SEARCH

SEARCH BY CITATION

Keywords:

  • neural development;
  • eyes absent;
  • Xeya3;
  • retina;
  • placode;
  • Xenopus laevis

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The transcriptional coactivater and tyrosine phosphatase eyes absent (eya) is vital for eye development in Drosophila. We identified a vertebrate member of the Eya family, Xeya3, which is expressed in the anterior neural plate, including the eye field. Overexpression of wild-type Xeya3 or of a phosphatase-negative version of Xeya3 creates massive enlargements of brain and retinal tissues, mainly caused by overproliferation of neural precursor cells. On the other hand, suppression of Xeya3 function induces local apoptosis within the sensorial layer of the anterior neuroectoderm. Thus, Xeya3 is key factor for the formation and size control of brain and eyes in vertebrates. Developmental Dynamics 236:1526–1534, 2007. © 2007 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The eyes absent gene (eya) has been identified in Drosophila, where it functions genetically downstream of eyeless/Pax6 within the hierarchy of eye specification genes (Bonini et al.,1993; Pignoni et al.,1997; Halder et al.,1998). In fact, eya can synergize with dachshund (dac) and sine oculis (so) for the induction of ectopic eyes in Drosophila (Bonini et al.,1997; Chen et al.,1997). Eya mutations led to an elevated rate of apoptosis in the pool of ommatidial precursor cells, which resulted in a suppression of compound eye development (Bonini et al.,1993,1998; Leiserson et al.,1998). In vertebrates, four Eya homologs have been cloned (Duncan et al.,1997; Tomarev,1997; Zimmerman et al.,1997; Borsani et al.,1999; Fee et al.,2002). Eya1/2 expression in lens and nasal placodes depend on proper Pax6 activity (Xu et al.,1997). Haploinsufficiency for Eya1 in humans is causal for branchio-oto-renal (BOR) syndrome (Buller et al.,2001). As in Drosophila, the resulting phenotypes are due to increased apoptosis of precursor cells (Xu et al.,1999). Although the BOR syndrome is not primarily characterized by eye defects, a couple of human Eya1 mutations result in defects of the anterior chamber and cataract formation (Azuma et al.,2000). Eya3/4 are expressed in the head mesenchyme, and elevated levels of transcripts were found in anterior brain regions but were excluded from cranial placodes. Mutations in Eya4 have been reported as the causative gene of hearing impairment in humans and causes dilated cardiomyopathy in zebrafish (Wayne et al.,2001; Schonberger et al.,2005). The overall structure of EYA proteins is highly conserved. At the N-terminus they contain a transactivation domain, but appear not to bind to DNA directly. Instead, EYA proteins can physically interact by means of the so-called Eya domain at the C-terminus with dac and so and are thereby considered to regulate transcription of target genes in the context of a multimeric complex (Heanue et al.,1999; Ikeda et al.,2002; Silver et al.,2003; Ozaki et al.,2004). Recently, it has been demonstrated that Eya proteins translocate from the cytoplasm to the nucleus upon phosphorylation of a conserved PXS/TP motif by MAPK (Ohto et al.,1999; Hsiao et al.,2001) and harbor a phosphatase activity (Li et al.,2003; Rayapureddi et al.,2003; Tootle et al.,2003).

Although EYA-type proteins are expressed during vertebrate eye development, no function has been addressed so far in this respect. Therefore, we intended to gain further information regarding the roles of EYA-type proteins during formation of the visual system in Xenopus embryos. We identified three Eya (Xeya1, -2, and -3) homologous cDNAs in Xenopus, of which we found only Xeya3 to be expressed in the anterior neural plate, including the developing eye. In loss- and gain-of-function experiments, we identified Xeya3 as a key factor for the maintenance and proliferation of anterior neural precursor cells.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Temporal and Spatial Expression of Xenopus Eya3

To understand the function of EYA-type proteins in early vertebrate eye development, we cloned the homologues for Xeya1, -2, and -3 from Xenopus laevis (Supplementary Figure S1, which can be viewed at http://www.interscience.wiley.com/jpages/1058-8388/suppmat). Because only Xeya3 showed a distinct expression during the early formation of the neural system, we concentrated on the analysis of the spatial and temporal expression of Xeya3 by whole-mount in situ hybridization in more detail (Fig. 1). Xeya3 is maternally expressed and transcripts become localized to the animal hemisphere during oogenesis in stage V oocytes (Fig. 1A). This pattern persists during cleavage stages with only animal blastocysts containing detectable signals of Xeya3 (Fig. 1B). With the onset of neurulation, Xeya3 is expressed in the anterior neural plate and in cells of the prospective embryonic brain (Fig. 1C). At the end of neurulation, cells of the lens placode and premigratory neural crest cells, the latter overlying presumptive brain tissue, now additionally express Xeya3 (Fig. 1D). In tailbud stage embryos, Xeya3 expression is maintained in the otic and eye vesicles, in migrating neural crest cells and in the prospective mid- and hindbrain region (Fig. 1E,F). Within the prospective brain, Xeya3 expression is exclusive to dorsal regions (Fig. 1F). In contrast, transcripts of Xeya3 are almost absent in neural tissues of advanced tadpole stages. However, derivates of the neural crest in the area of the branchial arches as well as primary lens fiber cells still express high levels of Xeya3 (Fig. 1G,G′). Taken together, maternal and zygotic Xeya3 transcripts are mainly found in cells of the neural lineage and neural crest, suggesting a role for Xeya3 in the earliest stages of neural development.

