SEARCH

SEARCH BY CITATION

Keywords:

  • serotonin;
  • receptor;
  • mutation;
  • ectoderm;
  • gastrulation;
  • cuticle;
  • affinity

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Serotonin (5-HT) not only works as a neurotransmitter in the nervous system, but also as a morphogenetic factor during early embryogenesis. In Drosophila, a previous report showed that embryos that lack the 5-HT2Dro receptor locus, display abnormal gastrulation movements. In this work, we screened for point mutations in the 5-HT2Dro receptor gene. We identified one point mutation that generates a gain of serotonin affinity for the receptor and affects germband extension: 5-HT2DroC1644. Embryos homozygous for this point mutation display a fourfold increase in the maximal speed of ectodermal cell movements during the rapid phase of germband extension. Homozygous 5-HT2DroC1644 embryos present a cuticular phenotype, including a total lack of denticle belt. Identification of this gain of function mutation shows the participation of serotonin in the regulation of the cell speed movements during the germband extension and suggests a role of serotonin in the regulation of cuticular formation during early embryogenesis. Developmental Dynamics 236:991–999, 2007. © 2007 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

In vertebrates, the biogenic amine serotonin (5-hydroxytryptamine, 5-HT) affects a wide variety of central and peripheral functions involved in behavioral and physiological activities in addition to embryonic development. Numerous receptor subtypes mediate the many functions of 5-HT. At least 14 different receptors have been molecularly characterized in mammals. All receptors except 5-HT3 belong to the G protein coupled receptor family and activate different signaling pathways. In insects, biogenic amines are similarly involved as neuromodulators and neurotransmitters, in addition to their role in cross-linking proteins and chitin during the sclerotization of the cuticle (Wright, 1987). In Drosophila, four 5-HT receptors have been described (Witz et al., 1990; Saudou et al., 1992; Colas et al., 1995) in addition to the transporter (Park et al., 2006).

We previously reported that the G-protein coupled receptor 5-HT2Dro is an ortholog of the mammalian 5-HT2A, B, C receptor subfamily. The expression of 5-HT2Dro receptor mRNA and protein starts after cellularization at the blastoderm stage, when major gastrulation movements begin. Further experiments demonstrated that the 5-HT2Dro receptor is functional during early developmental stages. Concomitant with 5-HT2Dro receptor expression, there is also a detectable transient peak of 5-HT synthesis (Colas et al., 1995). Moreover, the 5-HT2Dro receptor mRNA is expressed in a pattern similar to the pair-rule gene Fushi tarazu (Pankratz and Jäckle, 1993). In contrast to other pair-rule genes whose expression surrounds the embryo entirely, the seven stripes of 5-HT2Dro mRNA are restricted to the presumptive ectoderm.

We previously demonstrated that embryos homozygous for the deficiency Df(3R)HTRI, that removes the 5-HT2Dro receptor locus, display abnormal morphogenetic movements during the germband extension (GBE) and die at the end of embryogenesis or early first-instar larval stage (Colas et al., 1999b). However, a contribution of other genes present in the 55 kb of DNA deleted in Df(3R)HTRI could not be completely ruled out. In this work, we looked for a point mutant in the 5-HT2Dro receptor gene to validate the functions of 5-HT in GBE process.

In wild-type gastrulae, peaks of both 5-HT2Dro receptor expression and 5-HT synthesis coincide precisely with the onset of GBE. We previously reported that the peak of 5-HT synthesis is dependent on the maternal deposition of biopterins, cofactors of tryptophan hydroxylase (the limiting enzyme in 5-HT synthesis) and on the zygotic expression of both tryptophan hydroxylase and DOPA decarboxylase (Colas et al., 1999a). Mutant embryos with an impaired peak of 5-HT synthesis display a particular cuticular organization called “double line” (Colas et al., 1999b), which was similarly observed in Df(3R)HTRI homozygous embryos and in shotgun embryos mutated in the DE-cadherin locus (Colas et al., 1999b). Whether the cuticular phenotype is a direct consequence of a gastrulation defect remained to be determined.

GBE results in an approximate doubling in length of the anteroposterior axis of the Drosophila embryo (Zallen and Wieschaus, 2004). As in other species, this process of convergent extension relies mostly on cell intercalation (Schoenwolf and Alvarez, 1989). Irvine and Wieschaus proposed that ectodermal cell intercalation, the main process in GBE, could be driven by adhesion strength, which would be different in adjacent segments (Irvine and Wieschaus, 1994). Differences in adhesion strength between cells of alternate segments would control cell intercalation speed. In fact, cells do not delaminate or migrate across the tissue but, instead, rearrange specific contacts after an ordered spatial–temporal pattern of junction remodeling. It has been proposed that axis elongation in Drosophila occurs through stereotyped cell-shape changes across a uniform field (Bertet et al., 2004). However, this model stipulates a single round of intercalation, whereas multiple rounds are required for full elongation. Recently, the asymmetric distribution of cytoskeletal and junctional proteins has been proposed to contribute directly to polarized cell behavior during tissue elongation (Bertet et al., 2004; Zallen and Wieschaus, 2004; Blankenship et al., 2006).

DE-cadherins localize to the apical part of the lateral membranes of ectodermal cells and are involved in cell adhesion (Tepass et al., 1996; Oda et al., 1998; Greaves et al., 1999). DE-cadherin regulation seems to be important for the GBE process. Zallen and Wieschaus have demonstrated that striped expression of the pair-rule genes are both necessary and sufficient to orient planar polarity (Zallen and Wieschaus, 2004). The F-actin asymmetry was reported as the primary planar polarity in the GBE, followed by the segregation of Myosin II and Bazooka into complementary surface domains. DE-cadherin and Armadillo/beta-catenin would then be recruited to sites of new cell contacts before Bazooka association (Blankenship et al., 2006). The local destabilization of DE-cadherin–based adhesion indeed may cause the local destabilization of polarized cell behavior during tissue elongation. Regulators of these phenomenon remain to be identified.

