SEARCH

SEARCH BY CITATION

Keywords:

  • heart development;
  • MEF2;
  • transcription factor;
  • primary heart field;
  • ventricular differentiation

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Targeted deletion of the mef2c gene results in a small left ventricle and complete loss of the right ventricle (Lin et al. [1997] Science 276:1404–1407). Absence of the right ventricle is from defective differentiation of cells from the secondary heart field. Our studies of the dysmorphogenesis of the left ventricle uncovered morphological and transcriptional abnormalities at the transition from the cardiac crescent to the linear-tube stage heart. Use of the cgata6LacZ transgene demonstrated that lacZ-positive cells, which normally mark the precursors to the atrioventricular canal and adjacent regions of the left ventricle and atria, remain in the sinoatrial region of the mutant. This, along with the absence of a morphologically distinct atrioventricular canal, indicates a misapportioning of cells between the inflow and outflow segments. The underlying genetic program was also affected with altered expression of mlc2a, mlc2v, and irx4 in outflow segment precursors of the primary heart field. In addition, the sinoatrial-enriched transcription factor, tbx5, was ectopically expressed in the primitive ventricle and ventricle-specific splicing of mef2b was lost, suggesting that the mutant ventricle had acquired atrial-specific characteristics. Collectively, these results suggest a fundamental role of MEF2C in ventricular cardiomyocyte differentiation and apportioning of cells between inflow and outflow precursors in the primary heart field. Developmental Dynamics 235:1809–1821, 2006. © 2006 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The early development of the heart can be viewed as a series of steps in which cardiomyocytes are parsed into distinct classes (Harvey, 2002). The first of these is the separation of cardiac precursors into primary and secondary heart fields (PHF and SHF, respectively). This has been demonstrated by a number of complementary lines of research using gene expression, transgenic reporters, and lineage tracing (Kelly et al., 2001; Mjaatvedt et al., 2001; Waldo et al., 2001; Kelly and Buckingham, 2002; Cai et al., 2003). The timing of this separation was determined by an elegant retrospective clonal analysis showing that the pre-septation heart is comprised of two populations of cells that become clonally distinct shortly after gastrulation (Meilhac et al., 2004). The physical locations of these two populations prior to formation of the linear heart cannot be inferred from these experiments, but they probably correspond to the PHF and SHF defined by Evans and coworkers based on the expression domains of mlc2a and isl1, respectively (Cai et al., 2003). The SHF appears to be composed of distinct anterior and posterior regions. The anterior region expresses fgf10 as well as isl1, contributes to the heart solely through the arterial pole, and is known as the anterior heart field (AHF) (Kelly et al., 2001; Mjaatvedt et al., 2001; Waldo et al., 2001; Kelly and Buckingham, 2002; Zaffran et al., 2004). Moreover, the AHF is transcriptionally distinct from the posterior cells of the SHF in that promoter elements of the mef2c and nkx2.5 genes are active in the AHF but not the posterior region (Dodou et al., 2004; Takeuchi et al., 2005). Lineage tracing experiments using the AHF regulatory elements from the mef2c gene show that the outflow tract (OFT), right ventricle (RV), and ventricular septum are AHF derivatives (Verzi et al., 2005).

The next major subdivision of precardiac mesoderm occurs through specification of the inflow and outflow segments of the heart (Simoes-Costa et al., 2005). These two segments will be further subdivided as development progresses with the inflow segment being subdivided into the sinus venosus and atria, and the outflow into the OFT, ventricles, and AVC. The precise mechanism directing this specification is not known in any detail, but considerable evidence supports a model in which the default pathway for cardiomyocyte differentiation is to the outflow segment, with retinoic acid (RA) directing immature cardiomyocytes to the inflow (Yutzey et al., 1994; Niederreither et al., 2001; Hochgreb et al., 2003; Simoes-Costa et al., 2005). The downstream molecules regulating differentiation of both segments are unknown, yet it is likely that transcription factors play a prominent role.

A large number of transcription factors have been found to regulate the development of the heart (Firulli and Thattaliyath, 2002). One of the factors whose genetic ablation causes morphological and transcriptional abnormalities during early cardiogenesis is MEF2C. It is a member of the small MEF2 family of MADS-box containing transcription factors that have been implicated in several fundamental processes including myogenesis, fiber-type specification, cardiac hypertrophy, atherosclerosis, and as both an activator and inhibitor of apoptosis (Molkentin et al., 1995; Woronicz et al., 1995; Firulli et al., 1996; Kolodziejczyk et al., 1999; Mao et al., 1999; Youn et al., 1999; Okamoto et al., 2000; Passier et al., 2000; Wu et al., 2000; Dunn et al., 2001; Yan et al., 2001). Deletion of the mef2c gene results in a heart with a small, non-looping LV, loss of the RV, no trabeculation, and decreased expression of several cardiac-specific genes (Lin et al., 1997, 1998; Bi et al., 1999; Bruneau et al., 2000; Liu et al., 2001). In addition to the myocardial defects, there are endocardial and vascular malformations caused, in part, by decreased expression of the endothelial growth factors ang1 and vegfa in the myocardium (Lin et al., 1998; Bi et al., 1999).

Recent reports highlight the importance of MEF2C in formation and transcriptional regulation of AHF-derived structures, leading to the hypothesis that part of the mef2c−/− phenotype can be explained as defects in AHF-derived structures (Dodou et al., 2004; von Both et al., 2004). Because the AHF-derived cells in the mef2c−/− embryo are capable of incorporating into the heart relatively normally, the dysfunction appears to be in later stages of development (Verzi et al., 2005). Early evidence of the importance of MEF2 activity in transcriptional regulation of AHF-derivatives was the finding that the mlc2v and desmin promoters, which are specific to the OFT and RV, require MEF2 binding sites (Kuisk et al., 1996; Ross et al., 1996). This was followed by the observation that hand2 and bop are downregulated in the mef2c−/− heart and that deletion of either causes loss of the RV (Lin et al., 1997; Srivastava et al., 1997; Gottlieb et al., 2002). Moreover, the bop promoter contains essential MEF2 sites, suggesting a genetic route from mef2c to RV formation through the direct activation of the bop promoter and the, possibly indirect, induction of hand2 expression (Phan et al., 2005). A potential upstream genetic pathway within the AHF from isl1 and foxh1 to mef2c has also been uncovered (Dodou et al., 2004; von Both et al., 2004). Within the AHF, isl1 directly regulates transcription of the mef2c gene in combination with GATA factors through an element 5′ of the transcriptional start site (Dodou et al., 2004). Similarly, foxh1 regulates transcription of mef2c in combination with nkx2.5 through a 3′ element (von Both et al., 2004). Importantly, deletion of either isl1 or foxh1 causes loss of the RV, supporting a genetic pathway for formation of the AHF-derived structures from isl1 and foxh1 through mef2c to bop, hand2, and perhaps other downstream effectors (Lin et al., 1997; Cai et al., 2003; von Both et al., 2004; Phan et al., 2005).