thumbnail image

Figure 1. Xeya3 is expressed in the anterior neural plate during Xenopus development. Whole-mount in situ hybridization of Xenopus oocytes and embryos. A: Stages I–V of oogenesis. Xeya3 transcripts become localized to the animal hemisphere in stage V oocytes. B: Lateral view. In blastula stages, Xeya3 transcripts are enriched in the animal pole. C: Anterior view. During neurulation, Xeya3 expression in the anterior neural plate includes the eye field (black arrowhead). D: Anterior view. At the end of neurulation, strong Xeya3 expression is found in the eye vesicles (black arrowhead) as well as cells of the lens placodes (red arrowhead). E–G: Lateral view, anterior to the right and (E′) horizontal (F,G′) transversal sections. E,G: In tadpole stage embryos, cranial neural crest cells (black arrowheads in E,E′) migrate toward the branchial arches (black arrowheads in G). Xeya3 is expressed in the eye vesicles/cups in early but not late tadpole embryos (white arrowheads in E–G) and in the otic vesicle (white star in E). Within the mid- and hindbrain, Xeya3 transcripts are localized dorsally (black arrowhead in F). G–G′: Strong Xeya3 expression resides in primary lens fibers (red arrowhead in G) and in the branchial arches (black arrowheads in G). ap, animal pole; ba, branchial arches; fbv, forebrain ventricle; le, lens; eyf, eye field; eyv, eye vesicle; lp, lens placode; mnc, migrating neural crest; nr, neural retina; plf, primary lens fibers; st, embryonic stage; vp, vegetal pole. Staging according to Nieuwkoop & Faber (1967).

Download figure to PowerPoint

Suppression of Xeya3 Function Inhibits Brain Formation

To address the function of Xeya3 during embryogenesis, we microinjected a morpholino oligonucleotide that specifically blocks translation of the endogenous Xeya3 mRNA. Upon injection of 0.4 pmol of the Xeya3 morpholino into one cell of a two-cell stage embryo, we observed a severe loss of anterior neural tissue in tadpole stage embryos, which led to phenotypes ranging from a complete absence of brain and retinal tissue (Fig. 2A,A′) to embryos with a milder phenotype, allowing the analysis of effects of eya3 on the expression of neural genes (Fig. 2B–G). A transversal section through the head region of a morpholino-injected embryo revealed the strong hypoplasia of neural tissue and only rudiments of retinal pigment epithelium resided within the eye-forming region (Fig. 2A′). These observations were further analyzed by the expression of Xn-tubulin, a marker for differentiated neurons, which is severely reduced in remaining brain and retinal tissue in an embryo with a less pronounced penetration of the phenotype upon injection of the Xeya3-morpholino (Fig. 2C). Importantly, we noticed that phenotypic effects were restricted to derivatives of the anterior neural plate, reflecting endogenous Xeya3 expression. Thus, the suppression of Xeya3 function leads to a severe hypoplasia of anterior neural tissue in early tadpole stage embryos.

thumbnail image

Figure 2. Xeya3 function is necessary for maintaining the integrity of the anterior neural plate. A–G″: Xeya3 morpholino-injected embryos. C–G: LacZ RNA was co-injected as a lineage tracer (light blue). A,B: Dorsal view, anterior to the top. Suppression of Xeya3 function leads to a dramatic loss of anterior neural tissue in tadpole stages (A) or in less severe phenotypes to a reduction in brain and retinal structures (B). A′: Transversal section of A. Note the hypoplastic brain and absence of retinal structures on the injected side. C: Transversal section. A tail bud stage embryo with a less strong penetration of the morpholino-induced phenotype is shown, pointing to reduction of Xn-tubulin expression. Both the eye and brain show a strong reduction of Xn-tubulin expression (black arrowheads). D–F: Anterior view, midline indicated by a dashed line. Xotx2, Xsox3, and Xrx1 in situ analysis reveals a strong reduction of anterior neural markers in the area of blocked Xeya3 translation; Xotx2 expression is not reduced in the non-neural cement gland anlage (black arrowhead in D). G: Anterior view, terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling (TUNEL) assay in early neurula stage embryos. G′,G″: A massive increase of apoptotic cells is detected exclusively in the sensorial layer of anterior neural ectoderm. However, this increase occurs neither in the epithelial layer nor in the underlying endoderm. H–K: Anterior view, Xotx2, Xsox3, and Xrx1 in situ analysis and TUNEL analysis. Coexpression of Xeya3 morpholino and Xeya3-wob mRNA rescues the suppression phenotype. L–O: Anterior view, Xotx2, Xsox3, and Xrx1 in situ analysis and TUNEL analysis. Injection of a standard morpholino reveals no phenotype. P: The Xeya3 morpholino targets the regular Xeya3 RNA, but not that of a rescue construct, of which seven bases of the morpholino binding site had been exchanged. Q: The injection of Xeya3 morpholino is partially rescued by co-injecting Xeya3-wob RNA. el, epithelial layer; en, endoderm; is, injected side; le, lens; rpe, retinal pigment epithelium; sl, sensorial layer; ve, brain ventricle.

Download figure to PowerPoint

To further characterize the effect of Xeya3 suppression during early neurulation, we analyzed the expression of a panel of anterior neural plate markers. All genes analyzed showed a marked decrease in their level of expression in anterior regions of the neural plate upon injection of the Xeya3 morpholino (Xotx2, in 76% of analyzed embryos, n = 19/25; Xsox3, 80%, n = 24/30; Xrx1, 40%, n = 12/30; Fig. 2D–F), suggesting that Xeya3 is needed for the maintenance of anterior neural cells within the sensorial layer. Of interest, Xeya3 function is not essential for non-neural anterior structures, because Xotx2 was still expressed within the cement gland anlage, which derives from the epithelial layer (Fig. 2D). To determine whether apoptosis could account for the loss of neural progenitor cells, we examined the occurrence of apoptotic cells in early neurula stage embryos after injection of the Xeya3 morpholino. We observed significant more apoptotic cells on the injected side located in the anterior neural plate (in 66% of analyzed embryos, n = 19/29; Fig. 2G–G″). Transversal sections further illustrated that apoptotic cells were restricted to the sensorial layer of the neural ectoderm (Fig. 2G′–G″), but were neither found in the overlaying epithelial layer nor in the underlying endoderm. This finding correlates well with reports from mammals and flies because increased apoptosis of specific progenitor cells caused the loss of ears and kidneys in Eya1−/− mice and zebrafish (Xu et al.,1999; Kozlowski et al.,2005), or of ommatidia upon a mutation in the eya-locus of Drosophila (Bonini et al.,1993). To verify the specificity of the Xeya3 morpholino, we tested its ability to inhibit translation of Xeya3 mRNA in an in vitro translation system. The presence of the Xeya3 morpholino completely suppressed the synthesis of Xeya3 protein from synthetic Xeya3 mRNA (Fig. 2P). Moreover, we were able to rescue the Xeya3 morpholino-induced phenotype, by co-injecting synthetic Xeya3-wob mRNA, which is not bound and, therefore, not inhibited by the morpholino, and translated into the appropriate protein (Fig. 2H–K,P,Q). The injection of a standard morpholino showed no phenotype (Fig. 2L–O). Thus, Xeya3 function is essential for maintaining anterior neural progenitor cells in early development.