In this work, we screened for mutations in the 5-HT2Dro receptor gene and identified one point mutant that generates an increase in 5-HT affinity for the receptor. Homozygous embryos for this mutation present a defect in cell speed movements during GBE accompanied by cuticular defects.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

l(3)82CDbC1644 Encodes a Mutant 5-HT2Dro Receptor With Increased Affinity for 5-HT

To understand the embryonic functions of 5-HT, we became interested in mapping mutants in the 5-HT2Dro receptor. The gene encoding this receptor is localized on the right arm of the third chromosome at 82C5 (Colas et al., 1995). Using EMS, Meagraw and Kaufman (FlyBase) screened several homozygous lethal mutants in the 82C4-D5 region. Five mutants (l(3)82CDbC1644, l(3)82CDcC931, l(3)82CDdC142, l(3)82CDdC360, and l(3)82CDcl6) were mapped in this interval, because they all complement with Df(3R)6-7 (82D5-82F3-6) but not with Df(3R)110 (82C4-82F3). To check whether some of these point mutants affect the 5-HT2Dro receptor gene, we refined further the mapping using Df(3R)HTRI (82C4-82D5) that deletes 5-HT2Dro and the Df(3R)HTR6 (82D2-82D5) that leaves the gene intact (Fig. 1A; Colas et al., 1999b). The l(3)82CDbC1644, l(3)82CDcC931, l(3)82CDdC142, and l(3)82CDdC360 were lethal with Df(3R)HTRI but viable with Df(3R)HTR6, indicating that they are in the region of interest. However, l(3)82CDcl6 that is viable with Df(3R)HTRI, does not map at the 5-HT2Dro locus and was not further analyzed. We found that l(3)82CDdC142 and l(3)82CDdC360 define a distinct complementation group in 82C5, because they fail to complement the lethal insertion j3A4 localized in the vicinity of 5-HT2Dro (Colas et al., 1999b).

thumbnail image

Figure 1. l(3)82CDbC1644 is an allele of 5-HT2Dro that encodes a P52S mutant receptor. A: The l(3)82CDbC1644, l(3)82CDcC931, l(3)82CDdC142, l(3)82CDdC360, and l(3)82CDcl6 complementation groups are represented. Their locations were ordered and refined by deletion mapping with Df(3R)HTRI and Df(3R)HTR6. Only l(3)82CDbC1644 and l(3)82CDcC931 mapped in the vicinity of 5-HT2Dro. B: The sequence of the second exon of the 5-HT2Dro gene (first coding exon) is presented for wild-type (WT) and 5-HT2DroC1644 chromosomes. A C to T transition in l(3)82CDbC1644 changes the proline 52 into a serine within the long N-terminus domain of the receptor. C: Schematic drawing indicating the location of the point mutation in the receptor molecule of the l(3)82CDbC1644 strain. TM, transmembrane domain.

Download figure to PowerPoint

We then focused on the two remaining mutants l(3)82CDbC1644 and l(3)82CDcC931. To assess whether they correspond to mutant alleles of the 5-HT2Dro gene, we extracted genomic DNA from a single embryo to check by polymerase chain reaction (PCR) the presence of the balancer chromosome. We took advantage of a reporter gene (twi-LacZ) of the balancer chromosome to distinguish the homozygous mutant embryos from the others. We sequenced all the coding exons of the 5-HT2Dro receptor gene of homozygous l(3)82CDbC1644 and l(3)82CDcC931 embryos. The sequence revealed that the l(3)82CDbC1644 chromosome had a mutation in the first coding exon of 5-HT2Dro gene (Exon2), while the l(3)82CDcC931 issued from the same genetic screen had a wild-type sequence (Fig. 1B). The point mutation in l(3)82CDbC1644 changes the proline 52 into a serine in the N-terminus of the receptor (Fig. 1B,C).

Until now, the role of the N-terminus part of the GPCR that recognizes biogenic amine had not established. In mammals, the N-terminus domain of the 5-HT receptors is not directly involved in ligand binding. Therefore, it was intriguing that a mutation in this domain leads to homozygous lethal mutation. We investigated how this point mutation influenced the receptor function. We performed transient expression of the mutated 5-HT2Dro receptor in COS-1 cells and binding experiments on membrane preparations. This experiment showed that several of the ligands tested, including 5-HT, the endogenous physiological ligand, have an increased affinity for the mutant receptor compared with wild-type receptor. The Ki of 5-HT was 200 nM for the wild-type 5-HT2Dro receptor and only 11 nM for the mutant receptor, while expression was similar (Table 1). These data indicate that the mutation in the N-terminus domain of the 5-HT2Dro receptor confers to the receptor a gain of 5-HT affinity.

Table 1. 5-HT2Dro Pharmacological Propertiesa
Transfection5-HT2Dro cDNA5-HT2DroC1644 cDNA
  • a

    Affinity determined as competition of [125I]DOI is expressed as Ki ± SEM (nanomolar) for each compound for wild-type 5-HT2Dro or mutant 5-HT2DroC1644 receptor cDNA expressed transiently in COS-1 cells.

  • #

    Significant increase compared with wild-type;

  • *

    significant decrease compared with wild-type; P < 0.05, n = 9. After transfection of identical amounts of plasmid encoding cDNAs, the expression levels of wild-type and mutant receptors were not significantly different (similar Bmax). 5-HT, 5-hydroxytryptamine; 5-CT, carboxytryptamine.

