SEARCH

SEARCH BY CITATION

Keywords:

  • Pitx2c;
  • myogenic differentiation;
  • cell proliferation

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Pitx2 is a paired-related homeobox gene that has been shown to play a central role during development. In the mouse, there are three isoforms, Pitx2a, b, and c, which differ only in their amino terminal regions. Pitx2 is expressed in myotomes, myoblasts, and myofibers and may be involved in muscle patterning. However, the mechanism by which Pitx2 acts in muscle cell lineages as well as the distinct functions of the individual isoforms have not been investigated. In this study, we used Sol8 myoblasts to investigate the function of Pitx2 in skeletal myogenesis. We found that Pitx2c is the main Pitx2 isoform present in Sol8 myoblasts. Overexpression of Pitx2c in Sol8 myoblasts inhibited myocyte differentiation and myotube formation. Furthermore, Sol8 cells overexpressing Pitx2c maintained high proliferative capacity and a significant up-regulation of the cell cycle genes cyclin D1, cyclin D2, and c-myc. Gene expression analysis for Pax3 and the s MyoD and myogenin showed that Pitx2c-overexpression caused Sol8 cells to remain as myoblasts, in an undifferentiated myogenic state. Furthermore, down-regulation of the muscle-specific genes sTnI and MyHC3 demonstrated that Sol8-overexpressing Pitx2c myoblasts failed to reach terminal differentiation. This study sheds light on previously unknown functions of the Pitx2c isoform in balancing proliferation vs. differentiation in a myogenic cell line. Developmental Dynamics 235:2930–2939, 2006. © 2006 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Pitx2 is a member of the bicoid family of homeodomain transcription factors that plays an important role in morphogenesis. Mutations in PITX2 were first identified as the molecular cause of the Rieger syndrome congenital malformations (Semina et al.,1996; Alward,2000; Amendt et al.,2000). Pitx2 is expressed in many tissues during development, including the left lateral plate mesoderm, derivatives of the first brachial arch, the eye, brain, pituitary gland, mandible, heart, and limbs (Muccielli et al.,1996; Gage and Camper,1997; Kitamura et al.,1997; Arakawa et al.,1998). Several laboratories have shown that Pitx2 is a mediator of left–right signaling in vertebrates acting downstream of the Nodal/Lefty cascade (Burdine and Schier,2000; Shiratori et al.,2001). Pitx2-deficient mice are characterized by failure of body-wall closure, arrest in embryo turning, ocular defects, right pulmonary isomerism and defects in cardiac, tooth, and pituitary development (Gage et al.,1999; Kitamura et al.,1999; Lin et al.,1999, Lu et al.,1999).

Molecular studies have demonstrated that three different Pitx2 isoforms (Pitx2a, Pitx2b, and Pitx2c) are expressed during development, and a fourth Pitx2 isoform (Pitx2d) has only been described in humans (Cox et al.,2002). Pitx2a and Pitx2b are generated by alternative splicing mechanisms, and Pitx2c uses an alternative promoter upstream of exon 4 (Semina et al.,1996; Gage and Camper,1997; Arakawa et al.,1998; Gage et al.,1999; Kitamura et al.,1999). Thus, each Pitx2 isoform has identical C termini but different N termini (Gage et al.,1999). Expression analyses, as well as epigenetic and genetic studies, have revealed that Pitx2c is the major isoform involved in heart development (Schweickert et al.,2000; Liu et al.,2001,2002; Campione et al.,2001). Furthermore, Pitx2 expression has been detected in myotomes colocalizing with Pax3 (Kitamura et al.,1999). Pitx2 protein is present in myoblasts of the limb bud, displaying a similar pattern of expression to Pax3 and MyoD (Marcil et al.,2003), suggesting a putative muscle pattern involvement. However, the molecular mechanism by which Pitx2 acts in skeletal muscle cell lineages as well as Pitx2 isoform-specific functions remain unclear.

As a transcription factor, Pitx2 binds to consensus and nonconsensus binding sites for bicoid-type homeodomain transcription factors, activating or repressing the transcription of their target genes to execute specific cellular functions. Recent in vitro studies have shown that Pitx2c and Nkx2.5 (a cardiac-specific transcription factors) synergistically regulate the Nppa (atrial natriuretic factor, ANF) promoter. Cotransfection experiments have revealed a role of p38 MAP kinases in up-regulating Pitx2c activation of the ANF promoter in the presence of MEF2A, providing a molecular mechanism for Pitx2c regulation of heart development (Ganga et al.,2003; Toro et al.,2004). Of interest, it has been reported that Pitx2 is a target gene in the Wnt/Dvl2/beta-catenin pathway and operates in specific cell types to control proliferation by regulating expression of the growth control genes cyclin D1, cyclin D2, and c-Myc (Kioussi et al.,2002; Baek et al.,2003). These authors established that the Pitx2 N-terminal domain is required for its effects on proliferation, although the involvement of different Pitx2 isoforms in this process remain unknown. Taken together, these data lead us to think that Pitx2c could play a pivotal role in coordinating proliferation vs. differentiation in distinct cell types.