These results form the basis of a compelling genetic framework within the AHF for formation of the RV and point to an important, but still incompletely defined, role for MEF2C. However, defects in AHF formation cannot completely explain the mef2c−/− phenotype. We provide evidence in this report that dysfunctional cardiogenesis in mef2c−/− embryos first arises in the PHF; specifically, in the ability of cells in the cardiac crescent to differentiate and physically contribute to the left ventricle and AVC. These cells contributed instead to the sinoatrial region that was consequently increased in size. This misallocation was mirrored by defects in transcription of genes marking the PHF and outflow segment precursors. Additionally, the ventricle-specific splicing of mef2b changed to the atrial-specific pattern and the sinoatrially-enriched tbx5 transcript was ectopically expressed in the primitive ventricle, indicating an anteriorly expanded domain of atrial-like expression similar to that observed following RA treatment (Liberatore et al., 2000). Thus, defective cardiogenesis in the mef2c−/− embryo is first manifested in the PHF with a primary defect in the differentiation of the ventricular and AVC precursors, and misallocation of cells between the inflow and outflow segments. The normal function of MEF2C, therefore, appears to be in the determination and maturation of the outflow lineage.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The Primitive Mef2c−/− Ventricle Had Reduced Proliferation But No Increase in Apoptosis

A salient feature of the mef2c−/− phenotype is the small LV (Lin et al., 1997). Two probable mechanisms for this would be a decrease in proliferation or an increase in apoptosis. We assayed proliferation in the linear heart tube by determining the number of cells in mitosis using immunohistochemistry to phosphorylated histone H3 and found that the percentage of mitotic cells was significantly lower than in the wildtype (1.3 ± 0.14% in the mutant compared with 2.1 ± 0.15% in the wildtype) (Fig. 1A) (Wei et al., 2002). TUNEL assays were performed to investigate the possibility of increased apoptosis in the mutant. We had considered apoptosis a likely possibility since the MEF2s are anti-apoptotic in neurons (Mao et al., 1999; Okamoto et al., 2000; Li et al., 2001). Although apoptosis was detected in other regions of the embryo at E8.5, none was detectable in the linear hearts of either wildtype (Fig. 1B) or mef2c−/− embryos (Fig. 1D). Since the first observable difference between mutant and wildtype cardiogenesis was in embryos with 4 SP (somite pairs) (see below), we also assayed for apoptosis at this stage. But, again, no apoptosis was detected in the cardiomyocytes (Fig. 1C and 1E). From these data, we conclude that the decreased size of the mef2c−/− ventricle was not the result of differences in apoptosis, but that decreased proliferation in the linear heart tube is a factor in creating a smaller ventricle.

thumbnail image

Figure 1. Proliferation was decreased but no apoptosis was detectable in mef2c−/− hearts. A: Proliferation was assayed by immunohistochemistry to the mitotic marker, phosphorylated histone H3. The ratio of positive nuclei to total nuclei in the linear tubes was determined for 5 embryos of each type. A statistically significant decrease (P < 0.05) in cardiomyocyte proliferation was observed using the Student's t-test. TUNEL assays of (B) wildtype and (D) mef2c−/− embryos at E8.5. Although apoptosis was observed in the headfolds of both wildtype and mef2c−/− embryos (arrowheads), there was no observable apoptosis in the hearts (arrows). The first morphological differences between wildtype and mutant were observed at the age with 4 somite pairs. TUNEL assays of (C) wildtype and (E) mef2c−/− embryos at this age showed apoptosis in other parts of the embryos (arrowheads) but not the cardiomyocytes (arrows). In situ hybridization to mlc2a was used to delineate the cardiomyocytes in C and E (blue).

Download figure to PowerPoint

Mef2c−/− Cardiomyocytes Fail to Elongate at the Linear Tube Stage Causing a Reduction in the Size of the Primitive Ventricle

In addition to the decrease in proliferation in the linear tube, there were striking morphological and organizational differences in the cardiomyocytes. In wildtype embryos, there was ballooning of the cardiac crescent along most of its length above the anterior intestinal portal beginning at 4 SP. This horizontal expansion later remodeled to form a vertical linear tube (Fig. 2A). In the mef2c−/− heart, the anterior expansion was delayed and appeared to occur only near the midline (Fig. 2E). Sections through the linear tubes (Fig. 2B and F) revealed that there was minimal ballooning of the mef2c−/− ventricle. These cells did not elongate to form a bulbous chamber, but appeared to be compacted, multilayered, and less organized than wildtype cells (Fig. 2C and G). It was also apparent that the extracellular matrix separating the myocardial and endocardial layers was reduced. Paradoxically, deletion of a known MEF2C target, bop, results in a similar loss of the RV but an increase in extracellular matrix (Gottlieb et al., 2002; Phan et al., 2005).

thumbnail image

Figure 2. Cardiomyocytes of Mef2c−/− linear hearts had abnormal morphology and differentiation. (A–D) wildtype and (E–H) mef2c−/− linear hearts. A: The wildtype linear heart was bulbous and extended over much of the region anterior to the anterior intestinal portal. E: In contrast, the mef2c−/− linear heart was narrow and limited to a smaller region near the midline. Sagittal sections through the center of these hearts and staining with hematoxylin and eosin showed that the mef2c−/− ventricle (F) has not expanded anteriorly and ventrally to form a bulbous chamber like the wildtype (B). At higher magnification, the cardiomyocytes (arrows) in the mef2c−/− heart (G) were rounded and more densely packed in multiple layers than the wildtype cells (C), which have elongated to form a single layer around a greatly expanded chamber. Immunohistochemistry with the MF-20 antibody to sarcomeric myosin showed that cardiomyocytes (arrows) in the mef2c−/− linear tube (H) were less differentiated than those in the wildtype tube (D).

Download figure to PowerPoint

The rounded appearance of cardiomyocytes in the mef2c−/− heart implied that myocyte differentiation was aberrant. To further examine cardiomyocyte differentiation, we assayed expression of myosin heavy chain by immunohistochemistry with the MF-20 antibody (Xavier-Neto et al., 1999). MF-20 staining was readily apparent in the wildtype linear tube (Fig. 2D) whereas it was not detected in the mutant (Fig. 2H). Although MF-20 staining was detectable at E9.5 in mef2c−/− cardiomyocytes, it was reduced and the myofibers appeared to be less organized (data not shown). These observations suggest that the small size of the primitive mef2c−/− ventricle may be a consequence of a reduced region of crescent contributing to the linear tube and of the cardiomyocytes being less differentiated with a rounded, compact organization. To investigate these possibilities, we examined expression of several genes that mark different precursor populations within the cardiac crescent, linear tube, and looping stage hearts.

Hand1 Expression Was Significantly Delayed and Reduced in the mef2c−/− Heart, But Retained Normal Patterning

In order to investigate ventricle maturation and specification into primary and chamber myocardium, we made a careful examination of hand1 expression in the mutant at earlier stages than previously reported (Lin et al., 1997; Firulli and Thattaliyath, 2002). Hand1 expression begins in the posterior, ventral part of the linear tube and then moves anteriorly as looping proceeds. It is thus a very early marker of the subdivision of the primitive left ventricle into primary and secondary ventricular myocardium (Biben and Harvey, 1997; Srivastava et al., 1997). During looping, its posterior expression in the linear tube relocates to the left and expression begins in the OFT and RV (Biben and Harvey, 1997; Srivastava et al., 1997). For our analysis, Hand1lacZ reporter mice in which the lacZ gene replaces most of the first coding exon of hand1 were crossed with mef2c+/− mice in a scheme similar to that used by Firulli and coworkers (Firulli and Thattaliyath, 2002; Morikawa and Cserjesi, 2004). LacZ expression from the hand1 locus was first observed in the posterior-ventral surface of the wildtype linear heart at 6 SP (not shown), but was not observed in the heart of the mef2c−/− until 8 SP. At this age, the wildtype heart was looping but the mutant heart was still linear. Expression in the linear tube of the mef2c−/− (Fig. 3D) was correctly located at the ventral surface but was greatly reduced from that of the wildtype (Fig. 3A). As the mutant heart loops, the junction between the ventricle and atrium, which does not resemble an anatomically distinct AVC, transitions to the left side of the embryo (Fig. 3E), revealing that this component of looping can occur in the mutant without obvious looping of the ventricle. Unexpectedly, expression of hand1 in the mutant was relatively normal in the OFT (Fig. 3B and E), suggesting that at least part of the transcription network is normal in the OFT without MEF2C. Although expression was much lower than in the wildtype, it was correctly regionalized, demonstrating that the hand1 gene can still properly respond to signals establishing the dorsoventral and anteroposterior pattern. Sections of E9.5 hand1lacZ embryos (Fig. 3C and F) reveal that the atria of the mef2c−/− were substantially larger than in the corresponding wildtype, suggesting that the small ventricle may be caused by misdistribution of cells from the ventricle to the atria.