Agonists  
 Dexfenfluramine17 ± 15.0 ± 0.3#
 5-HT200 ± 1611 ± 1#
 α-methyl 5-HT420 ± 23370 ± 18
 5-CT1700 ± 7228 000 ± 900*
 Tryptamin2040 ± 831950 ± 62
Antagonists  
 Ritanserin8.1 ± 1.17.0 ± 0.8
 Ketanserin40 ± 58.1 ± 0.7#
 Mesulergine78 ± 671 ± 5
 Bufotenine200 ± 121350 ± 45*
 Yohimbine310 ± 18340 ± 16

5-HT2DroC1644 Homozygous Embryos Display Specific Cuticular Alterations

The l(3)82CDbC1644 was EMS-induced on a Rucuca chromosome that presents several nonlethal mutations: ru h1th st cu sr esca. To analyze the phenotype induced by the mutation in the 5-HT2Dro receptor, we first generated a recombinant chromosome that was only mutated in the 5-HT2Dro gene. After recombination of both arms of the third chromosomes, we verified that the recombinant 5-HT2DroC1644 chromosome was still lethal against the original l(3)82CDbC1644 strain and Df(3R)HTRI. This recombined 5-HT2DroC1644 chromosome was then used for all subsequent experiments. We analyzed the timing of the lethality in 5-HT2DroC1644 mutant embryos.

To distinguish the phenotypes, we used a green fluorescent protein (GFP) -labeled balancer chromosome to follow the fate of each embryo. With this technique, we observed that approximately 20% of homozygous 5-HT2DroC1644 embryos hatched and died shortly during the first instar larvae (Table 2). The majority of the homozygous 5-HT2DroC1644 embryos died at the embryonic stages. We analyzed the cuticular phenotype of the embryos that never hatched in the 5-HT2DroC1644 strain (Fig. 2; Table 2). We verified that the homozygous balancer embryos displayed mainly wild-type cuticles (Table 2). The 5-HT2DroC1644 homozygous embryos presented either “double line” or “ghost” phenotypes (Fig. 2C,D, 2E,F; Table 2). Among the unhatched homozygous 5-HT2DroC1644 embryos, 43% present wild-type cuticle, 30% double-line and 22% ghost cuticles. The “double line” phenotype is characterized by the presence of two rows of denticles in each segment (Fig. 2E,F) and has been previously observed in homozygous Df(3R)HTRI embryos that lack the 5-HT2Dro receptor (Colas et al., 1999b). Moreover, we observed that the “ghost” phenotype with no denticle at the surface of the embryo was mainly represented in 5-HT2DroC1644 embryos (Fig. 2C,D; Table 2). This phenotype could be distinguished from the nonfertilized embryos as the cuticle had been secreted. Interestingly, the transheterozygous 5-HT2DroC1644/Df(3R)HTRI embryos hatched but led to small larvae that all died quickly with no obvious cuticular defects, showing a partial cuticular rescue. These data revealed that the 5-HT2DroC1644 mutation significantly affects cuticular development.

Table 2. Cuticular Phenotypic Classes of Nonhatched Embryos (%)a
 5-HT2DroC16445-HT2DroC1644/Df(3R)HTRIl(3)82CDcC931
  • a

    Cuticles were prepared as described in the Experimental Procedures section and observed with a brightfield microscope. The fly strains were maintained with the same TM3 balancer chromosome. The l(3)82CDcC931 embryos were used as control of the homozygous balancer phenotype because homozygous l(3)82CDcC931 are late larval lethal. Transheterozygous 5-HT2DroC1644/Df(3R)HTRI and homozygous l(3)82CDcC931embryos are hatching as weak first-instar larvae that are dying with apparent wild-type cuticle. Part (62.5% for 5-HT2DroC1644) and the near totality (5-HT2DroC1644/Df(3R)HTRI and l(3)82CDcC931) of the nonhatched embryos correspond to homozygous TM3 balancer chromosome on the same genetic background. The percentage of homozygous 5-HT2DroC1644 embryos that hatch and die as first-instar larvae is, thus, approximately 20%, and the percentage of unhatched homozygous 5-HT2DroC1644 embryos presenting wild-type, double-line, or ghost cuticular phenotypes is approximately 43, 30, and 22%, respectively. Using a green fluorescent protein-labeled balancer chromosomes, we confirmed that the “ghost” phenotype represented approximately one fourth of all 5-HT2DroC1644 homozygous embryos. Wild-type, “ghost,” and “double line” phenotypes are described in Figure 2. Values are presented as percentage of embryos with a cuticular phenotype in relation to those that hatch 72 hr after egg laying, and n corresponds to the total number of embryos counted.

n204208487
Wild-type799695
Ghost841
Double line1102
Others202
thumbnail image

Figure 2. Cuticular phenotype of 5-HT2DroC1644 mutant embryos. A,B: Cuticular phenotype of wild-type embryos. C,D: “Ghost” cuticular phenotype of 5-HT2DroC1644 embryos. “Ghost” embryos present no denticle but clear differentiated cuticle. E,F: “Double line” phenotype of 5-HT2DroC1644 embryos. Note that in each segment, there are only two rows of denticles. Scale bar = 80 μm in A,C,E, 20 μm in B,D,F.