The Sol8 cell line has provided an excellent system for studying myocyte differentiation. In most instances, these cells faithfully recapitulate the pattern of gene regulation observed in primary cell cultures of mammalian muscle and express a battery of muscle-specific genes (Daubas et al.,1988; Montarras et al.,1991). Here, we show that Pitx2c is the main Pitx2-isoform present in Sol8 myoblasts, and evaluate the effects of Pitx2c overexpression on cell proliferation and terminal cell differentiation in this myoblast cell line.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Pitx2c Expression in Myoblasts Vs. Myotubes

To test expression levels of different Pitx2 isoforms during the process of “in vitro” differentiation, we performed quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for Pitx2a, Pitx2b, and Pitx2c in Sol8 myoblasts vs. myotubes. Figure 1A shows that, in Sol8 myoblasts, RNA levels were higher for Pitx2c isoform, whereas there are lower Pitx2a and Pitx2b expression levels. However, endogenous Pitx2c expression levels were drastically reduced in differentiated myotubes (Fig. 1A). In addition, the presence of Pitx2c isoform expression in in vivo myoblasts was tested by in situ hybridization in embryonic day (E) 11.5 mouse embryos. As shown Figure 1B, Pitx2c is expressed in myoblasts in the forelimb bud.

thumbnail image

Figure 1. Pitx2c expression in myoblasts. A: Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for different Pitx2 isoforms in Sol8 myoblasts vs. myotubes. Pitx2c shows higher expression levels than Pitx2a and Pitx2b. Moreover, endogenous Pitx2c expression levels decreased in differentiated myotubes. B:Pitx2c expression in the myoblasts of forelimb (arrowheads) as well as in the wall of left ventricle and left horn of the sinus venosus of an embryonic day (E) 11.5 mouse embryo. V, caudal extremity of the wall of left ventricle; lsv, the left horn of the sinus venosus; T, thoracic wall.

Download figure to PowerPoint

Pitx2c Isoform-Specific Overexpression

Based on high Pitx2c expression in undifferentiated myoblasts and the decrease of Pitx2c expression levels on differentiated myotubes, we decided to examine the role of Pitx2c in myocyte differentiation by overexpressing mouse Pitx2c under the control of the muscle-specific α-MHC promoter in the Sol8 myogenic cell line. Sol8 skeletal myoblasts, when induced to differentiate, withdraw from the cell cycle and fuse to form myotubes (Yaffe and Saxel,1977; Daubas et al.,1988). Genes encoding skeletal muscle-specific isoforms, which are not expressed in undifferentiated myoblasts (Hastings et al.,1991; Banerjee-Basu and Buonanno,1993), are quickly induced within 24 hr after the transfer of myoblasts into differentiation medium that contains reduced levels of growth factors. Previous reports have demonstrated α-MHC promoter construct activity in primary muscle cultures and skeletal muscle cell lines (Tsika et al.,1990; Molkentin et al.,1996). RT-PCR analysis in Sol8 cells revealed α-MHC expression in both undifferentiated myoblasts and myotubes (Fig. 2A).

thumbnail image

Figure 2. αMHC expression in Sol8 myoblasts and myotubes. A: Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for αMHC (upper panel) and β-actin (lower panel). C: PCR negative control. MW, molecular weight; MB, Sol8 myoblasts; MT, Sol8 myotubes; RT, RT negative control. B: Enhanced green fluorescent protein (EGFP) expression driven by αMHC promoter in myoblasts (left) and myotubes (right).

Download figure to PowerPoint

To evaluate α-MHC promoter activity, we transiently transfected Sol8 myoblasts with an α-MHC–enhanced green fluorescent protein (EGFP) construct. Transfection of Sol8 cells with the α-MHC–EGFP construct led to green fluorescence expression in approximately 40% of nonfused myoblasts and 30% of the myotubes (Fig. 2B).

To determine whether Pitx2c is involved in the process of muscle differentiation, we stably transfected Sol8 cells with the α-MHC–Pitx2c–IRES–Puro construct. Quantitative RT-PCR analysis was performed to measure Pitx2c expression in Pitx2c-transfected Sol8 cells in comparison with control Sol8 myotubes. As shown in Figure 3D, Pitx2c mRNA expression is increased more than fourfold in Sol8-transfected cells compared with control Sol8 myotubes.

thumbnail image

Figure 3. Pitx2c overexpression in Sol8 cells cultured under differentiation conditions. A: Control myoblasts cultured in growth-promoting conditions (Dulbecco's modified Eagle medium [DMEM] + 10% fetal bovine serum [FBS]). B: Myotubes from control myoblasts after 4 days in differentiation medium (DMEM + 2% horse serum [HS]). C: Sol8 Pitx2c-transfected cells not fuse, and no myotubes were observed after 4 days in differentiation medium. D: Quantitative reverse transcriptase-polymerase chain reaction analysis of Pitx2c overexpression in Sol8-tranfected cells after 4 days in differentiation medium compared with Pitx2c expression levels in control myotubes.