thumbnail image

Figure 3. Hand1 expression was delayed and reduced in the mef2c−/−. Expression of hand1 was monitored through a lacZ gene that was recombined into its first coding exon. Wildtype and mef2c−/− embryos were matched according to the number of somite pairs (S). A: Early in the looping process, the wildtype embryo expressed hand1 in the left, ventral part of the LV extending through the outer curvature of the AVC into a restricted region of the atrium. D: The age-matched mef2c−/− embryo exhibited only a low level of expression on the ventral surface of a small, linear ventricle. The mutant OFT, which is formed from the secondary heart field, had relatively normal hand1 expression. B: As looping continued, expression in the wildtype extended from the OFT into the right ventricle, while expression in the mef2c−/− heart (E) became stronger in the posterior, ventral surface of the ventricle. The junction between the atrium and ventricle had transitioned to the left in the mef2c−/− embryo, but there was no indication of the ventricular looping. C,F: Sections through the atrium of E9.5 embryos demonstrated that the mef2c−/− atria (F) were larger than the corresponding wildtype atria (C) despite the smaller size of the mutant embryos. The arrows indicate expression of hand1 in the outer curvature of the left ventricle and part of left atrium. The levels were reduced in the mutant and there was ectopic expression on the dorsal surface of the right atrium. A, atria; AVC, atrioventricular canal; LV, left ventricle; OFT, outflow tract; RV, right ventricle; S, somite pairs.

Download figure to PowerPoint

Ventricle-Specific Splicing of the mef2b Gene Required MEF2C

Mef2b is expressed at the same time as mef2c and its expression is increased in the mef2c−/− heart (Lin et al., 1997). In addition to increased expression, we observed that the mef2b gene exhibited a large number of alternative splicing products whose pattern changed in the mef2c−/− hearts (data not shown). To focus our analysis, we made primers to cross the intron between exons 5 and 6 (Morisaki et al., 1997). Surprisingly, the resulting PCR products revealed retention of this intron in the wildtype ventricle but not atria (Fig. 4A). Sequencing this intron showed that retention resulted in an in-frame addition of 39 amino acids (Fig. 4B). Significantly, the mutant ventricle displayed the same pattern of intron splicing as the wild-type atria rather than the wild-type ventricle-specific retention, suggesting that the mutant ventricle had acquired atrial-specific characteristics.

thumbnail image

Figure 4. Ventricle-specific retention of a Mef2b intron required MEF2C. A: RT/PCR across the junction of mef2b exons 5 and 6 revealed that the intervening intron was retained in ventricles of E9.5 wildtype embryos. This intron was spliced out in wildtype atria and in both atria and ventricles of mef2c−/− embryos. B: Cloning and sequencing of this alternate splice showed that the retained intron was in-frame so that a protein of 39 additional amino acids (shown in lowercase) would be produced in the wildtype ventricle.

Download figure to PowerPoint

Expression of the Sinoatrial-Enriched Transcription Factor, tbx5, Expanded Anteriorly Into the mef2c−/− Ventricle

To determine if the migration and early differentiation of cardiomyocytes in the cardiac crescent is abnormal in mef2c−/− embryos, we performed in situ hybridization to the transcription factor, tbx5. It is normally expressed in cardiomyocytes throughout the crescent but becomes restricted to the sinoatrial region during formation of the linear tube (Bruneau et al., 1999). It is, therefore, a valuable assay for alterations in atrial and ventricular specification in addition to marking cardiomyocytes of the crescent (Liberatore et al., 2000). The initial extent and level of tbx5 expression appeared normal in the mef2c−/− crescent at 3 SP, which was just prior to the first morphological indications of linear tube formation (Fig. 5A and E). We also observed no differences in the gross organization of the heart fields at this stage from examination of paraffin-embedded embryo sections (data not shown). This suggests that the cardiomyocytes have correctly migrated to form the cardiac crescent in the mutant and that there are no major morphological differences prior to formation of the primitive ventricle. In older wildtype embryos, tbx5 expression was high in the sinoatrial region of embryos during the early transition from the crescent to the linear tube at 5 SP, however little was observed in the expanding ventricular region (Fig. 5B). Although expression was apparently normal in the crescent of 5 SP mef2c−/− embryos, there was no expansion of the crescent into a tube (Fig. 5F). In 7 SP embryos, the wildtype linear tube showed no expression of tbx5 but strong expression in the sinoatrial region (Fig. 5C). In contrast, the corresponding mutant showed uniformly high expression throughout the sinoatria and forming ventricle, indicating an anterior expansion of the tbx5 expression domain (Fig. 5G). This distinction between the wildtype and mutant continued in the older 8 SP embryos with high expression in the ventricle of the mutant and little expression in the wildtype ventricle except in the posterior part, which was the first sign of induction of tbx5 in the left ventricle of older embryos (Fig. 5D and H) (Bruneau et al., 1999). Also apparent at this stage was the clear enlargement of the sinoatrial region in the null (Fig. 5H) that probably prefigures the enlarged atria observed at E9.5. Yutzey and coworkers observed an anterior expansion of tbx5 expression into the ventricle when retinoic acid was used to redirect cardiomyocytes from the outflow to inflow lineage that is similar to what we observed in the mef2c mutant (Liberatore et al., 2000). By analogy, there may be a similar alteration in segment specification in the mef2c−/− embryo.

thumbnail image

Figure 5. Tbx5 expression was initially normal in the cardiac crescent of the mef2c−/− but becomes ectopically expressed in the linear tube. In situ hybridization to tbx5 in wildtype (A–D) and mef2c−/− embryos (E–H) age-matched based on somite number (S). Tbx5 was expressed similarly in the cardiac crescent of 3 S wildtype (A) and mef2c−/− (E) embryos, suggesting that the early stages of migration and differentiation are normal in the mutant. B: When the crescent expands to form the linear tube, tbx5 expression was transiently downregulated in the forming ventricle of the wildtype but not the mutant (F). Expression continued to be reduced in the ventricle of the wildtype at the linear tube stage (C) whereas the mef2c−/− embryo maintained a high level of ventricular expression (G). D: At the looping stage in the wildtype, tbx5 expression was visible in the left ventricle and atrioventricular canal. H: Expression of tbx5 was throughout the linear tube of the mutant at this stage and highlighted the strikingly enlarged sinoatria. V, ventricle; S, somite pairs; SA, sinoatria.