Download figure to PowerPoint

5-HT2DroC1644 Embryos Display Altered Cell Speed Movements During GBE

A previous study showed that Df(3R)HTRI homozygous embryos presented defects in GBE (Colas et al., 1999b). We, thus, investigated the GBE in 5-HT2DroC1644 homozygous and heterozygous mutant embryos. Following the previously described method (Colas et al., 1999b), we video recorded the rapid phase of the GBE and followed the movements of ectodermal cells around the midline of single embryos. After recording, each embryo was PCR genotyped. The absence of the balancer chromosome marker was indicative of homozygous mutant chromosome. Using image analysis of the digital video recording, we assessed the speed of cell movements, near the ventral and dorsal midline of the embryo. This analysis was made by using a software developed to allow the “peeling off” of a single superficial layer of pixels from each recorded video image, then laying the layer flat after opening from the most rostral point. Accumulating these layers over time allowed the visualization and quantification of the speed and extent of individual cell movement at the surface of the embryo and the evaluation of the synchronization of these movements. Taking the initiation of extension movements as a reference time point, the speed and synchronization of the extension movements can be directly evaluated. Figure 3 displays representative results of these investigations on an individual genotyped embryo. As the X-axis represents the position of the cell along the embryo and the Y-axis the time scale, the slope of the curves represents their speed. We followed the migration of ectodermal cells ventral to the pole cells because they were easy to distinguish in each of the embryos (Fig. 3D). Of interest, we observed an initial contraction of the ventral ectoderm, reflecting the mesoderm invagination in wild-type embryos, before ectodermal cells start moving (Fig. 3A), which could not be detected in 5-HT2DroC1644 homozygous embryos (Fig. 3B). For cells close to the pole cells, the highest cell speed (V2) was recorded in 5-HT2DroC1644 homozygous embryos and was four times higher than in the wild-type embryos (V2 = 12.5 ± 1.8, n = 6 vs. 3.3 ± 0.5 μm/min, n = 6; Fig. 3E). Calculating the speed of similar cells in 5-HT2DroC1644/TM3 heterozygous embryos (V2 = 5.9±0.3 μm/min, n = 5) showed that it was only two times faster (Fig. 3E). The data show that 5-HT and 5-HT2Dro receptors are involved in cell speed regulation during the GBE. Moreover, the intermediary phenotype observed for the heterozygous 5-HT2DroC1644/TM3 embryos supports the notion that the mutation leads to a gain of function for the 5-HT2Dro receptor.

thumbnail image

Figure 3. Quantification of cell movements during germband extension (GBE) in wild-type, 5-HT2DroC1644, and Kr-Gal4, UAS-5-HT2Dro embryos. The gastrulation of embryos was video recorded, and image analysis allowed the direct visualization and quantification of ectodermal cell movements along their relative synchronization The X-axis is the flat projection of a pixel layer at the periphery of the embryos for each video frame, that is, at a determinate time. This process allows the visualization of the location of ectodermal cells present around the midline of the embryo before cell movements start (one pixel layer corresponds to one picture). As we recorded one picture every 15 seconds, we accumulated all flat projections along the Y-axis (thus, being the time scale). As a consequence, each line on the figures corresponds to the trajectory of one cell along the periphery of the embryos. We analyzed three to five ectodermal cells directly close to the pole cells (bold lines) to calculate the cell speed movements from the beginning of the GBE. One pixel corresponds to 0.2 μm on the X-axis and to 15 sec on the Y-axis (see Supplementary Material). A: On a representative wild-type (w1118) embryo, mesoderm invagination is first visualized by slight ventral ectoderm contraction before the ectodermal extension starts (time t = 0 min). Then, ventral ectodermal cells begin to move from the anterior to the posterior position. The cephalic furrow (cf) can easily be observed. Cells surrounding the pole cells (PC) correspond to the ventral (VE) and dorsal (DE) endoderm that will form the posterior midgut after invagination. B: In the video recording of a representative 5-HT2DroC1644 homozygous mutant embryo, ectodermal cells start their extension before contractions triggered by mesodermal invagination could be observed. C: A representative Kr-Gal4,UAS-5-HT2Dro embryo displays milder defects than homozygous 5-HT2DroC1644 embryos. The bold line starting initially close to the ventral endoderm (VE) corresponds to the cell tracing used to calculate speed presented in E. D: In an embryo that undergoes GBE, A, B, C, D, and E correspond to the position of the cell at the time of a change in its speed (Vi) during elongation. These points are noted on the X-axis of the graph on the right. E: In wild-type (w1118) embryos, at the beginning of GBE, cells move slowly and accelerate until pole cells invaginate and then cell speed decreases until posterior cells reach the dorsal cephalic furrow; V2 corresponds to the maximal speed of the cell. The asterisk corresponds to significantly different speeds from wild-type (P < 0.05). All embryos have been individually polymerase chain reaction genotyped after video recording using balancer chromosome markers. False colors correspond to different gray levels of the recorded images. See Supplementary Material for the corresponding video recordings.

Download figure to PowerPoint

Locally Overexpressing 5-HT2Dro Receptor Embryos Display Altered Cell Speed Movements During GBE

A transgenic strain that overexpresses a wild-type 5-HT2Dro receptor under the control of the Krüppel promoter has been previously produced (Kr-Gal4,UAS-5-HT2Dro; Colas et al., 1999b). This transgenic strain displays an overexpression of the wild-type 5-HT2Dro receptor in the central region of the embryos, where the endogenous receptor expression is low (Colas et al., 1999b). Cell speed calculation in Kr-Gal4,UAS-5-HT2Dro embryos during GBE showed that the maximal speed was similar to heterozygous 5-HT2DroC1644/TM3 embryos (V2 = 5.7 ± 0.7, n = 3 vs. 5.9 ± 0.3 μm/min, n = 5; Fig. 3C–E). These data reveal that defects of GBE in heterozygous 5-HT2DroC1644 mutant embryos can be phenocopied by 5-HT2Dro local overexpression.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Mutation in the N-terminal Domain of 5-HT2Dro Receptor Is a Gain of 5-HT Affinity