Download figure to PowerPoint

Role of Pitx2c in Myoblasts to Myotubes Differentiation

In normal conditions, control myoblasts fuse and assume an elongated, multinucleated morphology characteristic of differentiating myotubes after 4 days of culture in differentiation medium (Fig. 3B). Surprisingly, after more than 4 days in differentiation medium, Pitx2c-transfected Sol8 cells did not fuse and preserved the morphological characteristics of proliferating myoblasts (Fig. 3C). To characterize the proliferative capacity of Sol8 cells overexpressing Pitx2c, we monitored the number of viable cells in stably transfected and control Sol8 myoblasts, cultured under growth-promoting conditions (10% fetal bovine serum, FBS), over a period of 120 hr. We found that Sol8 cells overexpressing Pitx2c and control myoblasts maintain a similar increase in the number of viable cells after 24 hr of culture. These increases were higher for Sol8 cells overexpressing Pitx2c after 48, 72, 96, and 120 hr in comparison with control Sol8 myoblasts (Fig. 4).

thumbnail image

Figure 4. Proliferative capacity of Sol8 cells overexpressing Pitx2c. Sol8 Pitx2c-transfected cells and control Sol8 myoblasts were seeded at 5 × 104/100-mm dish (in triplicate) and grown for 24, 48, 72, 96, and 120 hr in growth-promoting conditions. Cell viability was determined by trypan blue exclusion. Results shown are representative of three experiments. C-MB, control myoblasts; Sol8-Pitx2c, Sol8 Pitx2c-transfected cells.

Download figure to PowerPoint

Pitx2c-Mediated Cell Cycle Regulation

The expression levels of cell cycle regulators genes cyclin D1, cyclin D2, and c-myc were examined in Sol8 cells overexpressing Pitx2c as well as in control Sol8 cells by quantitative RT-PCR. Cyclin D1, cyclin D2, and c-myc were up-regulated in Sol8 cells overexpressing Pitx2c compared with control cells in both growth and differentiation conditions (Fig. 5). However, we observed that Pitx2c overexpression levels were higher in Pitx2c-transfected cells cultured with 10% serum (sevenfold more compared with control myoblasts; Fig. 5C), whereas no changes in Pitx2a and Pitx2b expression levels were detected in Sol8 cells overexpressing Pitx2c (Fig. 5C). Coinciding with high Pitx2c expression levels, c-myc and cyclin D2 up-regulation were also increased to a greater extent in growth-promoting conditions (Fig. 5A) compared with differentiation-promoting conditions (Fig. 5B).

thumbnail image

Figure 5. Expression levels of growth-control genes in Sol8 cells overexpressing Pitx2c. A: Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of mRNA expression levels for c-myc, cyclin D1, and cyclin D2 in Sol8 cells overexpressing Pitx2c (Sol8-Pitx2c) compared with control myoblasts (C-MB), both cultured under growth-promoting conditions. B: Quantitative RT-PCR analysis of mRNA expression levels for c-myc, cyclin D1, and cyclin D2 in Sol8 cells overexpressing Pitx2c (Sol8-Pitx2c) cultured under differentiation-promoting conditions compared with control myotubes (C-MT). C: Quantitative RT-PCR analysis of Pitx2c, Pitx2a, and Pitx2b mRNA expression levels in Sol8-tranfected cells (Sol8-Pitx2c) cultured under growth-promoting conditions compared with control myoblasts.

Download figure to PowerPoint

Role of Pitx2c in Transcriptional Control of Myogenesis

To determine whether Pitx2c acts by modulating expression of specific skeletal muscle transcription factors, we compared the expression levels of Pax3, MyoD, and myogenin between Sol8 control myotubes and Pitx2c-overexpressing cells that did not fuse after more than 4 days in differentiation medium. Quantitative RT-PCR analysis revealed a dramatic down-regulation of MyoD and myogenin in Pitx2c-overexpressing Sol8 cells compared with control myotubes. However, Pax3 was up-regulated in Pitx2c-overexpressing Sol8 cells (Fig. 6B). These results demonstrate that Pitx2c overexpression caused Sol8 cells to remain in an undifferentiated myogenic state.

thumbnail image

Figure 6. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of specific myogenic transcription factors. A: In Sol8 cells overexpressing Pitx2c under growth-promoting culture conditions, Pax3 mRNA levels were more than fourfold higher (Sol8-Pitx2c) than in control myblasts (C-MB). However, MyoD mRNA levels in Sol8 cells overexpressing Pitx2c (Sol8-Pitx2c) were comparable to the mRNA levels in control myoblasts. Myogenin mRNA levels were more than twofold lower in Sol8 cells overexpressing Pitx2c. B: In Sol8 cells, overexpressing Pitx2c under differentiation culture conditions, Pax3 mRNA levels were more than 2.5-fold higher (Sol8-Pitx2c) than in control myotubes (C-MT). MyoD mRNA levels were more than 20-fold lower in Sol8 cells overexpressing Pitx2c (Sol8-Pitx2c) and myogenin mRNA levels were more than 250-fold lower in Sol8 cells overexpressing Pitx2c.

Download figure to PowerPoint

To elucidate whether Pitx2c-overexpressing Sol8 cells retain gene expression characteristics of undifferentiated myoblasts, quantitative RT-PCR was performed to compare expression levels of specific transcription factors (Pax3, MyoD, and myogenin) between Sol8 cells overexpressing Pitx2c and control myoblasts, both cultured under growth-promoting conditions (Dulbecco's modified Eagle medium [DMEM] + 10% FBS). This analysis showed similar expression levels for MyoD for both cells populations. However, compared with undifferentiated myoblasts, there was an up-regulation of Pax3 and down-regulation of myogenin in Pitx2c-overexpressing Sol8 cells (Fig. 6A).