Overexpression of Xeya3 Expands the Anterior Neural Plate

On the other hand, the microinjection of synthetic Xeya3 RNA resulted in an expansion of the anterior neural plate, as revealed by the analysis of molecular markers for anterior neural plate formation (Xotx2, in 40% of analyzed embryos, n = 12/30; Xsox3, 50%, n = 10/20; Xrx1, 50%, n = 15/30; Pax6, 64%, n = 16/25; Fig. 3A,C and data not shown). Nevertheless, the basic pattern of the anterior neural plate was maintained because the enlarged Xrx1 expression domain was still surrounded by Xotx2-positive cells as described (Andreazzoli et al.,1999; 67%, n = 10/15; Fig. 3A). However, Xk81, a marker for epidermis, was repressed in the vicinity of the enlarged anterior neural plate, suggesting a profound influence of additional Xeya3 on placodal identity (84%, n = 21/25; Fig. 3B). Moreover, the expression of Xdlx3, a marker for the transition zone of neural toward non-neural ectoderm (54%, n = 16/30; Fig. 3C) and the induction of neural crest as monitored by Xtwist, was suppressed by Xeya3 RNA injection (100%, n = 15/15; Fig. 3D). Control embryos with injection of a similar amount of β-galactosidase from the same vector showed no phenotype (Fig. 3E,J). Although Xeya3 overexpression modified the identity of the placodal territory, our data indicate that the anterior neural plate is not enlarged at the expense of non-neural tissue. Therefore, we tested whether Xeya3 overexpression effects cell proliferation. We applied the mitotic inhibitor hydroxyurea/aphidicolin (HUA; Harris and Hartenstein,1991) to block cell proliferation. In fact, broadening of the neural plate was suppressed in Xeya3-injected and HUA-treated embryos (Fig. 3H,I). Furthermore, upon injection of Xeya3 mRNA, we observed a strong increase of mitotic cells within the anterior neural plate of early neurula stage embryos (53% of embryos, n = 16/30; Figs. 3F, 4F), whereas apoptosis as revealed by terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling (TUNEL) staining was not increased (Fig. 3G, compare also with Fig. 2G). However, Xeya3 was not sufficient to induce neural differentiation in pluripotent animal cap explants (data not shown). Thus, the expansion of the neural plate upon overexpression of Xeya3 seems to be primarily caused by the survival of precursor cells and/or the maintenance of the precursors in a mitotic state. Because at this stage of normal development the number of apoptotic cells is low (Figs. 2G, 3I), the latter interpretation appears to be more likely.

thumbnail image

Figure 3. Overexpression of Xeya3 expands the anterior neural plate. A–D,F–I:Xeya3 RNA injected embryos (800 pg of Xeya3 mRNA into one cell of two-cell stage embryo). LacZ RNA (100 pg) was co-injected as a lineage tracer (light blue). A–D: Anterior view. Injected side to the right. A,B: Double in situ analysis of Xotx2 (magenta) together with Xrx1 (red) and of Xk81 (magenta) together with Xsox3 (red), respectively. H: Expansion of Xotx2, Xrx1, and Xsox3 expression domains in response to Xeya3 RNA injection (the green dashed line indicates the noninjected area, the red dashed line indicates the side). C,D: Xdlx3 (C, arrowhead) and Xtwist expression (D, arrowhead) is suppressed. H,I: Treatment of embryos with mitotic inhibitors (hydroxyurea/aphidicolin, HUA) blocked the expansion of Xsox3. E,J: Anterior view. Expression of a similar amount of β-galactosidase alone shows no phenotype.

Download figure to PowerPoint

thumbnail image

Figure 4. A–F: Overexpression of Xeya3 expands anterior brain and retinal structures by induction of neural precursor cell overproliferation embryos (800 pg of Xeya3 mRNA into one-cell of two-cell stage embryo). A: Xn-tubulin analysis revealed a suppression of cranial nerve formation (arrowhead, inset shows the noninjected side) and in A′ a mirror image of the neural tube within the Xeya3 injected side, similar to J–,K′ as monitored by XmyT1 and Xpax3 expression (white arrowheads in A′,B′,C′). The midline of the neural tube is indicated by a red line. D,E: Anterior view. D′: Transversal section of the embryo shown in D. Enlarged eyes in early tadpole stages as shown by in situ analysis of Xrx1 and Xoptx2. F: Analysis of phosphorylated histone H3 revealed a strong increase in dividing cells upon Xeya3 RNA injection.