We identified a lethal mutation in a Drosophila strain characterized by a point mutation in the 5-HT2Dro receptor gene that changes proline 52 to serine in the N-terminal domain of the receptor, increasing 20-fold its affinity for 5-HT. The complete deletion of the N-terminal domain of the 5-HT2Dro receptor also led to a gain of 5-HT affinity (Colas et al., 1997). These data indicate that the N-terminal domain of the 5-HT2Dro receptor is involved in the binding of 5-HT. Classically, biogenic amines including 5-HT bind to amino acid side chains within the transmembrane domains of their receptors (Manivet et al., 2002). However, in Drosophila, most biogenic amine receptors have a long N-terminal domain (Onai et al., 1989; Saudou et al., 1990; Witz et al., 1990; Colas et al., 1995; Gotzes and Baumann, 1996). Few studies have been performed to understand the role of these long domains. Our study demonstrates for the first time a role for the long N-terminal domain of the serotonergic receptor 5-HT2Dro. Because this mutant receptor is more sensitive for its endogenous ligand 5-HT, 20-fold less 5-HT could be sufficient to reach signaling activity in the mutant receptor, comparable to that of the fully stimulated wild-type receptor.

Mutant 5-HT2Dro Receptor GBE Phenotype Can Be Phenocopied by Wild-Type 5-HT2Dro Receptor Ectopic Expression

5-HT2DroC1644 homozygous mutant embryos display an increase in GBE movements compared with wild-type. As previously shown, 5-HT is transiently synthesized in Drosophila embryos, with a peak of synthesis at 3 hr 15 min after fertilization (Colas et al., 1999a). Because the mutated 5-HT2Dro receptor found in the 5-HT2DroC1644 strain could be activated by 20-fold less 5-HT, it could, thus, reach a threshold of activity earlier than wild-type receptor, have stronger signaling, and/or its activity may last longer. The 5-HT2DroC1644 homozygous embryos seem to respond to an early signal inducing cell movements, because GBE starts before detectable mesodermal invagination. However, the precise measure of the time elapsed between fertilization and the onset of GBE is hardly accessible, thus, limiting the possibility to document this putative time shift.

A transgenic fly strain with a restricted ectopic expression of 5-HT2Dro cDNA under the Krüppel gene promoter (Kr-Gal4, UAS-5-HT2Dro) also generates gastrulation defects, supporting a role of 5-HT signaling in GBE (Colas et al., 1999b). This transgenic strain displays (1) an overexpression of the 5-HT2Dro receptor in the central region of the embryos, where the endogenous receptor expression is low with a local disruption of the receptor segmental expression and (2) a change in the timing of the 5-HT2Dro receptor expression as Krüppel is expressed before 5-HT2Dro. In Kr-Gal4, UAS-5-HT2Dro embryos, the first defects appear as abnormal anterior initiation of the extension movements before the posterior initiation of movements (Colas et al., 1999b). Cell movement studies during GBE show that cell speed defects of heterozygous 5-HT2DroC1644/TM3, and Kr-Gal4, UAS-5-HT2Dro embryos are similar. The cuticular phenotype of Kr-Gal4, UAS-5-HT2Dro embryos is weaker than 5-HT2DroC1644. Indeed, they display either wild-type or mild denticle alterations, like heterozygous 5-HT2DroC1644/ TM3 embryos. Moreover, the Kr-Gal4, UAS-5-HT2Dro strain is viable, indicating that the overexpression of the receptor mimics the phenotype of 5-HT2DroC1644/TM3 embryos. The phenotype of homozygous point mutant is, thus, stronger than the overexpression of the wild-type 5-HT2DroC1644. The difference between homozygous and heterozygous 5-HT2DroC1644 embryos and the similar phenotype of heterozygous 5-HT2DroC1644 and Kr-Gal4, UAS-5-HT2Dro strongly support the notion that the mutation in 5-HT2Dro confers a gain of function to the receptor with respect to GBE movements. In mutants depleted of 5-HT (synthesis mutant; Colas et al., 1999a) or of 5-HT2Dro receptor {Df(3R)HTRI} (Colas et al., 1999b), although altered, GBE movements still occur. The 5-HT and the 5-HT2Dro receptor seem, thus, to be involved in regulating the speed of the cell movements during the GBE process but apparently not the GBE or mesodermal invagination movements themselves.

GBE Defects in 5-HT2DroC1644 Could Be Due to Cell Adhesion Defects

The change in cell speed in the 5-HT2Dro receptor mutant most probably reflects alterations in ectodermal cell intercalation that was initially proposed to depend upon the difference of adhesion strength between neighboring cells (Irvine and Wieschaus, 1994). Cell intercalation of epithelial cells would be driven by simple remodeling of contacts in an ordered directional pattern, allowing progressive exchange of places with neighboring cells (Bertet et al., 2004; Zallen and Wieschaus, 2004). In this model, axis elongation in Drosophila occurs through stereotyped cell-shape changes across a uniform field (Bertet et al., 2004). However, multiple rounds are required for full elongation, and intercalating cells locally organize to generate multicellular structures (rosettes) that form and resolve in a directional manner. Directionality is disrupted in mutants that lack anteroposterior patterning and fail to elongate. Multicellular structures, and not individual cells or cell interfaces, represent, thus, the functional units of cell behavior during tissue elongation. The asymmetric distribution of cytoskeletal and junctional proteins has been proposed to contribute directly to polarized cell behavior during tissue elongation (Blankenship et al., 2006). F-actin enrichment at anteroposterior interfaces is the earliest evidence of planar polarity. Myosin II subsequently accumulates at these interfaces and may coordinate the contraction of linked edges to drive multicellular (rosette) formation. These transient structures resolve in a directional manner to create contact between cells that were previously separated along the dorso–ventral axis. DE-cadherin association is an early step in new contact formation and coincides with formation of a transient F-actin structure. Bazooka may be recruited later to new interfaces during their eventual stabilization (Blankenship et al., 2006).