Download figure to PowerPoint

Ventricle-Specific Differentiation Was Delayed in the mef2c−/− Cardiomyocytes Until After the Precursors Had Physically Contributed to the Primitive Ventricle

The anterior expansion of tbx5 expression into the forming ventricle, the loss of ventricle-specific splicing of the mef2b transcript, and the change in the relative sizes of the ventricle and sinoatria led us to explore the hypothesis that MEF2C is important for specification of the inflow and outflow segments. For this, we used in situ hybridization to the ventricle-restricted contractile-protein gene, mlc2v, and the transcription factor, irx4, which is a ventricle-restricted inhibitor of atrial-differentiation, to assay for changes in the boundaries of atrial and ventricular precursors in the cardiac crescent (Bao et al., 1999; Bruneau et al., 2000). Mlc2v was strongly expressed in the wildtype 3 SP embryo in the anterior part of the cardiac crescent prior to tube formation (Fig. 6A). Within the wildtype linear (Fig. 6B) and looping (Fig. 6C) hearts, it was primarily limited to the ventricle and the AVC with diminished expression in the OFT. Importantly, it was not expressed in the sinoatrial region below the linear tube or in the more posterior region of the crescent prior to tube formation. In comparison, expression of tbx5 at the 3 SP stage extends much more posteriorly to approximately the first somite pair (Fig. 5A). Although lineage tracing would be required to accurately delimit the precursor domains, these expression patterns imply that mlc2v expression only marks the precursors of the OFT, ventricle, and AVC within the crescent; but not the sinoatrial precursors. Remarkably, no mlc2v expression was observed in the cardiac crescent of null embryos with 4 or 6 SP (Fig. 6D and 6E). It was first observed in the linear tube of the 8 SP null when the normal heart has begun looping (Fig. 6F). Thus, mlc2v expression was delayed until after the ventricular precursors in the crescent had physically contributed to the primitive ventricle. Because of this delay, however, mlc2v expression could not indicate if the ventricular precursors occupied a smaller region within the cardiac crescent.

thumbnail image

Figure 6. Whole-mount in situ hybridization to mlc2v and irx4 revealed delayed differentiation in the mef2c−/− ventricular precursor cells until after their incorporation into the linear tube. Differentiation of ventricular cardiomyocytes was monitored by in situ hybridization to the ventricular markers, mlc2v and irx4. A: Robust mlc2v expression was first detected in wildtype embryos with 3 S in the anterior part of the cardiac crescent. B: It was later expressed in the bulbous ventricle and part of the OFT in 6 S wildtype embryos, but not in the sinoatria. D:Mlc2v was not expressed in mef2c−/− embryos with 4 S, nor was there any anterior expansion of the crescent. E: At 6 S, a small tube formed in the mutant, but there was no mlc2v expression. C: By 8 S, mlc2v was expressed in the ventricle of the looping heart and in parts of the OFT and AVC of wildtype embryos. F: At this age, the mutant expressed mlc2v in the tube, but not the crescent. G: Expression of irx4 was high along the expanding anterior crescent of the wildtype embryo with 5 S, but there was only minimal irx4 expression in the presumptive ventricular precursors near the midline of the mef2c−/− embryo (J). H: In the 6 S wildtype embryo, the tube exhibited pronounced irx4 expression, whereas the mutant (K) showed a much lower level. It can be seen by comparing the mutant embryo in K with the earlier stage wildype embryo in G that the region of anterior expansion in the mef2c−/− embryo was over a smaller lateral extent. At 8 S, the wildtype (I) and mutant (L) both displayed expression in the looping heart and linear tube, respectively. Notably, the sinoatrial region was visibly enlarged in 8 S mef2c−/− embryos (F and L). S, somite pairs; SA, sinoatrial region; V, ventricle; VP, ventricular precursors.

Download figure to PowerPoint

Irx4 expression in the mef2c−/− embryo was also substantially delayed in the mutant, but there was an earlier onset of weak expression in the crescent that may mark the region of ventricular precursors. This low level of irx4 expression in the mef2c−/− crescent could be seen at 5 SP concentrated near the midline (Fig. 6J), whereas there was strong expression throughout the expanding region of the wildtype crescent at this same age (Fig. 6G). When the wildtype linear tube formed, there was strong expression throughout the tube but no expression in the sinoatrial region (Fig. 6H). Expression was readily detectable in the small forming ventricle of the correspondingly aged null, although at a much lower level (Fig. 6K). It is important to note that the region of crescent expanding anteriorly in the mutant was small compared with the wildtype and restricted to near the midline (compare the null embryo in Fig. 6K with the younger wildtype embryo in Fig. 6G that was also undergoing an anterior expansion). At 8 SP, when a wildtype heart was beginning to loop (Fig. 6I), the null exhibited intense irx4 expression in a linear tube (Fig. 6L). The expression appears to be stronger than wildtype, but this may simply be a function of the increased cell density in the mutant tube. Taken together, these data indicate that ventricle-specific differentiation was delayed in both the onset of expression of the ventricle-specific genes, mlc2v and irx4, and the downregulation of tbx5. Moreover, the small region of low-level expression of irx4 in the crescent suggests that there was a smaller region of ventricular precursors in the mef2c−/− cardiac crescent.

The Earliest Indication of Cardiomyocyte Dysfunction Was in the Delayed Expression of mlc2a in the Primary Heart Field

The mlc2v and irx4 data suggested that a smaller region of the cardiac crescent was differentiating into the outflow segment. In order to determine if there is an earlier and more general defect in differentiation of cardiomyocytes, we examined expression of the mlc2a gene. It has recently been shown that mlc2a expression marks the cardiomyocytes of the primary heart field starting at the headfold stage (Cai et al., 2003). We observed robust mlc2a expression (Fig. 7A and B) in the wildtype crescent in a region that appears to extend a little more posterior than those of mlc2v and irx4 (Fig. 6A and G), but not as far posterior as either tbx5 (Fig. 5A) or the cGata6LacZ transgene (Fig. 7J). Taken together, this would suggest that mlc2a is an early marker for outflow segment (OFT, ventricle, and AVC) precursors. The onset of mlc2a expression in the mef2c−/− was delayed until the 3 SP stage (Fig. 7F). Even then, it was at a lower level and was stronger at the anterior part of the crescent with decreasing amounts at the posterior ends (Fig. 7B and F). Mlc2a expression continued to mark the cells in the anterior part of the crescent during the formation of the linear tube at 5 SP in the wildtype (Fig. 7D). At this stage, the mef2c−/− embryo had begun to form a vertical tube but it was small, disorganized, and had lower expression of mlc2a (Fig. 7H). Because mlc2a expression appears to be restricted to precursors of the outflow segment early in heart development, these data indicate that cardiomyocyte differentiation is dysfunctional in the mef2c−/− embryo in the outflow precursors of the primary heart field from the onset of mlc2a expression at the headfold stage.

thumbnail image

Figure 7. Prospective precursors of the atrioventricular canal and adjacent left ventricular cells in the mef2c−/− cardiac crescent did not contribute to the linear tube. A:Mlc2a was strongly expressed in the primary heart field of the 2 S wildtype embryo, but not in the mef2c−/− (E). The posterior extent of wildtype mlc2a expression at 3 S (bar in B) and 4 S (arrowhead in C) was not as extensive as that of cGata6LacZ, which marks the precursors to the AVC and adjacent parts of the LV and sinoatria (bar in J and arrowhead in K, respectively). Indicating that sinoatrial precursors were not expressing mlc2a at these stages. At 3 S, mlc2a was expressed in the anterior part of the mef2c−/− crescent (F), but at a lower level than the wildtype embryo (B) and with a less posterior extent (arrow in F compared to the bar in B). Expression of mlc2a was stronger at 4 S in the null (G) but still less extensive than in the wildtype (C). D:Mlc2a expression in the wildtype at 6 S was throughout the linear tube and into the sinoatrial region; however, it did not extend as far posterior as cGata6LacZ expression (L). H: The mef2c−/− expressed mlc2a in a similar region but lower level than the wildtype. Expression of cGata6LacZ was the same at 1 S to 2 S in the wildtype (I,J) and null (M,N). At 4 S, the anterior part of the crescent expanded in the wildtype (K). The more distal cells of this expansion were positive for cGata6LacZ (arrow in K) and positive cells eventually populated the lateral surface of the linear tube at 6 S (arrow in L). P: The anterior crescent did not enlarge in the null at 4 S (O). When the mef2c−/− linear tube formed at 5 S (arrow in P), the cGata6LacZ-positive cells remained in the sinoatrial region, indicating that only the more medial cells contributed to the tube. VP, ventricle precursors; S, somite pairs.