Download figure to PowerPoint

Formation of Enlarged Brain Structures Upon Xeya3 Overexpression

At tail bud stage, the microinjection of synthetic Xeya3 mRNA led to the formation of dramatically enlarged brain structures and eyes as reveal by whole-mount in situ hybridizations of the respective marker genes (Xrx1, in 80% of analyzed embryos, n = 12/15; Xoptx2, 53%, n = 8/15; Fig. 4D,E, and Supplementary Figure S2). Often the enlargement of the eye is characterized by additional folding of the retinal cell layer, similar to what has been reported for overexpression of Xrx1 (Mathers et al.,1997). To investigate whether Xeya3 affects neural determination, we examined markers for the progress of secondary neuronal differentiation (Fig. 4A–C′). Cells positive for the neural differentiation marker Xn-tubulin were found in the center of the expanded brain area (100%, n = 15/15; Fig. 4A,A′). Expression of the neural determination marker XmyT1 appeared almost mirrored, because a second stripe of elevated XmyT1 expression was located distally in the enlarged brain, adjacent to the expanded Xn-tubulin expression domain (Fig. 4B,B′). In addition, an ectopic Xpax3 domain was found laterally, but in an almost normal dorsoventral position (47%, n = 8/17; Fig. 4C,C′), like the expression of Shh in the floor plate, which was neither duplicated nor shifted upon injection of Xeya3 (74%, n = 14/19; data not shown). Our data suggest the formation of a new territory of secondary neurogenesis. It shows some aspects of a reversed image of the ventricular zone with respect to the expression of neural marker genes, although major histological features, for example, a ventricular lumen, an epithelium lining a ventricular lumen, or an ependymal layer are missing (Fig. 4A′–C′). Because a regular ventricular zone of the neural tube contains dividing neural precursors, we checked Xeya3 mRNA-injected tail bud stages for mitotically active cells in enlarged brains. In fact, we detected additional pH3-positive cells (Figs. 3H, 4F). Taken together, the loss and gain of function data presented here show that Xeya3 can be characterized as a factor necessary for the survival and proliferation of anterior neural precursors, which as a consequence might help to regulate the size of the respective organs.

Phosphatase-Dead Mutant Forms of Xeya3 Process Enhanced Neural Inducing Activity

It has been reported recently that members of the Eyes absent protein family exhibit a serine-/thyrosine-phosphatase activity (Li et al.,2003; Rayapureddi et al.,2003; Tootle et al.,2003). The phosphatase domain is characterized by two conserved motives (WDLDETI and IGDGRDEE) within the highly conserved Eya domain at the C-terminus (Fig. 5D, and Supplementary Figure S1). In cell culture experiments, it was shown that the phosphatase activity of murine Eya3 is required to positively regulate proliferation of muscle precursor cells (Li et al.,2003). Consistent with these findings, mutations within the phosphatase domain strongly reduced the activity of Eya from Drosophila in rescue and gain-of-function experiments (Tootle et al.,2003).

thumbnail image

Figure 5. Increased ability to induce neural hyperplasia by Xeya3 phosphatase-negative mutants. A–C: Lateral views and transversal sections (A1, B1, C1–C2) through the eye of the injected side. LacZ RNA was co-injected as a lineage tracer (light blue). The 400 pg of Xeya3-m1 RNA (as well as Xeya3-m2 and Xeya3-m3, not shown) caused severe retinal overgrowths (B,B1,C′–C2″), whereas nonmutant Xeya3 only caused a mild increase in eye size at the same concentration (A,A1). Note the invagination of retinal tissue and the formation of two lenses in B1. D: Schematic representation of the mutations introduced in Xeya3. E: Statistical significance of RNA injections of phosphatase mutant forms compared with wild-type. le, lens; nr, neural retina.

Download figure to PowerPoint

To investigate how similar mutations alter the activity of Xeya3, we examined phosphatase-deficient mutants of Xeya3 in overexpression experiments (Fig. 5). Surprisingly, we found that the microinjection of 400 pg of synthetic mRNA of the corresponding Xeya3 phosphatase-deficient mutants (Xeya3-m1, Xeya3-m2, Xeya3-m3) led to a strongly enhanced appearance of neural hyperplasia (Fig. 5B,C), when compared with tadpoles injected with the same amount of nonmutant Xeya3 mRNA (Fig. 5A). While by the injection of 400 pg of nonmutant Xeya3 mRNA only moderate enlargements of the eyes were observed (Fig. 5A), the overexpression of the phosphatase-mutant forms led to massive folding of the retina, which in rare cases are even accompanied by the generation of two separate lenses (Fig. 5B). Microinjections of higher amounts (800 pg) of the respective synthetic Xeya3 mRNAs led to a higher occurrence of the described neural phenotype in general, still the phosphatase-mutant forms appear to be more potent than the nonmutant form in this respect (Fig. 5E).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Our experiments identify XEYA3 as a pivotal factor for the maintenance and proliferation of anterior neuroectodermal cells in Xenopus. The microinjection of synthetic messenger RNA encoding XEYA3 protein resulted in an enormous nevertheless spatially restricted enlargement of anterior neural structures. On the other hand, suppression of Xeya3 function by means of antisense morpholinos led to an activation of the apoptotic program again limited to cells of the anterior neural plate, which resulted in the loss of forebrain and eye. We conclude, that XEYA3 not only maintains anterior neural precursor cells, but also acts to control the number of neural precursor cells, thereby regulating the size of forebrain and retina.

Conserved Embryonic Expression of Eya3 in Mouse and Xenopus

So far, temporal and spatial expression of Eya3 during vertebrate embryogenesis has been only reported for the corresponding mouse gene (Xu et al.,1997; Zimmerman et al.,1997). At mouse embryonic stage 8.5–10.5, Eya3 expression was detected within head mesenchyme, branchial arch, and neural tissue, which correspond to similar areas of Xeya3 expression. Furthermore, mEya3 transcripts were excluded from cranial placodes, but were later found in the lens, again similar to the expression profile of Xeya3. The comparison of mammalian and amphibian EYA3 protein sequences revealed a strong conservation of the functional units of the protein, the N-terminal transactivation domain and the C-terminal phosphatase domain, which are linked by a short more diverged region. In addition, the chromosomal location for the murine Eya3 corresponds to a syntenic region of the human genome (Xu et al.,1997; Zimmerman et al.,1997). Taken together, Eya3 gene expression and function are most likely highly conserved between vertebrates.