We previously reported that the 5-HT2Dro receptor is expressed with a pair-rule–like pattern in ectodermal cells and that the apicobasal localization of Armadillo (β-catenin ortholog), in the ectodermal cells, that links cadherins with the cytoskeleton is altered in homozygous Df(3R)HTRI embryos (Colas et al., 1999b). Moreover, GBE defects are detected both in the 5-HT2DroC1644 gain of function strain and in the Df(3R)HTRI-deficient strain. The 5-HT by means of the 5-HT2Dro receptor appears, thus, to be able to influence the polarized adhesion signals controlling the GBE process. Because DE-cadherin and Armadillo/β-catenin are recruited to sites of new cell contacts before Bazooka association (Blankenship et al., 2006), the 5-HT–dependent DE-cadherin–based adhesion may, thus, regulate the stabilization/destabilization of polarized cell behavior during tissue elongation.

Putative Link Between GBE Defects and 5-HT2Dro Receptor

In embryos injected with Y-27632, a pharmacological inhibitor of Rho-kinase and specific regulator of Myosin-II, intercalation fails to occur (Bertet et al., 2004). Of interest, the 5-HT2Dro receptor is orthologous to mammalian 5-HT2A, B, C receptors, which are involved in smooth muscle cell contraction by means of a Rho-dependent regulation of myosin light chain kinase (Nishikawa et al., 2003). The 5-HT2Dro receptor may, thus, transduce extracellular signal (5-HT) to the cytoskeleton and regulate either the timing or intensity of cell intercalation, Rho/Rho kinase being a likely effector of the 5-HT2Dro receptor, although the precise transduction of this pathway remains to be determined in Drosophila.

Many 5-HT2DroC1644 homozygous embryos that did not hatch display a “ghost” phenotype that is nearly absent in other strains studied. The previously described “ghost” and “double line” cuticular phenotypes in Df(3R)HTRI (Colas et al., 1999b) have been proposed to result from variations in intensity of GBE defects, the “ghost” phenotype reflecting earlier and/or stronger defects. In both strains, alterations of differential adhesion between cell expressing, or not, the 5-HT2Dro receptor may explain the cuticular phenotypes. Of interest, by in situ hybridization, 5-HT2Dro probe showed no 5-HT2Dro mRNA misexpression in 5-HT2DroC1644 mutant embryos and by immunohistochemistry, we observed no defects in Fushi tarazu or Engrailed, expression in 5-HT2DroC1644 embryos at different developmental stages (data not shown). These observations support an indirect role of 5-HT2Dro in cuticular formation. It was noticed that cell speed appears more variable in 5-HT2DroC1644 homozygous embryos (higher SEM; Fig. 3D), suggesting higher variability in the control of GBE. Together, these observations support the notion that this gain of function mutation in the 5-HT2Dro receptor increases variability in the embryonic development and that 5-HT is likely involved in setting the time and/or speed of the GBE process by polarizing adhesion signals by means of the 5-HT2Dro receptor transduction.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Fly Stocks

The following strains have been used in this study. Point mutant lines: l(3)82CDbC1644 Stocks 0004830, l(3)82CDcC931 Stocks 0004831, l(3)82CDdC142 Stocks 0004832, l(3)82CDdC360 Stocks 0004833, l(3)82CDcl6 Stocks 0004839. Deficiency lines: Df(3R)HTRI, Df(3R)HTR6, Df(3R)110, Df(3R)6-7 (Colas et al., 1999b). Blue balancers: TM3 Sb Ser P[hb-lacZ] and TM3 Ser P[twi-lacZ]; Green balancers: TM3 Sb Ser P[hb-GFP].

To obtain 5-HT2DroC1644 strain, we used kar2ry506, ru,h1,th,st,cu,sr,es,Pr,ca (Ruprica), Ki,kar2ry506, D1,kar2ry506, and w1118 background chromosomes.

We performed the crossings as follows to obtain the 5-HT2DroC1644 strain:

(1) Recombination of the left arm of the third chromosome: l(3)82CDbC1644/ TM3 Ser and kar2ry506/kar2ry506 generated l(3)82CDbC1644/kar2ry506; l(3)82CDbC1644/kar2ry506 and Ruprica/TM6 Bri,Tb generated recombined l(3)82CDbC1644*/Ruprica; and recombined l(3)82CDbC1644*/Ruprica and Df(3R)HTRI/TM3 Ser, Sb generated l(3)82CDbC1644*/TM3 Ser, Sb.

(2) Preliminary crossing to prepare the second recombination: pr, pwn FLP38/CyO; Ki, kar2ry506 and kar2ry506/kar2ry506 generated +/CyO; Ki, kar2ry506/kar2ry506.

(3) Recombination of the right arm of the third chromosome: l(3)82CDbC1644*/ TM3 Ser, Sb X and +/CyO; Ki, kar2ry506/kar2ry506 generated l(3)82CDbC1644*/Ki, kar2ry506; l(3)82CDbC1644*/Ki, kar2ry506 and D, kar2ry506/TM3 Ser, Sb generated recombined l(3)82CDbC1644**/D, kar2ry506; l(3)82CDbC1644**/D, kar2ry506 and Df(3R)HTRI/TM3 Ser generated l(3)82CDbC1644**kar2ry506/TM3 Ser.

This stock was used in this study as 5-HT2DroC1644.