Download figure to PowerPoint

A Smaller Region of the Cardiac Crescent Contributed to the Primitive Ventricle of the Mutant

From the morphology and expression data, we hypothesized that only the cells near the midline of the anterior crescent were contributing to the primitive ventricle. To better establish the boundaries of this region, we crossed mef2c+/− mice with mice carrying the cgata6lacz reporter gene. This reporter primarily marks the cells of the AVC during looping, but its expression extends a little beyond into the left ventricle and atria. Importantly, it marks precursors of these regions beginning at the onset of cardiogenesis (Davis et al., 2001). Thus, it provides a means to examine the boundary between the atrial and ventricular precursors in mef2c−/− embryos during tube formation. We observed normal expression of this reporter in the mutant through the 3 SP stage (Fig. 7M and N), indicating that these precursor cells were correctly specified and localized. This is consistent with the tbx5 expression pattern that was also indistinguishable from wildtype prior to 4 SP. When the expansion of the anterior crescent began at 4 SP, the anterior-medial boundaries of cgata6lacz-positive cells were located at the distal ends of this expansion (Fig. 7K). During the subsequent remodeling into the linear tube, these cgata6lacz-positive cells relocated to the lateral surface of the primitive ventricle (Fig. 7L). The remaining positive cells were in the sinoatrial region from which they eventually contribute to the AVC and part of the atria during looping morphogenesis (data not shown) (Davis et al., 2001). The anterior crescent of the mutant fails to expand at 4 SP (Fig. 7O) but a small linear tube does eventually begin to form at 5 SP (Fig. 7P). Notably, the cgata6lacz-positive cells located in the anterior part of the crescent that would normally contribute to the lateral surface of the linear tube remain in the sinoatrial region. All of the cgata6lacz-positive cells remained in the sinoatrial region during looping, implying that a distinct AVC did not form (data not shown). These data indicate that, although the cgata6lacz-positive cells were correctly specified prior to 4 SP in the mutant, only the negative cells located more medially were able to contribute to the primitive ventricle. Thus, deletion of mef2c causes the misapportioning of cells from ventricular and AVC precursors to sinoatrial precursors.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Our experiments into the role of MEF2C in ventricle formation were directed at understanding why the loss of mef2c results in a smaller ventricle. As previously shown, part of the cause is failure of the AHF-derived RV to form (Lin et al., 1997). This is not from failure of the AHF to contribute to the heart, but rather from problems in differentiation (Verzi et al., 2005). The role of MEF2C in AHF differentiation is beginning to be defined through promoter and mutant analyses. This research places mef2c downstream of isl1 and foxh1, and upstream of bop and hand2 for transcriptional regulation within the AHF and its derivatives (Cai et al., 2003; Dodou et al., 2004; von Both et al., 2004; Phan et al., 2005). However, AHF defects alone do not explain the reduced size and transcriptional abnormalities in the LV, hich is formed exclusively from the PHF, nor the absence of a morphologically normal AVC, which is derived from both fields (Cai et al., 2003; Meilhac et al., 2004). This suggests that cardiogenesis in the outflow segment of the PHF is defective and led us to consider several potential mechanisms for this dysfunction.

We initially considered the most likely explanations to be increased apoptosis or decreased proliferation in the primitive ventricle or its precursors. Apoptosis does not appear to be a factor since we observed no apoptosis in cardiomyocytes at the linear tube stage or at the initiation of ventricle formation (Fig. 1). However, we did observe decreased proliferation in the mutant at the linear tube stage, making it a factor in the etiology of the smaller ventricle later in development. Nevertheless, we do not consider it to be a major factor in causing the smaller linear tube itself because, prior to ventricle formation, there were no differences between the morphologies of the wildtype and mutant cardiac crescents (Fig. 5) nor were there differences in the extent of cGata6LacZ-positive cells marking precursors of the AVC and adjacent regions (Fig. 7). Another potential mechanism is retarded migration of cardiac precursors causing the delayed arrival of cells into the correct anatomical location to contribute to the ventricle. However, this possibility is unlikely based on the normal expression of tbx5 and cGata6LacZ in the anterior part of the cardiac crescent. Moreover, just such a migration defect in Mesp1−/− embryos results in cardiobifida, which we have not observed in the mef2c−/− (Saga et al., 1999). Another possibility is for MEF2C to be required in the physical reorganization of the crescent to form a linear tube. This is supported by the failure of much of the cardiac crescent to expand at 4 SP in the mutant and by the abnormally dense, rounded morphology of cardiomyocytes in the primitive ventricle (Fig. 2). Although clearly a factor, these morphological changes were accompanied by a pattern of altered gene expression that implicates roles for MEF2C in the outflow lineage more fundamental than the physical reorganization of the cardiac crescent: These are to initiate a program of outflow segment maturation and to properly allocate precursors between the inflow and outflow.

MEF2C Activates a Differentiation Program for Outflow Segment Maturation

We found several genes with altered expression during formation of the ventricle that were, nevertheless, normally expressed either before or after this period. It is, therefore, necessary to interpret the effects of mef2c deletion in temporal, spatial, and quantitative terms rather than simply in terms of loss of gene expression.

Hand1 was originally investigated in mef2c−/− hearts along with hand2 to establish that the RV expressing hand2 is missing whereas the LV expressing hand1 remains (Lin et al., 1997). We examined its expression earlier in development using a lacZ knockin as a reporter because it is one of the earliest differentially expressed genes subdividing the ventricle into functional compartments (Biben and Harvey, 1997; Morikawa and Cserjesi, 2004). Hand1 expression exhibits an anteroposterior and dorsoventral pattern beginning at the linear tube stage that prefigures its expression in the ventricular secondary myocardium (Biben and Harvey, 1997; Christoffels et al., 2000). Although, as reported previously (Lin et al., 1997; Firulli and Thattaliyath, 2002), hand1 was expressed at E9.5 in the null, albeit at a considerably reduced level, we found that its onset was substantially delayed (Fig. 3), indicating retarded ventricular differentiation. Significantly, the pattern in the null is similar to that of the wildtype in that hand1 is localized to the ventral, posterior surface of the ventricle (Fig. 3). This suggests that mef2c−/− cardiomyocytes can eventually respond to some of the positional cues governing the spatial parsing of the heart. Remarkably, the mutant heart was also capable of responding to looping signals by transitioning the junction between the ventricle and sinoatria to the left side without normal looping in the ventricle (Fig. 3). These two components of cardiac looping are, therefore, separable processes. Surprisingly, expression in the OFT was relatively normal with respect to timing and amount (Fig. 3A and D). So, despite the obvious problem in RV formation, expression of hand1 appears to be independent of mef2c in the AHF-derived OFT whereas it is dependent in the PHF-derived LV.