Pitx2c Overexpression and Terminal Differentiation

To investigate the effects of Pitx2c overexpression on skeletal muscle terminal differentiation, we studied expression levels of the skeletal muscle contractile proteins slow skeletal troponinI (sTnI) and skeletal myosin heavy chain (MyH3) in Pitx2c-overexpressing Sol8 cells compared with control myotubes. Quantitative RT-PCR revealed that RNA levels of sTnI and MyH3 were clearly decreases in Pitx2c-overexpressing Sol8 cells as compared with control myotubes (Fig. 7).

thumbnail image

Figure 7. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for genes coding for specific skeletal muscle contractile proteins in Sol8 cells overexpressing Pitx2c under differentiation culture conditions. A:sTnI mRNA expression levels decreased more than 12-fold in Sol8 cells overexpressing Pitx2c (Sol8-Pitx2c) compared with control myotubes (C-MT). B: For MyH3, mRNA expression levels decreased more than 70-fold in Sol8 cells overexpressing Pitx2c as compared with control myotubes.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The Sol8 myoblast cell line cultured in the presence of 10% FBS proliferates as mononucleated cells. Sol8 myoblasts terminally differentiate into skeletal myocytes and fuse to form multinucleated myotubes when grown to confluence and deprived of growth factors (Yaffe and Saxel,1977; Daubas et al.,1988). We have demonstrated that overexpression of Pitx2c in Sol8 myoblasts, the main Pitx2 isoform present in this cell line, maintained high proliferative capacity and completely blocked terminal differentiation of this skeletal muscle cell line. We found that after 4 days of culture in differentiation medium, and in contrast with control α-MHC–EGFP Sol8 transfected cells, α-MHC–Pitx2c–IRES–Puro transfected cells failed to form multinucleated myotubes. These data are further supported by a drop in levels of endogenous Pitx2c expression at the onset of myogenic differentiation, thus indicating that Pitx2c expression modulates the terminal differentiation stage of skeletal myogenesis.

Pitx2 has been identified as a target of the Wnt/Dvl2/β-catenin signal transduction cascade promoting proliferation (Kioussi et al.,2002). In the C2C12 myoblast cell line, a non–isoform-specific effect of Pitx2 regulating expression of several cell cycle genes by binding to the c-myc, cyclin D1, and cyclin D2 promoters has been described (Baek et al.,2003). Our study shows that Pitx2c overexpression in Sol8 myoblast leads to an increase in cell proliferation and modulates c-myc, cyclin D1, and cyclin D2 expression, without changes in Pitx2a and Pitx2b expression levels, indicating a c-isoform–specific effect of Pitx2-dependent myocyte proliferation.

It has been well established that cell cycle genes such as cyclin D1 and cdc2 are serum-induced in myoblasts (Jahn et al.,1994). Moreover, up-regulation of cell cycle genes has been reported in serum-treated terminally differentiated C2C12 myotubes (Tiainen et al.,1996). We observed that, coinciding with high Pitx2c overexpression, when Sol8 cells were cultured in growth-promoting conditions, the increases in cyclin D2 and c-myc mRNA levels were higher. These data are in agreement with those of Kioussi et al. (2002), who found that cyclin D2 transcripts were robustly induced after serum treatment in Wnt-dependent activation of Pitx2 in C2C12 cells, and serum alone caused some appearance of Pitx2 on the cyclin D2 promoter. Thus, serum may have an additional effect on both an increase in Pitx2c overexpression and cell cycle gene transcripts in Pitx2c-overexpressing Sol8 cells in 10% FBS.

Embryonic, fetal, and adult myoblasts in the limb have their origins in the hypaxial migratory population of muscle precursors (Christ et al.,1977). The stages of skeletal myogenesis are well defined (Buckingham et al.,2003). Pax3 expression marks the early step of myogenic cell specification and is required for proper cell delamination and migration from the dermomyotome (Tajbakhsh et al.,1997). Initiation of myogenic determination begins when precursor cells reach the limb and express the muscle regulatory factors (MRF) MyoD and Myf5 (Tajbakhsh and Buckingham,1994). The activation of the differentiation program depends on the presence of the MRF myogenin (Buckingham et al.,2003). Finally, MRFs activate transcription of specific structural genes by binding to their promoters (Christ and Brand-Saberi,2002). Our findings show that Pitx2c overexpression in Sol8 cells cultured under differentiation conditions results in Pax3 up-regulation and MyoD and myogenin down-regulation. Pax3 up-regulation and myogenin down-regulation were maintained compared with control myoblasts when Pitx2c-overexpressing Sol8 cells were cultured in growth-promoting conditions. However, MyoD mRNA levels were comparable between Pitx2c-overexpressing Sol8 cells and undifferentiated myoblasts in 10% FBS. As expected, MRF down-regulation in Pitx2c-overexpressing Sol8 cells limited terminal differentiation demonstrated by a drastic decrease in sTnI and MyHC3 mRNA expression levels. Taken together, these results suggest that Pitx2c is implicated in the onset of myogenic differentiation.