DNA Extraction, PCR, Sequencing

Unique embryos have been genotyped by PCR. After collection of the embryos (from 3 to 5 hr), DNA was extracted as described (Colas et al., 1999b) and 1/10 of the DNA from a single embryo was amplified using regular PCR amplification conditions for 38 cycles. To identify homozygous mutants, embryos were genotyped by PCR using oligonucleotides for Atonal (5′CGTTGGATCCAGCAACATAACACCACCATA3′ and 5′ATCGGGATCCGGGAATTCAGCGCAGCAATC3′) or twist-β-galactosidase (5′GCGTCAGTTGCGTTCCGTAAGTGC3′ and 5′CAGTTTGAGGGGACGACGACAGTA3′) genes.

To identify point mutations in homozygous embryos, each exon of the 5-HT2Dro receptor had been amplified by PCR using the following amplimers: exon 1, 5′GGAATTCCAAAACAAGTATTGTTGATGCTG3′ and 5′GGGGTACCTTATCTACTATATTTTACTTGC3′; exon 2, 3 and 4, 5′GGGGTACCAATTTTTTTTGAGATTCACATATA3′ and 5′GGGGTACCGCAGTAAGTCACCACCACGTAATT3′; exon 5, 5′GGTGGAAAATTATTCGAAAGT3′ and 5′GCGATTCACCACCAAAATAATTTA3′; and exon 6, 5′GGGGTACCCTTAACTTTTTGGTACTACTAATA3′ and 5′GGGGTACCTGGCACTGGATCCGCGTCTGGGCT3′.

Embryos, whose DNA was not amplified by twist β-galactosidase amplimers but by atonal (a marker of the third chromosome) primers, were considered as homozygous for a mutation on the third chromosome. Indeed, twist β-galactosidase is present on the balancer chromosome. This technique allowed the unambiguous genotyping of all individual embryos. PCR products of the 5-HT2Dro receptor were purified with the Geneclean kit and directly sequenced.

Binding Experiment

[125I]DOI was used as a radioligand to investigate the pharmacological properties of membrane fractions from 5-HT2DroR transiently transfected COS-1 cells (Colas et al., 1995). Briefly, cell membranes were prepared by four cycles of homogenization (Brinkman P10 disrupter) and centrifugation (48,000 × g for 15 min). The assay was established to achieve steady state conditions and to optimize specific binding (Kellermann et al., 1996). Fifty micrograms of membrane proteins were incubated with 5 nM [125I]DOI at 4°C for 60 min. The incubation medium (200 μl) contained 50 μl of radioligand, 50 μl of buffer or of competing drug, and 100 μl of membrane suspension (protein concentration, 50 μg/ml). The mixture was incubated at 30°C for 30 min. Assays were terminated by vacuum filtration through glass fiber filters (GF/B), which had been pretreated with 0.1% polyethyleneimine, followed by four washes of 5 ml of ice-cold buffer. Filters were dried rapidly, and their radioactivity was determined by liquid scintillation counting. Nonspecific binding, determined in the presence of 10 μM unlabeled DOI, represented approximately 30% of total binding. Competition studies for [125I]DOI binding were performed by adding increasing concentrations of test drug to the reaction. Data were analyzed using GraphPad software. Pharmacological profiles of transiently expressed receptors were determined over three independent experiments performed in triplicate.

Cuticle Preparation

Embryos were laid on an agar plate and observed at 25°C, 60% humidity. The percentage of hatching larvae was evaluated after 24, 48, and 72 hr (25°C) after egg laying and expressed as the percentage of nonhatched embryos in relation to the total number embryos and larvae. After 72 hr, the number of nonhatched embryos was counted. Approximately 25% of l(3)82CDcC931 embryos (larval lethal on the same chromosome), 25% of 5-HT2DroC1644/Df(3R)HTRI, and 40% of 5-HT2DroC1644 embryos died before hatching. Cuticles from nonhatched embryos were prepared as described by Colas et al. (1999b). Percentages in Table 2 correspond to the proportion of a phenotypic class in relation to the total number of nonhatched embryos.