Expression of tbx5 and alternative splicing of mef2b were changed in a manner suggesting defects in ventricle-specific differentiation. Tbx5 was expressed in cardiomyocytes throughout the cardiac crescent prior to formation of the primitive ventricle in both the wildtype and mutant (Fig. 5A and E) (Bruneau et al., 1999). It is downregulated in the wildtype ventricle at the linear tube stage before being induced specifically in the left ventricle during looping (Fig. 5B to D) (Liberatore et al., 2000). This transient downregulation corresponds to the anterior expansion of the crescent with accompanying changes in cell shape, supporting the notion that ventricular cells are undergoing a coordinated program of differentiation at about 4 SP. Downregulation of tbx5 in the ventricle can be disrupted, however, by treatment with retinoic acid, which causes the anterior extension of sinoatrial-specific gene expression (Liberatore et al., 2000). A similar ectopic expression of tbx5 in the primitive mef2c−/− ventricle (Fig. 5G and H) can conservatively be interpreted as the retarded downregulation of this gene indicating incomplete ventricular differentiation. But it could, in addition, indicate that sinoatrial-specific gene expression has extended anteriorly. This interpretation is supported by the switch in mef2b splicing in the ventricle from the ventricle-specific retention of the intron between exons 5 and 6 to its atrial-specific removal, implying that the mef2c−/− ventricle has acquired atrial-specific characteristics (Fig. 4). Because retention of this intron leads to the inclusion of additional amino acids, there could be an impact on MEF2B function in the mutant ventricle from their removal. Though this has not been explored, it is notable that alternative splicing is important for activity of the other members of this family (Zhu and Gulick, 2004; Zhu et al., 2005).

Altered expression was also seen for genes that identify earlier stages in differentiation of the ventricle and AVC. Both mlc2v and irx4 are restricted to the ventricle, OFT, and AVC and are expressed in their precursors in the anterior part of the cardiac crescent prior to formation of the primitive ventricle (Bruneau et al., 2000). They are both expressed in the mef2c−/− ventricle at E9.5 (Lin et al., 1997; Bruneau et al., 2000). However, we found that mlc2v is not expressed in the crescent but only in the small primitive ventricle (Fig. 6). This implies delayed ventricular differentiation and a smaller precursor population, but does not reveal the size of the precursor region. Irx4 was similarly not expressed in normal amounts in the crescent but there was low-level expression in cells near the midline (Fig. 6J). This zone of low irx4 expression later corresponded to the expanding region of the crescent from which the linear tube formed (Fig. 6L).

Irx4 expressing cells, therefore, probably mark the same precursors in the mef2c−/− crescent as they do in the wildtype embryo. These expression data are, thus, consistent with the morphological data in indicating that ventricular and AVC precursors in the crescent are restricted to near the midline in the null instead of across the entire anterior region.

The delay expressing mlc2a in the mef2c−/− crescent indicates a defect in cardiomyocyte differentiation from at least the headfold stage (Fig. 7). Moreover, comparing the expression domain of mlc2a (Fig. 7A–C) with those of cgata6lacz (Fig. 7I–K) and tbx5 (Fig. 5A,B) provides further evidence supporting a function of MEF2C specifically in outflow differentiation. From these comparisons, it can be seen that the posterior limit of mlc2a expression, which has been used to define the PHF in relation to the medially located SHF expressing isl1, was more anterior than those of cgata6lacz and tbx5. Because these genes also mark sinoatrial precursors located posterior to those of the AVC, these data indicate that mlc2a is probably expressed first in the ventricular and AVC precursors and only later in those of the sinoatria. This early restriction of mlc2a to outflow segment precursors suggests that differentiation into a state expressing contractile genes occurs first in these cells. This is consistent with the need to have the outflow segment be contractile prior to those of the inflow and SHF, which primarily contribute to the heart after contractions have initiated. Thus, the more anterior limit of the mlc2a expression domain at 3 SP in the mutant (Fig. 7G) implies that fewer anterior cells are outflow precursors.

These data demonstrate that there was delayed expression of marker genes at each step of cardiogenesis in the mef2c−/− from contractile-protein genes that are not lineage restricted (mlc2a and myosin heavy chain) (Figs. 1 and 7) to ventricle-specific genes (irx4 and mlc2v) (Fig. 6) and later genes specific for secondary myocardium (hand1 and anf) (Fig. 3) (Lin et al., 1997; Firulli and Thattaliyath, 2002). The normal function of MEF2C, therefore, could be to initiate a differentiation program that includes the sequential expression of genes, many of them regulatory, with more refined expression domains as the heart develops. Because expression of many of the genes that we have examined was delayed in onset in the mef2c−/− rather than completely abolished, it is possible that this program is later initiated by either mef2a or mef2d when they are expressed a day later in development (Edmondson et al., 1994; Lin et al., 1997). Redundancy between MEF2C and other members of this family is supported by our recent finding of normal heart development following the cardiac-specific deletion of mef2c after the initiation of mef2a and mef2d expression (Vong et al., 2005). However, cardiac development does not proceed normally in the mutant even after expression of the other MEF2s, probably because of the earlier misexpression of several transcription factors (tbx5, irx4, hand1) important for cardiogenesis.

MEF2C Is Required for the Proper Allocation of Precursors Between the Inflow and Outflow Segments

The mlc2v, irx4, and mlc2a expression data suggest a reduction in the domain of outflow precursors (Fig. 6). A corresponding increase in the size of the sinoatria was, moreover, visible by tbx5 expression at 8 SP (Figs. 5 and 6) and in sections through the atria at E9.5 (Fig. 3). Although suggestive, a more exact delineation of these precursor domains was derived from expression of the cGata6LacZ transgene. This transgene is remarkable in marking the distal, posterior aspects of the cardiac crescent that will give rise predominately to the AVC but also to immediately adjacent regions of the LV and atria (Davis et al., 2001). Because there was no distinction in cGata6LacZ expression between the wildtype and mutant until immediately prior to formation of the linear tube, it appears that the early steps in specifying these lineages are intact (Fig. 7I,J,M,N). The mef2c−/− embryo expressing cGata6LacZ then diverged from normal development during the expansion of the anterior crescent at about 4 SP (Fig. 7K,O). Whereas the cGata6LacZ-positive cells at the distal ends of the anterior crescent contributed to the lateral surfaces of the linear tube in the wildtype, none of these positive cells contributed in the null (Fig. 7L,P). The failure of cGata6LacZ-positive cells to contribute establishes the domain of ventricular precursors in the mef2c−/− to within the region of negative cells near the midline. It further reveals that all of the positive cells that would normally constitute the AVC and part of the LV contribute instead to the sinoatria, indicating a misallocation of cells from the outflow to the inflow segments.

There is an interesting parallel between the actions of retinoic acid (RA) and deletion of mef2c on the distribution of cells between the inflow and outflow segments. Treatment with retinoic acid causes an anterior expansion of the inflow and a commensurate decrease in the outflow that is similar, but substantially more severe, to that caused by deleting mef2c (Xavier-Neto et al., 1999; Davis et al., 2001; Hochgreb et al., 2003). In addition to the morphological similarities, shared changes in gene expression are the reduced domain of the ventricle-specific mlc2v gene and the anterior expansion of the sinoatrial-enriched tbx5 gene (Xavier-Neto et al., 1999; Liberatore et al., 2000). These studies imply that RA treatment or deletion of mef2c alters the fate of cardiomyocytes from the outflow to the inflow. A generally accepted interpretation of the RA studies is that outflow cardiomyocytes are the default pathway of cardiomyocyte differentiation and that RA actively directs differentiation into the inflow lineage (Hochgreb et al., 2003). By analogy, this suggests a model for MEF2C function in segment specification in which it actively promotes outflow-specific differentiation and directs cells to be non-responsive to the inflow-specifying actions of RA. This model agrees with the MEF2-dependence of the outflow-specific mlc2v promoter (Ross et al., 1996) and our data indicating retarded differentiation of outflow precursors in the null. In view of the apparently opposing actions of RA and MEF2C, it is tempting to speculate that RA functions in cardiogenesis, in part, through repressing the activity of MEF2C in sinoatrial precursors on genes specific to the outflow. Experiments to test this possibility are currently underway.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Mice

Construction and genotyping of the mef2c+/− and hand1lacZ mice have been described previously (Lin et al., 1997; Morikawa and Cserjesi, 2004).