Several authors have described Pitx2 and Pax3 coexpression in migratory precursor myoblasts as well as limb bud myoblasts (Kioussi et al.,2002; Marcil et al.,2003). The inhibitory effects of Pax3 on myogenic differentiation in myoblasts have been reported (Epstein et al.,1995). Our results show that Pitx2c overexpression invariably leads to Pax3 up-regulation. We have identified four putative Pitx2-binding sites (5′-TAATCC-3′) in the Pax3 promoter (one of them 417 bp upstream of transcription start site), suggesting that Pax3 could be a direct Pitx2 target gene in myoblasts. Thus, based in our in vitro data, we proposed that Pitx2c could be implicated in the regulation of Pax3 expression (a key myogenic determination gene in myogenic regulatory cascade) from the determination until the activation of the differentiation program in myoblasts. It nonetheless remains to be explored in detail the genetic interactions of these two transcription factors during skeletal myogenesis in vivo. Of interest, Kitamura et al. (1999) have shown that, in the absence of Pitx2, the extraocular muscles are not formed. The extraocular muscles, whose origin remains undefined, are characterized by the lack of Pax3 expression, thus suggesting that Pitx2 might be a key myogenic determination gene in this particular context.

In conclusion, this study demonstrates a novel function of the c-isoform of the transcription factor Pitx2 in balancing proliferation vs. differentiation during skeletal myogenesis. Pitx2c overexpression in Sol8 cells kept the cells in a proliferative state and prevented terminal differentiation. These findings may have future applications in the regeneration of skeletal muscle using myoblast therapy.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

In Situ Hybridization

Mouse embryos of the Balb/c strain from E11.5 were fixed in 4% freshly prepared formaldehyde in PBS overnight at 4°C, dehydrated in a graded series of ethanol solutions, and paraffin embedded. Serial sections were cut at 8μm thickness and mounted on RNase-free 3-aminipropyltriethoxysilane–coated slices. In situ hybridization was performed essentially as previously described (Franco et al.,2001). The riboprobe used in this study was mouse Pitx2c (807 bp containing 5′ untranslated and coding sequences of exon 4; accession no. AJ243597) (Schweickert et al.,2000).

Cell Culture

Mitotic Sol8 mouse myoblasts (Daubas et al.,1988) were cultured in growth medium (GM), consisting of DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and 50 U/ml penicillin–streptomycin. When the cells reached confluence, GM was switched to differentiation medium (DM), consisting of DMEM supplemented with 2% horse serum. Contractile myotubes were observed after 4 days. Growth and differentiation medium were replaced by fresh medium every 48 hr.

Plasmid Constructs

The pαMHC-Pitx2c–IRES–Puromycin construct was obtained from several plasmids. The puromycin resistance portion of the plasmid was produced by removing the TK promoter from the pTKpuro45 plasmid (Dr. S. Tajbakhsh, Pasteur Institute, France) through digestion with BamHI and EcoRV. Then a 470-bp fragment containing an internal ribosome entry site (IRES) was amplified by PCR from the pFMDV–IRES plasmid (Dr. Martínez-Salas, CBM, Spain), using primers that contained BamHI and EcoRV sites. After digestion with both enzymes, the 470-bp fragment was cloned into the vector upstream of the puromycin resistance gene and the pIRES–Puro construct was generated.

For the production of the pαMHC–Pitx2c construct, an approximately 1-kb cDNA fragment from the mouse Pitx2c gene, containing the whole open reading frame was cloned into the pαMHC plasmid (Subramaniam et al.,1993) containing the αMHC promoter. The pαMHC–Pitx2c–IRES–Puro construct was generated by cloning the 6.5-kb fragment containing the Pitx2c cDNA driven by the αMHC promoter (≈ 5.5 kb) into the BamHI-cleaved pIRES–Puro plasmid upstream of the IRES.

The pαMHC–EGFP plasmid was generated by cloning the 5.5-kb fragment from the pαMHC–Pitx2c plasmid corresponding to αMHC promoter into the SmaI-cleaved pEGFP–C1 plasmid (Invitrogen). Both constructs were verified by sequencing.

DNA Transfections

Two independent transfections were performed in Sol8 myoblasts with two different plasmids: pαMHC–Pitx2c–IRES–Puro and pαMHC–EGFP. The vectors were linearized with ScaI and KpnI, respectively, and then purified by phenol–chloroform extraction followed by ethanol precipitation. In both cases, 10 μg of the linearized plasmid were used and Sol8 myoblasts were transfected by using the Lipofectamine Reagent (Invitrogen) following the supplier's protocol. The cells were seeded at 3 × 105 cells/100 mm dish and transfected in serum-free conditions for 5 hr. Fresh growth medium was added the morning after transfection, and cells were allowed to grow until they reached confluence. Then the medium was switched to differentiation medium, and myotubes were observed after 4 days.

The Sol8 myotubes generated from Sol8 myoblasts transiently transfected with pαMHC–EGFP were checked for EGFP expression driven by the αMHC promoter through observation under an epifluorescence microscope.

