment of four functional, clonal strains of animal cells in culture. Science 154: 1186–1189.
- , . 2001. Enteric neural crest-derived cells: origin, identification, migration, and differentiation. Anat Rec 262: 1–15.Direct Link:
- , , , , , . 1998. A single rostrocaudal colonization of the rodent intestine by enteric neuron precursors is revealed by the expression of Phox2b, Ret, and p75 and by explants grown under the kidney capsule or in organ culture. Dev Biol 202: 67–84.
- , , , , , , . 2004. Dynamics of neural crest-derived cell migration in the embryonic mouse gut. Dev Biol 270: 455–473.
- , , , , , , . 1999. Coordinate regulation of RAG1 and RAG2 by cell type-specific DNA elements 5′ of RAG2. Science 285: 1080–1084.
- , , , , , . 2004. Spatiotemporal regulation of endothelin receptor-B by SOX10 in neural crest-derived enteric neuron precursors. Nat Genet 36: 732–737.
Supporting Information
- Top of page
- Abstract
- INTRODUCTION
- RESULTS
- DISCUSSION
- EXPERIMENTAL PROCEDURES
- Acknowledgements
- REFERENCES
- Supporting Information
The Supplementary Material referred to in this article can be found at http://www.interscience.wiley.com/jpages/1058-8388/suppmat
| Filename | Format | Size | Description |
|---|---|---|---|
| jws-dvdy.20769.fig1.tif | 3133K | Supporting Information file jws-dvdy.20769.fig1.tif | |
| jws-dvdy.20769.fig2.tif | 1831K | Supporting Information file jws-dvdy.20769.fig2.tif |
Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

1097-0177/asset/DVDY_left.gif?v=1&s=b87335326ab8ecd1f573539da0b5fa6abef26532)