Potential Protein Interaction Partners of Eya3

The determination of the retinal fate in Drosophila is controlled by a network of genes, including eyeless and twin-of-eyeless (ey, toy), sine oculis (so), dachshund (dac), and eyes absent (eya), which are conserved but have diverged in vertebrates. All members of the retinal determination gene network can induce ectopic eye formation in Drosophila on their own, but can synergize in this respect. Although vertebrate Eya1-3 can rescue the eya mutation in Drosophila, their activities in vivo depend on interaction partners that are present at a given time point. In vertebrates, it has been demonstrated that EYA1/2 and SIX1 interact physically and are expressed in sensorial placodes as well as in the developing kidney. Consistently, mutations in either Eya1 or Six1 underlie the branchio-oto-renal (BOR) syndrome, which is characterized by anomalies of face, ear, and kidneys (Abdelhak et al.,1997; Ruf et al.,2004; Kozlowski et al.,2005). Furthermore, EYA2 cooperates with SIX1 and DACH2 to regulate muscle development (Heanue et al.,1999), and reported activities of EYA3 in cell culture depend on the presence of SIX1 (Li et al.,2003). Because we found that Xeya3 is expressed within the anterior neuroectoderm and overexpression of Xeya3 induces forebrain and retinal hyperplasia as Six3/Six6 in Xenopus and the teleost medaca (Zuber et al.,1999; Bernier et al.,2000; Carl et al.,2002), it was intuitive to investigate if Eya3 and Six3 cooperate. However, overexpression of Eya3 together with either Six3 or Six6 failed to amplify the respective phenotypes and they did not interact in pull-down assays (data not shown). In line with our results, it has been demonstrated that Drosophila optix, the orthologous gene to vertebrate Six3/6, did not function synergistically with eyes absent, and SIX3 did not facilitate the nuclear entry of EYA3 in COS7 cells, like Six2/4/5 (Ohto et al.,1999; Seimiya and Gehring,2000). Furthermore, neither SIX3 nor SIX6 interact with EYA3 (Ohto et al.,1999), similar to their homologues gene Doptix, which does not interact with eya in Drosophila (Seimiya and Gehring,2000). Because Xsix1 expression is strictly excluded from the neural plate in Xenopus embryos (Pandur and Moody,2000) and it is unlikely that EYA3 directly interacts with SIX3, XEYA3 functions as a cotranscriptional activator may depend on a not yet identified interaction partner in respect to neural development. It is reasonable that an EYA3-specific cofactor or a specific mix of cofactors exists in the anterior neuroectoderm, because we found that the hyperplasia of the brain upon Xeya3 overexpression was strictly limited to this area. In Xenopus, hyperplasia of the forebrain region was also observed upon the activation of the insulin-like growth factor or upon repression of canonical Wnt signalling pathways, respectively, and by overexpression of either Six3 or Six6 (Zuber et al.,1999; Bernier et al.,2000; Pera et al.,2001; Richard-Parpaillon et al.,2002; Lagutin et al.,2003). However, in all these cases, the increase of forebrain tissue was explained by a transdifferentiation/determination of non-neural tissue, which was not observed upon Xeya3 overexpression. Nevertheless, it remains as an open question, if Xeya3 interacts with corresponding downstream factors of the mentioned signalling pathways.

Overexpression of XEYA3 Phosphatase-Dead Mutant Forms

In addition to their function as transcriptional coactivators, EYA proteins bear a protein phosphatase activity, which belongs to the subgroup of the haloacid dehalogenase (HAD) superfamily of phosphatases. The HAD domain of EYA3 alone is able to dephosphorylate phosphorylated tyrosyl residues, whereas the recombinant full-length protein dephosphorylates phosphorylated serine/threonine residues as well (Li et al.,2003; Rayapureddi et al.,2003; Tootle et al.,2003). In Drosophila, several HAD mutant forms of vertebrate EYA1–3 proteins only poorly rescued eyes absent mutant flies, suggesting that the HAD domain contribute significantly to the function of the whole protein. Therefore, at first glance, it was puzzling to see that HAD mutant forms of Xeya3 even led to a dramatic increase in respect to the penetrance and severeness of brain hyperplasia structures upon the injection of wild-type in comparison to the HAD mutant forms. However, several lines of evidence indicate that the phosphatase activity may act as a direct or indirect negative regulator of the cotranscriptional activity of EYA itself. First, full-length EYA is only a weak transactivator in cell culture experiments, whereas eya-delta HAD is up to 50-times more active (Silver et al.,2003). Second, HAD mutations did not abolish the function of EYA as a transcriptional coactivator (Tootle et al.,2003). Third, cotranscriptional activity of EYA is positively regulated by phosphorylation by means of MAPK, and because EYA does dephosphorylate itself in vitro, it is possible that phosphatase-negative mutants cannot turn off their activation by MAPK (Hsiao et al.,2001; Tootle et al.,2003). Moreover, EyaD493N, which carries a point mutation disrupting specifically phosphatase activity, did rescue eya mutant flies (Rayapureddi et al.,2003). Because EYA proteins can form homodimers, and, based on the observation that overexpression of XEYA3 phosphatase mutant forms led to an enhanced activation of cell proliferation in comparison to wild-type XEYA3, HAD mutant forms may act as dominant-negative proteins in respect to their phosphatase activity, resulting in prolongation of the transcriptional activation (Silver et al.,2003). Thus, it is conceivable that one role of the phosphatase activity of EYA proteins is to temporally limit their activities as transcriptional coactivators. A second target of EYA3 phosphatase activity is RNA polymerase II (RNAPII), which is dephosphorylated by EYA3 in vitro. RNAPII is phosphorylated at serine 2, which characterizes the elongating polymerase, and is phosphorylated at serine 5, indicative of the initiating polymerase. Ubiquitylation of RNAPII leads to hyperphosphorylation at serine 5, and to its degradation (Somesh et al.,2005). Although it is not clear if EYA3 dephosphorylates either serine 2 or serine 5 (Li et al.,2003), it is intriguing to see that EYA3 could function to facilitate recycling and/or protection from degradation of RNAPII, leading to transcriptional silencing. Furthermore, phosphatase-deficient EYA3 did not interact with RNAPII in vitro (Li et al.,2003), which may facilitate degradation of RNAPII and, therefore, transcriptional silencing as well. Similarly, mutant SCP1 (small CTD phosphatase; CTD, C-terminal domain of RNAPII) competes with the integration of endogenous SCP1 in a RNAPII complex, which could lead to an increase of serine 5 phosphorylation and, thereby, increase the efficiency of cap formation and transcription (Yeo et al.,2003). Moreover, dephosphorylation of RNAPII at serine 5 by SCP1 represses transcription, whereas a phosphatase mutant of SCP1 (SCP1PTP−) activates it, just like EYA missing the phosphatase domain in a Gal4DBD transactivation assay (Silver et al.,2003; Yeo et al.,2003).