Histology and β-Galactosidase Staining

E8.0 to E8.5 embryos were harvested, the yolk sac removed for genotyping, and then fixed in 4% paraformaldehyde/PBS. They were then embedded in paraffin and sectioned at 7 μm. Whole mount staining for β-galactosidase was performed as described (Morikawa and Cserjesi, 2004).

Proliferation Assay

The percentage of mitotic nuclei was determined by immunohistochemistry with antibody to phosphorylated histone H3 (Upstate Biotech; 1:100 dilution) to identify cells in mitosis (Wei et al., 2002). Nuclei were stained with DAPI. Statistical analysis was performed using the Student's t-test with a statistical significance of P < 0.05 and are expressed as the mean ± the SEM.

Apoptosis Assay

TUNEL assays were performed using the In Situ Cell Death Detection Kit (Roche) on paraffin-embedded sections following the manufacturer's protocol.

In Situ Hybridizations

Whole mount in situ hybridizations were performed on E8.0–8.5 mouse embryos as described (Nagy et al., 2003). The embryos were genotyped from DNA isolated from yolk sacs of embryos fixed in 4% paraformaldehyde/PBS.

Reverse Transcription/PCR

Semi-quantitative RT/PCR was performed on total RNA isolated from groups of 3 to 5 ventricles or atria of E9.5 embryos. The mRNAs were first reversed transcribed and normalized to the β-actin signals, and then all subsequent PCR reactions were performed on the same cDNAs essentially as described (Lin et al., 1997). The following primers sets were used for PCR: β-actin (Forward: GGACCTGGCTGGCCGGGACC; Reverse: GCGGTGCACGATGGAGGGGC); mef2b (Forward: CCCTGCAATGTCGGTTTCAGAGC; Reverse: CCCATCAGTCGCCAGGTACAGAG); The identities of the PCR products were confirmed by sequencing.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