For stable transfection, Sol8 myoblasts transfected with pαMHC–Pitx2c–IRES–Puro were selected in medium containing 1 μg/ml puromycin (Sigma) for 2 weeks and then the puromycin concentration was reduced to 0.5 μg/ml puromycin. Stable pools of cells were checked for Pitx2c overexpression by real-time RT-PCR. After selection and culture for 4 days in differentiation medium, only mitotic myoblasts remained and no myotubes were observed.

To evaluate proliferative capacity, Sol8 cells overexpressing Pitx2c as well as control myoblasts were cultured in DMEM with 10% FBS. After 24, 48, 72, 96, and 120 hr of culture, cells were trypsinized and stained with 0.13% trypan blue to determine cell viability. Sol8 cells overexpressing Pitx2c, cultured in both growth- and differentiation-promoting conditions, were checked for the expression levels of several genes involved in proliferation and terminal differentiation.

Total RNA Extraction and Reverse Transcription

Total RNA was extracted from control myoblasts and myotubes as well as from Pitx2c-transfected cells using the TriPure Isolation Reagent (Roche) according to the supplier's protocol. To avoid genomic DNA contamination, total RNA extracted was treated with 20 U of RNase-free DNase (Roche) for 1 hr at 37°C and then purified using a standard phenol–chloroform standard protocol. One microgram of total RNA was reverse transcribed using Superscript RNase H reverse transcriptase (Invitrogen) and a 15-mer oligo-dT primer (Promega) for 1 hr at 37°C according to the manufacturer's protocol. As a reverse transcription control, each sample was subjected to the same process without reverse transcriptase.

PCR

The cDNAs from Sol8 myoblasts and myotubes were amplified using specific oligonucleotides primers based on available NCBI sequence data. The primers used in this work were obtained from Genotek (Bonsai Technologies Group, Spain). PCR was performed within a Biometra PCR thermal cycler. PCR reactions were performed in 0.2-ml tubes in a 50-μl total volume containing 2 mM MgCl2, 0.2 mM dNTP, 2U of FastStart Taq DNA Polymerase (Roche), and 2 μl of the reverse transcribed RNA. β-actin was used in parallel for each run as an internal control. Amplification conditions were 95°C for 5 min; 40 cycles of 95°C for 30 sec, annealing temperature for 30 sec and 72°C for 30 sec. The final cycle was 72°C for 7 min. Specific primers for each gene analyzed, annealing temperatures, and amplicon sizes are shown in Table 1.

Table 1. Specific Primers, Annealing Temperatures, and Amplicon Sizes for PCRa
Gene PrimerAnnealing temperatureAmplicon size
  • a

    The polymerase chain reaction products were verified by 2% agarose gel electrophoresis. PCR, polymerase chain reaction.

β-actinSense Antisense5′-TGAGGAGCACCCTGTGCT-3′62143
  5′-CCAGAGGCATACAGGGAC-3′  
α-MHCSense Antisense5′-CTCAGCCAGGCCAATAGAAT-3′58.2331
  5′- GACTCCATCTTCTTCTTCTGG -3′  

Quantitative Real-Time PCR

Real-time PCR was performed within an iCycler PCR thermal cycler (Bio-Rad, Spain) and SYBR Green detection system (Bio-Rad). PCR reactions were performed in 0.2-ml optical tubes (Bio-Rad) in a 20-μl total volume containing Sybr Green Mix (Bio-Rad) and 2 μl of the reverse transcribed RNA. β-actin was used in parallel for each run as an internal control. Amplification conditions were 95°C for 5 min; 40 cycles of 95°C for 30 sec, annealing temperature for 30 sec and 72°C for 30 sec. The final cycle was 72°C for 7 min. Specific primers for each gene analyzed, annealing temperatures, and amplicon sizes are shown in the Table 2.

Table 2. Specific Primers, Annealing Temperatures, and Amplicon Sizes for Quantitative Real-Time PCRa
Gene PrimerAnnealing temperatureAmplicon size
  • a

    PCR, polymerase chain reaction.

β-actinSense Antisense5′-TGAGGAGCACCCTGTGCT-3′62143
  5′-CCAGAGGCATACAGGGAC-3′  
Pitx2cSense Antisense5′-CTTGGAGCACCGAGCAGC-3′61.1309
  5′-CTGGAAAGTGGCTTCCAG-3′  
Pitx2aSense Antisense5′-GAGAGCAGCAGACAGAAAC-3′60270
  5′-ATCTTTCTCTAATTGCACGC 3′  
Pitx2bSense Antisense5′-GGTGCAGTTCACGGACTCTC-3′60233
  5′-TGTCTGGGTAGCGGT TTCTC-3′  
Pax3Sense Antisense5′-GGAGACCTCTTACCAGCCCACGTC-3′64.2171
  5′-GCTTGAAAATCCATGCCTGGTGCT-3′  
Myh3Sense Antisense5′-GCCAGGATGGGAAAGTCACTGTGG-3′63.4137
  5′-GGGCTCGTTCAGGTGGGTCAGC-3′  
sTnISense Antisense5′-GGAAATCCAAGATCACTGCCTCC-3′62167
  5′-GGGCACTGAGGGACAGACCA-3′  
c-mycSense Antisense5′-GAGGAGACACCGCCCACCACC-3′63.2177
  5′-GCACCTCTTGAGGACCAGTGG-3′  
Cyclin D1Sense Antisense5′-TCCTGCTACCGCACAACGC-3′62.5172
  5′-CCAGCTTCTTCCTCCACTTCCC-3′  
Cyclin D2Sense Antisense5′-CTGGCCAAGATCACCCAC-3′58162
  5′-CACGTCTGTAGGGGTGGTG-3′  