Therefore, we like to suggest that the function of EYA3 is to maintain a neural precursor state, particularly of cells of the anterior neural plate in early development, because EYA3 is neither expressed posteriorly in the neural tube nor at later stages of development during secondary neurogenesis. In consequence, EYA3-deficient neural progenitor cells fail to differentiate and undergo apoptosis. More work is needed to elucidate the precise composition of EYA3 interactions, which may vary in time and space, and to understand its role in the mechanism of transcriptional regulation.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Animals

Pigmented and albino Xenopus laevis were obtained from Nasco (Ft. Atkinson, WI). Production and rearing of embryos was as described (Hollemann et al.,1999). Staging of embryos was done according to Nieuwkoop and Faber (1967).

Cloning of Xenopus Eya3 (Xeya3)

Starting from a Xenopus laevis expressed sequence tag (AW643370), which contained the putative transcriptional start site, missing 3′-sequence information was obtained by 3′-rapid amplification of cDNA ends (RACE) polymerase chain reaction (PCR; SMART RACE cDNA Amplification Kit, BD Biosciences) using the primer Xeya3-3′-Race: CACCATCTTCACCTGTTGTGCTAACATCATCAGGAGTTACC. The full Xeya3 coding region was amplified from stage 36 total RNA by reverse transcriptase-PCR (Xeya3-cds-F: ATGGAGAACGGACAGGATTTAG; Xeya3-cds-R: TCACAAGAAGTCCAGTTCCAG) and cloned into pGEM-T (Promega GmbH). Subcloning into pCS2+ was performed by PCR, using primers with additional ClaI and XhoI restriction sites to the mentioned forward and reverse primers. Rescue constructs were generated by means of a PCR-based two-step mutagenesis (Xeya3-wob-F-1st: ATCGATATGGAGAATGGACAAGATTTGGCAGAGCAG; Xeya3-wob-F-fin: ATCGATATGGAAAATGGGCAAGACTTGGCGGAGCAG) and phosphatase-deficient forms of Xeya3 were generated by means of site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Stratagene). pCS2+ constructs were checked by sequencing and in vitro translation (TnT-Coupled Reticulocyte Lysate System, Promega).

Whole-Mount In Situ Hybridization and Sectioning

To generate antisense RNA probes, corresponding plasmids were digested and transcribed as follows: Xdlx3: EcoRI, T7; Xeya3: SphI, Sp6; Xk81: EcoRI, Sp6; XmyT1: ClaI, T7; N-tubulin: BamHI, T3; Xotx2: NotI, T7; Xpax3: BglII, Sp6; Xrx1: XhoI, Sp6; Xsox3: EcoRI, T7. Whole-mount in situ hybridization was carried out as described. Double stainings were done with digoxigenin- and fluorescein-labeled RNAs followed by FastRed and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) staining, respectively. X-Gal staining was done before whole-mount in situ hybridization. Gelatin/albumin sections were done using a Vibratome (Leica, Germany). Embryos embedded in epoxy resin (Technovit 7100, Heraeus Kulzer, Germany) were sectioned using a microtome (Leica, Germany).

Microinjections and Treatment

To generate synthetic mRNA for microinjections, pCS2+-constructs were cut with NotI and transcribed with SP6 (mMessage mMachine, Ambion). RNA was microinjected in 4-nl aliquots up to 250 pg/nl. Synthetic mRNA for β-galactosidase was co-injected as a tracer at a concentration of 25 pg/nl. Morpholino oligonucleotides (Gene Tool) were injected at 0.1 pmol/nl (Xeya3-morpholino: 5′-CTGCTAAATCCTGTCCGTTCTCCAT). In rescue experiments, synthetic Xeya3-wob-mRNA (250 pg/nl) was co-injected with the Xeya3 morpholino (up to 0.1 pmol/nl). For HUA treatment (Harris and Hartenstein,1991), devitellinized stage 10.5 embryos were cultured in 0.1 × MBS containing 20 mM hydroxyurea and 150 μM aphidicolin (Sigma) until the desired stages (Harris and Hartenstein,1991).

Proliferation/Apoptosis Assays

Apoptotic cells were detected using the TUNEL assay (Hensey and Gautier,1998). Mitotic cells were identified by the detection of phosphorylated histone H3 in neurulae and early tail bud stages as described (Saka and Smith,2001). pH3-positive cells were quantified by counting cell numbers in defined areas of injected (n = 2; mean 96 cells) as well as on the control embryos (n = 2; mean 55 cells).