Time-Lapse Video Experiment

Flies laid on apple juice agar for 1 hr, aged for 2 hr, then overlaid with halocarbon 3S oil (Prolabo Voltalef) were staged according to Campos-Ortega and Hartenstein (1985). The development of randomly selected single embryos was video recorded for 1 hr (one picture every 15 sec, i.e., 241 pictures/hr) using a Leica MZ12 binocular and digital Sony camera under transmitted light. A surrounding superficial pixel layer of each picture of the video-recorded embryos was selected and, after opening at the most rostral point and flattening, accumulated over time (for the detailed procedure, see Supplementary Material, which can be viewed at http://www.interscience.wiley.com/jpages/1058-8388/suppmat). This strategy allows a direct visualization of the movements of individual cells initially located around the midline, the quantification of their speed during gastrulation movements, and their relative synchronization (speed = slope of the curve). We followed a set of ventral ectodermal cells close to the invaginating endoderm because they can be easily distinguish on each figures. We illustrated the different speed of individual cells (V1 to V4) as changes in the slope of the curve. The main inflexion point of the curve, the most reliably identifiable point, corresponds to V2. Each embryo was individually PCR-genotyped after video recording using balancer chromosomes as markers (Colas et al., 1999b). False colors correspond to different gray levels of the recorded images. Statistical significance was assessed by analysis of variance and Neuman–Keul's post hoc test.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We are indebted to the Drosophila stocks centers of Bloomington, Szeged, Exelixis, and Umea, Drs. A. Spradling, J. O'Donnell, J. Roote, S. DiNardo, P. Heitzler, and G. Reuter for providing fly strains. We acknowledge M. Nullans for fly cares and D. Hentsch for help with video recordings and image analysis. We thank Drs. V. Setola and P. Heitzler for critical reading of the manuscript, and for helpful discussions. B.S. received a Region Alsace fellowship.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information
  • Bertet C, Sulak L, Lecuit T. 2004. Myosin-dependent junction remodelling controls planar cell intercalation and axis elongation. Nature 429: 667671.
  • Blankenship JT, Backovic ST, Sanny JS, Weitz O, Zallen JA. 2006. Multicellular rosette formation links planar cell polarity to tissue morphogenesis. Dev Cell 11: 459470.
  • Campos-Ortega JA, Hartenstein V. 1985. The embryonic development of Drosophila melanogaster. Berlin: Springer-Verlag.
  • Colas JF, Launay JM, Kellermann O, Rosay P, Maroteaux L. 1995. Drosophila 5-HT2 serotonin receptor: coexpression with fushi-tarazu during segmentation. Proc Natl Acad Sci U S A 92: 54415445.
  • Colas JF, Choi DS, Launay JM, Maroteaux L. 1997. Evolutionary conservation of the 5-HT2B receptors. Ann N Y Acad Sci 812: 148150.
  • Colas JF, Launay J-M, Maroteaux L. 1999a. Maternal and zygotic control of serotonin biosynthesis are both necessary for Drosophila germband extension. Mech Dev 87: 6776.
  • Colas JF, Launay J-M, Vonesch J-L, Hickel P, Maroteaux L. 1999b. Serotonin synchronises convergent extension of ectoderm with morphogenetic gastrulation movements in Drosophila. Mech Dev 87: 7791.
  • Gotzes F, Baumann A. 1996. Functional properties of Drosophila dopamine D1-receptors are not altered by the size of the N-terminus. Biochem Biophys Res Commun 222: 121126.
  • Greaves S, Sanson B, White P, Vincent JP. 1999. A screen for identifying genes interacting with armadillo, the Drosophila homolog of beta-catenin. Genetics 153: 17531766.
  • Irvine K, Wieschaus E. 1994. Cell intercalation during Drosophila germband extension and its regulation by pair-rule segmentation genes. Development 120: 827841.
  • Kellermann O, Loric S, Maroteaux L, Launay J-M. 1996. Sequential onset of three 5-HT receptors during the 5-hydroxytryptaminergic differentiation of the murine 1C11 cell line. Br J Pharmacol 118: 11611170.
  • Manivet P, Schneider B, Smith JC, Choi DS, Maroteaux L, Kellermann O, Launay JM. 2002. The serotonin binding site of human and murine 5-HT2B receptors: molecular modeling and site-directed mutagenesis. J Biol Chem 277: 1717017178.
  • Nishikawa Y, Doi M, Koji T, Watanabe M, Kimura S, Kawasaki S, Ogawa A, Sasaki K. 2003. The role of rho and rho-dependent kinase in serotonin-induced contraction observed in bovine middle cerebral artery. Tohoku J Exp Med 201: 239249.
  • Oda H, Tsukita S, Takeichi M. 1998. Dynamic behavior of the cadherin-based cell-cell adhesion system during Drosophila gastrulation. Dev Biol 203: 435450.
  • Onai T, Fitzgerald MG, Arakawa S, Gocayne JD, Urquhart DA, Hall LM, Fraser CM, McCobbie WR, Venter JC. 1989. Cloning, sequence analysis and chromosome localization of a Drosophila muscarinic acetylcholine receptor. FEBS Lett 255: 219225.
  • Pankratz MJ, Jäckle H. 1993. Blastoderm segmentation. In: BateM, Martinez-AriasA, editors. The development of Drosophila melanogaster. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. p 467516.
  • Park SK, George R, Cai Y, Chang HY, Krantz DE, Friggi-Grelin F, Birman S, Hirsh J. 2006. Cell-type-specific limitation on in vivo serotonin storage following ectopic expression of the Drosophila serotonin transporter, dSERT. J Neurobiol 66: 452462.
  • Saudou F, Amlaiky N, Plassat J-L, Borrelli E, Hen R. 1990. Cloning and characterisation of a Drosophila tyramine receptor. EMBO J 9: 36113617.
  • Saudou F, Boschert U, Amlaiky N, Plassat JL, Hen R. 1992. A Family of Drosophila serotonin receptors with distinct intracellular signalling properties and expression patterns. EMBO J 11: 717.
  • Schoenwolf GC, Alvarez IS. 1989. Roles of neuroepithelial cell rearrangement and division in shaping of the avian neural plate. Development 106: 427439.
  • Tepass U, Gruszynski-DeFeo E, Haag TA, Omatyar L, Torok T, Hartenstein V. 1996. shotgun encodes Drosophila E-cadherin and is preferentially required during cell rearrangement in the neurectoderm and other morphogenetically active epithelia. Genes Dev 10: 672685.
  • Witz P, Amlaiky N, Plassat J-L, Maroteaux L, Borrelli E, Hen R. 1990. Cloning and characterization of a Drosophila serotonin receptor that activates adenylate cyclase. Proc Natl Acad Sci U S A 87: 89408944.
  • Wright TR. 1987. The genetics of biogenic amine metabolism, sclerotization, and melanization in Drosophila melanogaster. Adv Genet 24: 127222.
  • Zallen JA, Wieschaus E. 2004. Patterned gene expression directs bipolar planar polarity in Drosophila. Dev Cell 6: 343355.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The Supplementary Material referred to in this article can be found at http://www.interscience.wiley.com/jpages/1058-8388/suppmat

FilenameFormatSizeDescription
jws-dvdy.21110.vid1.mpg849KSupporting Information file jws-dvdy.21110.vid1.mpg
jws-dvdy.21110.vid2.mpg1526KSupporting Information file jws-dvdy.21110.vid2.mpg
jws-dvdy.21110.fig3.tif3817KSupporting Information file jws-dvdy.21110.fig3.tif

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.