We gratefully acknowledge Drs. Benoit Bruneau, Sylvia Evans, and Gary Lyons for in situ probes and John Burch for the cGata6LacZ mice. We also thank Drs. Rebecca Keller and Martha Marvin for a careful reading of the manuscript, and Michael Ragusa for assistance with mouse husbandry.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Bao ZZ, Bruneau BG, Seidman JG, Seidman CE, Cepko CL. 1999. Regulation of chamber-specific gene expression in the developing heart by Irx4. Science 283: 11611164.
  • Bi W, Drake CJ, Schwarz JJ. 1999. The transcription factor MEF2C-null mouse exhibits complex vascular malformations and reduced cardiac expression of angiopoietin 1 and VEGF. Dev Biol 211: 255267.
  • Biben C, Harvey RP. 1997. Homeodomain factor Nkx2–5 controls left/right asymmetric expression of bHLH gene eHand during murine heart development. Genes Dev 11: 13571369.
  • Bruneau BG, Logan M, Davis N, Levi T, Tabin CJ, Seidman JG, Seidman CE. 1999. Chamber-specific cardiac expression of Tbx5 and heart defects in Holt-Oram syndrome. Dev Biol 211: 100108.
  • Bruneau BG, Bao ZZ, Tanaka M, Schott JJ, Izumo S, Cepko CL, Seidman JG, Seidman CE. 2000. Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2–5 and dHand. Dev Biol 217: 266277.
  • Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. 2003. Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart. Dev Cell 5: 877889.
  • Christoffels VM, Habets PE, Franco D, Campione M, de Jong F, Lamers WH, Bao ZZ, Palmer S, Biben C, Harvey RP, Moorman AF. 2000. Chamber formation and morphogenesis in the developing mammalian heart. Dev Biol 223: 266278.
  • Davis DL, Edwards AV, Juraszek AL, Phelps A, Wessels A, Burch JB. 2001. A GATA-6 gene heart-region-specific enhancer provides a novel means to mark and probe a discrete component of the mouse cardiac conduction system. Mech Dev 108: 105119.
  • Dodou E, Verzi MP, Anderson JP, Xu SM, Black BL. 2004. Mef2c is a direct transcriptional target of ISL1 and GATA factors in the anterior heart field during mouse embryonic development. Development 131: 39313942.
  • Dunn SE, Simard AR, Bassel-Duby R, Williams RS, Michel RN. 2001. Nerve activity-dependent modulation of calcineurin signaling in adult fast and slow skeletal muscle fibers. J Biol Chem 276: 4524345254.
  • Edmondson DG, Lyons GE, Martin JF, Olson EN. 1994. Mef2 gene expression marks the cardiac and skeletal muscle lineages during mouse embryogenesis. Development 120: 12511263.
  • Firulli AB, Thattaliyath BD. 2002. Transcription factors in cardiogenesis: the combinations that unlock the mysteries of the heart. Int Rev Cytol 214: 162.
  • Firulli AB, Miano JM, Bi W, Johnson AD, Casscells W, Olson EN, Schwarz JJ. 1996. Myocyte enhancer binding factor-2 expression and activity in vascular smooth muscle cells. Association with the activated phenotype. Circ Res 78: 196204.
  • Gottlieb PD, Pierce SA, Sims RJ, Yamagishi H, Weihe EK, Harriss JV, Maika SD, Kuziel WA, King HL, Olson EN, Nakagawa O, Srivastava D. 2002. Bop encodes a muscle-restricted protein containing MYND and SET domains and is essential for cardiac differentiation and morphogenesis. Nat Genet 31: 2532.
  • Harvey RP. 2002. Patterning the vertebrate heart. Nat Rev Genet 3: 544556.
  • Hochgreb T, Linhares VL, Menezes DC, Sampaio AC, Yan CY, Cardoso WV, Rosenthal N, Xavier-Neto J. 2003. A caudorostral wave of RALDH2 conveys anteroposterior information to the cardiac field. Development 130: 53635374.
  • Kelly RG, Buckingham ME. 2002. The anterior heart-forming field: voyage to the arterial pole of the heart. Trends Genet 18: 210216.
  • Kelly RG, Brown NA, Buckingham ME. 2001. The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell 1: 435440.
  • Kolodziejczyk SM, Wang L, Balazsi K, DeRepentigny Y, Kothary R, Megeney LA. 1999. MEF2 is upregulated during cardiac hypertrophy and is required for normal post-natal growth of the myocardium. Curr Biol 9: 12031206.
  • Kuisk IR, Li H, Tran D, Capetanaki Y. 1996. A single MEF2 site governs desmin transcription in both heart and skeletal muscle during mouse embryogenesis. Dev Biol 174: 113.
  • Li M, Linseman DA, Allen MP, Meintzer MK, Wang X, Laessig T, Wierman ME, Heidenreich KA. 2001. Myocyte enhancer factor 2A and 2D undergo phosphorylation and caspase-mediated degradation during apoptosis of rat cerebellar granule neurons. J Neurosci 21: 65446552.
  • Liberatore CM, Searcy-Schrick RD, Yutzey KE. 2000. Ventricular expression of tbx5 inhibits normal heart chamber development. Dev Biol 223: 169180.
  • Lin Q, Schwarz J, Bucana C, Olson EN. 1997. Control of mouse cardiac morphogenesis and myogenesis by transcription factor MEF2C. Science 276: 14041407.
  • Lin Q, Lu J, Yanagisawa H, Webb R, Lyons GE, Richardson JA, Olson EN. 1998. Requirement of the MADS-box transcription factor MEF2C for vascular development. Development 125: 45654574.
  • Liu ZP, Nakagawa O, Nakagawa M, Yanagisawa H, Passier R, Richardson JA, Srivastava D, Olson EN. 2001. CHAMP, a novel cardiac-specific helicase regulated by MEF2C. Dev Biol 234: 497509.
  • Mao Z, Bonni A, Xia F, Nadal-Vicens M, Greenberg ME. 1999. Neuronal activity-dependent cell survival mediated by transcription factor MEF2. Science 286: 785790.
  • Meilhac SM, Esner M, Kelly RG, Nicolas JF, Buckingham ME. 2004. The clonal origin of myocardial cells in different regions of the embryonic mouse heart. Dev Cell 6: 685698.
  • Mjaatvedt CH, Nakaoka T, Moreno-Rodriguez R, Norris RA, Kern MJ, Eisenberg CA, Turner D, Markwald RR. 2001. The outflow tract of the heart is recruited from a novel heart-forming field. Dev Biol 238: 97109.
  • Molkentin JD, Black BL, Martin JF, Olson EN. 1995. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 83: 11251136.
  • Morikawa Y, Cserjesi P. 2004. Extra-embryonic vasculature development is regulated by the transcription factor HAND1. Development 131: 21952204.
  • Morisaki T, Sermsuvitayawong K, Byun SH, Matsuda Y, Hidaka K, Morisaki H, Mukai T. 1997. Mouse Mef2b gene: unique member of MEF2 gene family. J Biochem (Tokyo) 122: 939946.
  • Nagy A, Gertsenstein M, Vintersten K, Behringer R. 2003. Manipulating the mouse embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. 764 p.
  • Niederreither K, Vermot J, Messaddeq N, Schuhbaur B, Chambon P, Dolle P. 2001. Embryonic retinoic acid synthesis is essential for heart morphogenesis in the mouse. Development 128: 10191031.
  • Okamoto S, Krainc D, Sherman K, Lipton SA. 2000. Antiapoptotic role of the p38 mitogen-activated protein kinase-myocyte enhancer factor 2 transcription factor pathway during neuronal differentiation. Proc Natl Acad Sci USA 97: 75617566.
  • Passier R, Zeng H, Frey N, Naya FJ, Nicol RL, McKinsey TA, Overbeek P, Richardson JA, Grant SR, Olson EN. 2000. CaM kinase signaling induces cardiac hypertrophy and activates the MEF2 transcription factor in vivo. J Clin Invest 105: 13951406.
  • Phan D, Rasmussen TL, Nakagawa O, McAnally J, Gottlieb PD, Tucker PW, Richardson JA, Bassel-Duby R, Olson EN. 2005. BOP, a regulator of right ventricular heart development, is a direct transcriptional target of MEF2C in the developing heart. Development 132: 26692678.
  • Ross RS, Navankasattusas S, Harvey RP, Chien KR. 1996. An HF-1a/HF-1b/MEF-2 combinatorial element confers cardiac ventricular specificity and established an anterior-posterior gradient of expression. Development 122: 17991809.
  • Saga Y, Miyagawa-Tomita S, Takagi A, Kitajima S, Miyazaki J, Inoue T. 1999. MesP1 is expressed in the heart precursor cells and required for the formation of a single heart tube. Development 126: 34373447.
  • Simoes-Costa MS, Vasconcelos M, Sampaio AC, Cravo RM, Linhares VL, Hochgreb T, Yan CY, Davidson B, Xavier-Neto J. 2005. The evolutionary origin of cardiac chambers. Dev Biol 277: 115.
  • Srivastava D, Thomas T, Lin Q, Kirby ML, Brown D, Olson EN. 1997. Regulation of cardiac mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nat Genet 16: 154160.
  • Takeuchi JK, Mileikovskaia M, Koshiba-Takeuchi K, Heidt AB, Mori AD, Arruda EP, Gertsenstein M, Georges R, Davidson L, Mo R, Hui CC, Henkelman RM, Nemer M, Black BL, Nagy A, Bruneau BG. 2005. Tbx20 dose-dependently regulates transcription factor networks required for mouse heart and motoneuron development. Development 132: 24632474.
  • Verzi MP, McCulley DJ, De Val S, Dodou E, Black BL. 2005. The right ventricle, outflow tract, and ventricular septum comprise a restricted expression domain within the secondary/anterior heart field. Dev Biol 287: 134145.
  • von Both I, Silvestri C, Erdemir T, Lickert H, Walls JR, Henkelman RM, Rossant J, Harvey RP, Attisano L, Wrana JL. 2004. Foxh1 is essential for development of the anterior heart field. Dev Cell 7: 331345.
  • Vong LH, Ragusa MJ, Schwarz JJ. 2005. Generation of conditional Mef2c(loxP/loxP) mice for temporal- and tissue-specific analyses. Genesis 43: 4348.
  • Waldo KL, Kumiski DH, Wallis KT, Stadt HA, Hutson MR, Platt DH, Kirby ML. 2001. Conotruncal myocardium arises from a secondary heart field. Development 128: 31793188.
  • Wei L, Imanaka-Yoshida K, Wang L, Zhan S, Schneider MD, DeMayo FJ, Schwartz RJ. 2002. Inhibition of Rho family GTPases by Rho GDP dissociation inhibitor disrupts cardiac morphogenesis and inhibits cardiomyocyte proliferation. Development 129: 17051714.
  • Woronicz JD, Lina A, Calnan BJ, Szychowski S, Cheng L, Winoto A. 1995. Regulation of the Nur77 orphan steroid receptor in activation-induced apoptosis. Mol Cell Biol 15: 63646376.
  • Wu H, Naya FJ, McKinsey TA, Mercer B, Shelton JM, Chin ER, Simard AR, Michel RN, Bassel-Duby R, Olson EN, Williams RS. 2000. MEF2 responds to multiple calcium-regulated signals in the control of skeletal muscle fiber type. Embo J 19: 19631973.
  • Xavier-Neto J, Neville CM, Shapiro MD, Houghton L, Wang GF, Nikovits W, Jr., Stockdale FE, Rosenthal N. 1999. A retinoic acid-inducible transgenic marker of sino-atrial development in the mouse heart. Development 126: 26772687.
  • Yan Z, Serrano AL, Schiaffino S, Bassel-Duby R, Williams RS. 2001. Regulatory elements governing transcription in specialized myofiber subtypes. J Biol Chem 276: 1736117366.
  • Youn HD, Sun L, Prywes R, Liu JO. 1999. Apoptosis of T cells mediated by Ca2+-induced release of the transcription factor MEF2. Science 286: 790793.
  • Yutzey KE, Rhee JT, Bader D. 1994. Expression of the atrial-specific myosin heavy chain AMHC1 and the establishment of anteroposterior polarity in the developing chicken heart. Development 120: 871883.
  • Zaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. 2004. Right ventricular myocardium derives from the anterior heart field. Circ Res 95: 261268.
  • Zhu B, Gulick T. 2004. Phosphorylation and alternative pre-mRNA splicing converge to regulate myocyte enhancer factor 2C activity. Mol Cell Biol 24: 82648275.
  • Zhu B, Ramachandran B, Gulick T. 2005. Alternative pre-mRNA splicing governs expression of a conserved acidic transactivation domain in myocyte enhancer factor 2 factors of striated muscle and brain. J Biol Chem 280: 2874928760.