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We thank R.M. Harland for Xotx2, M. Jamrich for Xrx1, N. Papalopulu for Xdlx3, R.A. Rupp for pCS2+. T.H. was funded by the Deutsche Forschungsgemeinschaft and BMBF.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information
  • Abdelhak S, Kalatzis V, Heilig R, Compain S, Samson D, Vincent C, Weil D, Cruaud C, Sahly I, Leibovici M, Bitner-Glindzicz M, Francis M, Lacombe D, Vigneron J, Charachon R, Boven K, Bedbeder P, Van Regemorter N, Weissenbach J, Petit C. 1997. A human homologue of the Drosophila eyes absent gene underlies branchio-oto-renal (BOR) syndrome and identifies a novel gene family. Nat Genet 15: 157164.
  • Andreazzoli M, Gestri G, Angeloni D, Menna E, Barsacchi G. 1999. Role of Xrx1 in Xenopus eye and anterior brain development. Development 126: 24512460.
  • Azuma N, Hirakiyama A, Inoue T, Asaka A, Yamada M. 2000. Mutations of a human homologue of the Drosophila eyes absent gene (EYA1) detected in patients with congenital cataracts and ocular anterior segment anomalies. Hum Mol Genet 9: 363366.
  • Bernier G, Panitz F, Zhou X, Hollemann T, Gruss P, Pieler T. 2000. Expanded retina territory by midbrain transformation upon overexpression of Six6 (Optx2) in Xenopus embryos. Mech Dev 93: 5969.
  • Bonini NM, Leiserson WM, Benzer S. 1993. The eyes absent gene: genetic control of cell survival and differentiation in the developing Drosophila eye. Cell 72: 379395.
  • Bonini NM, Bui QT, Gray-Board GL, Warrick JM. 1997. The Drosophila eyes absent gene directs ectopic eye formation in a pathway conserved between flies and vertebrates. Development 124: 48194826.
  • Bonini NM, Leiserson WM, Benzer S. 1998. Multiple roles of the eyes absent gene in Drosophila. Dev Biol 196: 4257.
  • Borsani G, DeGrandi A, Ballabio A, Bulfone A, Bernard L, Banfi S, Gattuso C, Mariani M, Dixon M, Donnai D, Metcalfe K, Winter R, Robertson M, Axton R, Brown A, van Heyningen V, Hanson I. 1999. EYA4, a novel vertebrate gene related to Drosophila eyes absent. Hum Mol Genet 8: 1123.
  • Buller C, Xu X, Marquis V, Schwanke R, Xu PX. 2001. Molecular effects of Eya1 domain mutations causing organ defects in BOR syndrome. Hum Mol Genet 10: 27752781.
  • Carl M, Loosli F, Wittbrodt J. 2002. Six3 inactivation reveals its essential role for the formation and patterning of the vertebrate eye. Development 129: 40574063.
  • Chen R, Amoui M, Zhang Z, Mardon G. 1997. Dachshund and eyes absent proteins form a complex and function synergistically to induce ectopic eye development in Drosophila. Cell 91: 893903.
  • Duncan MK, Kos L, Jenkins NA, Gilbert DJ, Copeland NG, Tomarev SI. 1997. Eyes absent: a gene family found in several metazoan phyla. Mamm Genome 8: 479485.
  • Fee BE, Doyle CA, Cleveland JL. 2002. A novel Eyes Absent 2 protein is expressed in the human eye. Gene 285: 221228.
  • Halder G, Callaerts P, Flister S, Walldorf U, Kloter U, Gehring WJ. 1998. Eyeless initiates the expression of both sine oculis and eyes absent during Drosophila compound eye development. Development 125: 21812191.
  • Harris WA, Hartenstein V. 1991. Neuronal determination without cell division in Xenopus embryos. Neuron 6: 499515.
  • Heanue TA, Reshef R, Davis RJ, Mardon G, Oliver G, Tomarev S, Lassar AB, Tabin CJ. 1999. Synergistic regulation of vertebrate muscle development by Dach2, Eya2, and Six1, homologs of genes required for Drosophila eye formation. Genes Dev 13: 32313243.
  • Hensey C, Gautier J. 1998. Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev Biol 203: 3648.
  • Hollemann T, Panitz F, Pieler T. 1999. In situ hybridization techniques with Xenopus embryos. In: RichterJD, editor. A comparative methods approach to the study of oocytes and embryos. Oxford: Oxford University Press. p 279290.
  • Hsiao FC, Williams A, Davies EL, Rebay I. 2001. Eyes absent mediates cross-talk between retinal determination genes and the receptor tyrosine kinase signaling pathway. Dev Cell 1: 5161.
  • Ikeda K, Watanabe Y, Ohto H, Kawakami K. 2002. Molecular interaction and synergistic activation of a promoter by Six, Eya, and Dach proteins mediated through CREB binding protein. Mol Cell Biol 22: 67596766.
  • Kozlowski DJ, Whitfield TT, Hukriede NA, Lam WK, Weinberg ES. 2005. The zebrafish dog-eared mutation disrupts eya1, a gene required for cell survival and differentiation in the inner ear and lateral line. Dev Biol 277: 2741.
  • Lagutin OV, Zhu CC, Kobayashi D, Topczewski J, Shimamura K, Puelles L, Russell HR, McKinnon PJ, Solnica-Krezel L, Oliver G. 2003. Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development. Genes Dev 17: 368379.
  • Leiserson WM, Benzer S, Bonini NM. 1998. Dual functions of the Drosophila eyes absent gene in the eye and embryo. Mech Dev 73: 193202.
  • Li X, Oghi KA, Zhang J, Krones A, Bush KT, Glass CK, Nigam SK, Aggarwal AK, Maas R, Rose DW, Rosenfeld MG. 2003. Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis. Nature 426: 247254.
  • Mathers PH, Grinberg A, Mahon KA, Jamrich M. 1997. The Rx homeobox gene is essential for vertebrate eye development. Nature 387: 603607.
  • Nieuwkoop PD, Faber J. 1967. Normal table of Xenopus laevis (Daudin). Amsterdam: North Holland.
  • Ohto H, Kamada S, Tago K, Tominaga SI, Ozaki H, Sato S, Kawakami K. 1999. Cooperation of six and eya in activation of their target genes through nuclear translocation of Eya. Mol Cell Biol 19: 68156824.
  • Ozaki H, Nakamura K, Funahashi J, Ikeda K, Yamada G, Tokano H, Okamura HO, Kitamura K, Muto S, Kotaki H, Sudo K, Horai R, Iwakura Y, Kawakami K. 2004. Six1 controls patterning of the mouse otic vesicle. Development 131: 551562.
  • Pandur PD, Moody SA. 2000. Xenopus Six1 gene is expressed in neurogenic cranial placodes and maintained in the differentiating lateral lines. Mech Dev 96: 253257.
  • Pera EM, Wessely O, Li SY, De Robertis EM. 2001. Neural and head induction by insulin-like growth factor signals. Dev Cell 1: 655665.
  • Pignoni F, Hu B, Zavitz KH, Xiao J, Garrity PA, Zipursky SL. 1997. The eye-specification proteins So and Eya form a complex and regulate multiple steps in Drosophila eye development. Cell 91: 881891.
  • Rayapureddi JP, Kattamuri C, Steinmetz BD, Frankfort BJ, Ostrin EJ, Mardon G, Hegde RS. 2003. Eyes absent represents a class of protein tyrosine phosphatases. Nature 426: 295298.
  • Richard-Parpaillon L, Heligon C, Chesnel F, Boujard D, Philpott A. 2002. The IGF pathway regulates head formation by inhibiting Wnt signaling in Xenopus. Dev Biol 244: 407417.
  • Ruf RG, Xu PX, Silvius D, Otto EA, Beekmann F, Muerb UT, Kumar S, Neuhaus TJ, Kemper MJ, Raymond RM Jr, Brophy PD, Berkman J, Gattas M, Hyland V, Ruf EM, Schwartz C, Chang EH, Smith RJ, Stratakis CA, Weil D, Petit C, Hildebrandt F. 2004. SIX1 mutations cause branchio-oto-renal syndrome by disruption of EYA1-SIX1-DNA complexes. Proc Natl Acad Sci U S A 101: 80908095.
  • Saka Y, Smith JC. 2001. Spatial and temporal patterns of cell division during early Xenopus embryogenesis. Dev Biol 229: 307318.
  • Schonberger J, Wang L, Shin JT, Kim SD, Depreux FF, Zhu H, Zon L, Pizard A, Kim JB, Macrae CA, Mungall AJ, Seidman JG, Seidman CE. 2005. Mutation in the transcriptional coactivator EYA4 causes dilated cardiomyopathy and sensorineural hearing loss. Nat Genet 37: 418422.
  • Seimiya M, Gehring WJ. 2000. The Drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism. Development 127: 18791886.
  • Silver SJ, Davies EL, Doyon L, Rebay I. 2003. Functional dissection of eyes absent reveals new modes of regulation within the retinal determination gene network. Mol Cell Biol 23: 59895999.
  • Somesh BP, Reid J, Liu WF, Sogaard TM, Erdjument-Bromage H, Tempst P, Svejstrup JQ. 2005. Multiple mechanisms confining RNA polymerase II ubiquitylation to polymerases undergoing transcriptional arrest. Cell 121: 913923.
  • Tomarev SI. 1997. Pax-6, eyes absent, and Prox 1 in eye development. Int J Dev Biol 41: 835842.
  • Tootle TL, Silver SJ, Davies EL, Newman V, Latek RR, Mills IA, Selengut JD, Parlikar BE, Rebay I. 2003. The transcription factor Eyes absent is a protein tyrosine phosphatase. Nature 426: 299302.
  • Wayne S, Robertson NG, DeClau F, Chen N, Verhoeven K, Prasad S, Tranebjarg L, Morton CC, Ryan AF, Van Camp G, Smith RJ. 2001. Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus. Hum Mol Genet 10: 195200.
  • Xu PX, Woo I, Her H, Beier DR, Maas RL. 1997. Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development 124: 219231.
  • Xu PX, Zhang X, Heaney S, Yoon A, Michelson AM, Maas RL. 1999. Regulation of Pax6 expression is conserved between mice and flies. Development 126: 383395.
  • Yeo M, Lin PS, Dahmus ME, Gill GN. 2003. A novel RNA polymerase II C-terminal domain phosphatase that preferentially dephosphorylates serine 5. J Biol Chem 278: 2607826085.
  • Zimmerman JE, Bui QT, Steingrimsson E, Nagle DL, Fu W, Genin A, Spinner NB, Copeland NG, Jenkins NA, Bucan M, Bonini NM. 1997. Cloning and characterization of two vertebrate homologs of the Drosophila eyes absent gene. Genome Res 7: 128141.
  • Zuber ME, Perron M, Philpott A, Bang A, Harris WA. 1999. Giant eyes in Xenopus laevis by overexpression of XOptx2. Cell 98: 341352.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The Supplementary Material referred to in this article can be found at http://www.interscience.wiley.com/jpages/1058-8388/suppmat