Each PCR reaction was carried out at least 5 times to obtain a representative average. The relative level of expression of each gene was calculated as the ratio of the extrapolated levels of expression of each gene and β-actin mRNAs. The PCR products were verified by 2% agarose gel electrophoresis. For each pool of cDNA used, Pitx2c overexpression was tested.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

We thank Dr. S. Tajbakhsh (Pasteur Institute, France) and Dr. Martínez-Salas (CBM, Spain) for supplying the pTKpuro45 and pFMDV–IRES plasmids, respectively. S.M. and F.H.-T. are recipients of predoctoral fellowships from the Ministry of Education and Science, Spain.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Alward WL. 2000. Axenfeld-Rieger syndrome in the age of molecular genetics. Am J Ophthalmol 130: 107115.
  • Amendt BA, Semina EV, Alward WL. 2000. Rieger syndrome: a clinical, molecular, and biochemical analysis. Cell Mol Life Sci 57: 16521666.
  • Arakawa H, Nakamura T, Zhadanov AB, Fidanza V, Yano T, Bullrich F, Shimizu M, Blechman J, Mazo A, Canaani E, et al. 1998. Identification and characterization of the ARP1 gene, a target for the human leukaemia ALL1 gene. Proc Natl Acad Sci U S A 95: 45734578.
  • Baek SH, Kioussi C, Briata P, Wang D, Nguyen HD, Ohgi KA, Glass GK, Wynshaw-Boris A, Rose DW, Rosenfeld MG. 2003. Regulated subset of G1 growth-control genes in response to derepression by the Wnt pathway. Proc Natl Acad Sci U S A 100: 32453250.
  • Banerjee-Basu S, Buonanno A. 1993. cis-acting sequences of the rat troponin I slow gene confer tissue-and development-specific transcription in cultured muscle cells as well as fiber type specificity in transgenic mice. Mol Cell Biol 13: 70197028.
  • Buckingham M, Bajard L, Chang T, Daubas P, Hadchouel J, Meilhac S, Montarras D, Rocancourt D, Relaix F. 2003. The formation of skeletal muscle: from somite to limb. J Anat 202: 5968.
  • Burdine RD, Schier AF. 2000. Conserved and divergent mechanisms in left-right axis formation. Genes Dev 14: 763776.
  • Campione M, Ros MA, Icardo JM, Piedra E, Christoffels VM, Schweichert A, Blum M, Franco D, Moorman AFM. 2001. Pitx2 expression defines a left cardiac lineage and provides evidence for the existence of ventricular isomerism in iv mice. Dev Biol 231: 252264.
  • Christ B, Brand-Saberi B. 2002. Limb muscle development. Int J Dev Biol 46: 905914.
  • Christ B, Jacob HJ, Jacob M. 1977. Experimental analysis of the origin of the wing musculature in avian embryos. Anat Embryol (Berl) 150: 171186.
  • Cox CJ, Espinosa HM; McWilliams B, Chappell K, Morton L, Hjalt TA, Semina EV, Amedt BA. 2002. Differential regulation of gene expression by PITX2 isoforms. J Biol Chem 277: 2500125010.
  • Daubas P, Klarsfeld A, Garner I, Pinset C, Cox R, Buckingham M. 1988. Functional activity of the two promoters of myosin alkali light chain gene in primary muscle cell cultures: comparison with other muscle gene promoters and other culture system. Nucleic Acids Res 16: 12511271.
  • Epstein JA, Lam P, Jepeal L, Maas RL, Shapiro DN. 1995. Pax3 inhibits myogenic differentiation of cultured myoblast cells. J Biol Chem 270: 1171911722.
  • Franco D, de Boer PAJ, de Gier-de Vries C, Lamers WH, Moorman A. 2001. Methods on in situ hybridization, immunohistochemistry and β-galactosidase reporter gene detection. Eur J Morphol 39: 325.
  • Gage PJ, Camper SA. 1997. Pituitary homeobox 2, a novel member of the bicoid-related family of homeobox genes, is a potential regulator of anterior structure formation. Hum Mol Genet 6: 457464.
  • Gage PJ, Suh H, Camper SA. 1999. Dosage requirement of Pitx2 for development of multiple organs. Development 126: 46434651.
  • Ganga M, Espinoza HM, Cox CJ, Morton L, Hjalt TA, Lee Y, Amendt B. 2003. PITX2 isoform-specific regulation of atrial natriuretic factor expression. J Biol Chem 278: 2243722445.
  • Hastings KE, Koppe RI, Msrmor E, Bader E, Shimada Y, Toyota N. 1991. Structure and developmental expression of troponin I isoforms. cDNA clone analysis of avian cardiac troponin I mRNA. J Biol Chem 266: 1965919665.
  • Jahn L, Sadoshima J, Izumo S. 1994. Cyclins and cyclin-dependent kinases are differentially regulated during terminal differentiation of C2C12 muscle cells. Exp Cell Res 212: 297307.