FilenameFormatSizeDescription
jws-dvdy.21170.fig1.tif1828K Supplementary figure 1: Xeya3is a member of theEyes absentfamily of proteins.(A) Alignment of the primary structures of Xenopus laevis, human and mouse Eyes absent homolog 3. The well conserved C-terminalEya -domain is boxed. The region with homology to the family of haloacid-dehalogenase-related phosphohydrolases (HAD) is shown in yellow, the catalytic (3; WDLDETI) and Mg 2+ -binding motifs (4; IGDGRDEE) are boxed. Putative phosphorylation sites are shown in bold letters. A conserved putative Abl_1 Kinase domain (1) and a Ship-SH2 domain (2) are boxed. (B) Amino acid identity betweenXeya3and other members of theEyes absentfamily of proteins. Abbreviations:(dm) Drosophila melanogaster, (hs) Homo sapiens, (mm) Mus musculus, (xl) Xenopus laevis .
jws-dvdy.21170.fig2.tif4156K Supplementary figure 2:Gain ofXeya3function causes hyperplasia of derivatives of the anterior neural plate. (A-A??, lateral view and transversal sections) Increase in eye and brain size (white and black arrowheads in A?). Ectopic retinal pigment in areas derivative from neural crest (black arrowhead in A,A??) upon microinjection of 800 pg ofXeya3mRNA. (B-E?) Lateral view and transversal sections. Alterations of retinal development characterized by multiple invaginations of the retina (black arrowheads in C?), formation of coloboma (B, C, C?) and hyperplasia of brain tissue (D, D?) upon microinjection of 1 ng ofXeya3mRNA. In hypertrophic brains, formation of ectopic neural ventricular-like structures occured (?2.? in D,D?). Neural structures posterior to the endogenousXeya3expression domain do not show any anomalies (see neural tube in E?). Abbreviations: is, injected side; le, lens; nt, neural tube.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.