  • Kioussi C, Briata P, Baek SH, Herman T, Ohgi KA, Lin C, Gleiberman A, Wang J, Brault V, Ruiz-Lozano P, Nguyen HD, Kemler R, Glass CK, Wynshaw-Boris A, Rosenfeld MG. 2002. Identification of a Wnt/Dvl/β-catenin-Pitx2 pathway mediating cell-type-specific proliferation during development. Cell 111: 673685.
  • Kitamura K, Miura H, Yanazawa M, Miyashita T, Kato K. 1997. Expression pattern of Brx1 (Rieg gene), Sonic hedgehog, Nlx2.2, Dlx1 and Arx during zona limitans intrathalamica and embryonic ventral lateral geniculate nuclear formation. Mech Dev 67: 8396.
  • Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M. 1999. Mouse Pitx2 deficiency leads to anomalies to the ventral body wall, heart, extra-and periocular mesoderm and right pulmonary isomerism. Development 126: 57495758.
  • Lin CR, Kioussi C, O'Conell S, Briata P, Szeto D, Liu F. Izpisua-Belmonte JC, Rosenfeld MG. 1999. Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature 401: 279282.
  • Liu C, Liu W, Lu MF, Brown NA, Martin JF. 2001. Regulation of left-right asymmetry by thresholds of Pitx2c activity. Development 128: 10391048.
  • Liu C, Liu W, Palie J, Lu MF, Brown NA, Martin JF. 2002. Pitx2c patterns anterior myocardium and aortic arch vessels and is required for local cell movement into atrioventricular cushions. Development 129: 50815091.
  • Lu MF, Pressman C, Dyer R, Johnson RL, Martin JF. 1999. Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature 401: 276268.
  • Marcil A, Dumontier E, Chamberland M, Camper SA, Drouin J. 2003. Pitx1 and Pitx2 are required for development of hindlimb buds. Development 130: 4555.
  • Molkentin JD, Jobe SM, Markham BE. 1996. α-myosin heavy chain gene regulation: delineation and characterization of the cardiac muscle-specific enhancer and muscle-specific promoter. J Mol Cell Cardiol 28: 12111225.
  • Montarras D, Chelly J, Bober E, Arnold H, Ott MO, Gros F, Pinset C. 1991. Developmental patterns in the expression of Myf5, MyoD, myogenin, and MRF4 during myogenesis. New Biol 3: 592600.
  • Muccielli ML, Martinez S, Pattyn A, Goridis C, Brunet JF. 1996. Otlx2 and an Otlx-related homeobox gene expressed in the pituitary gland and in a restricted pattern in the forebrain. Mol Cell Neurosci 8: 258271.
  • Schweickert A, Campione M, Steinbeisser H, Blum M. 2000. Pitx2 isoforms: involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left-right asymmetry. Mech Dev 90: 4151.
  • Semina EV, Reiter R, Leysens NJ, Alward WL, Small KW, Datson NA, Siegel-Bartelt J, Bierke-Nelson D, Bitoun P, Zabel BU, et al. 1996. Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet 14: 392399.
  • Shiratori H, Sakuma R, Watanabe M, Hashiguchi H, Mochida K, Sakai Y, Nishino J, Saijoh Y, Whitman M, Hamada H. 2001. Two-step regulation of left-right asymmetric expression of Pitx2: initiation by nodal signalling and maintenance by Nkx2. Mol Cell 7: 137149.
  • Subramaniam A, Gulick J, Neumann J, Knotts S, Robbins J. 1993. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter. J Biol Chem 268: 43314336.
  • Tajbakhsh S, Buckingham M. 1994. Mouse limb muscle is determined in the absence of the earliest myogenic factor Myf-5. Proc Natl Acad Sci U S A 91: 747751.
  • Tajbakhsh S, Rocancourt D, Cossu G, Buckingham M. 1997. Redefining the genetic hierarchies controlling skeletal myogenesis: Pax3 and myf-5 act upstream of Myod. Cell 89: 127138.
  • Tiainen M, Pajalunga D, Ferrantelli F, Soddu S, Salvatori G, Sacchi A, Crescenzi M. 1996. Terminally differentiated skeletal myotubes are not confined to G0 but can enter G1 upon growth factor stimulation. Cell Growth Differ 7: 10391050.
  • Toro R, Saadi I, Kuburas A, Nemer M, Russo AF. 2004. Cell-specific activation of the ANF promoter by PITX2 and MEF2A. J Biol Chem 279: 5208752094.
  • Tsika RW, Bahl JJ, Leinwand LA, Morkin E. 1990. Thyroid hormone regulates expression of a transfected human α-myosin heavy-chain fusion gene in fetal rat heart cells. Proc Natl Acad Sci U S A 87: 379383.
  • Yaffe D, Saxel O. 1977. A myogenic cell line with altered serum requirements for differentiation. Differentiation 7: 159166.